The steroid hormone 20-hydroxyecdysone (20E) is essential for proper development and the timing of intermediary stage transitions in insects. As a result, there is intense interest in identifying and defining the roles of the enzymes and signaling pathways that regulate 20E production in the prothoracic gland (PG), the major endocrine organ of juvenile insect phases. Transcriptomics is one powerful tool that has been used to identify novel genes that are up- or down-regulated in the PG which may contribute to 20E regulation. Additional functional characterization of putative regulatory candidate genes typically involves qRT-PCR and/or RNAi mediated knockdown of the candidate mRNA in the PG to assess whether the gene’s expression shows temporal regulation in the PG and whether its expression is essential for proper 20E production and the correct timing of developmental transitions. While these methods have proved fruitful for identifying novel regulators of 20E production, characterizing the null phenotype of putative regulatory genes is the gold standard for assigning gene function since RNAi is known to generate various types of “off target” effects. Here we describe the genetic null mutant phenotype of the Drosophila melanogaster Cyp6t3 gene. Cyp6t3 was originally identified as a differentially regulated gene in a PG microarray screen and assigned a place in the “Black Box” step of the E biosynthetic pathway based on RNAi mediated knockdown phenotypes and rescue experiments involving feeding of various intermediate compounds of the E biosynthetic pathway. In contrast, we find that Crispr generated null mutations in Cyp6t3 are viable and have normal developmental timing. Therefore, we conclude that Cyp6t3 is not required for E production under typical lab growth conditions and therefore is not an obligate enzymatic component of the Black Box.
","acknowledgements":"The authors wish to thank Aidan Peterson for critical review and helpful comments.","authors":[{"affiliations":["University of Minnesota"],"departments":[""],"credit":["writing_originalDraft","methodology","formalAnalysis"],"email":"oconn033@umn.edu","firstName":"MaryJane ","lastName":"Shimell ","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":"","orcid":""},{"affiliations":["University of Minnesota"],"departments":[""],"credit":["conceptualization","fundingAcquisition","writing_reviewEditing"],"email":"moconnor@umn.edu","firstName":"Michael B","lastName":"O'Connor","submittingAuthor":false,"correspondingAuthor":null,"equalContribution":null,"WBId":"","orcid":null}],"awards":null,"conflictsOfInterest":null,"dataTable":null,"extendedData":[],"funding":"NIGMS R35-118029","image":{"url":"https://portal.micropublication.org/uploads/852d4241ab8a976c18ff505815230b2d.jpg"},"imageCaption":"A. Ecdysone biosynthetic pathway. The feeding substrates for placement in the Black Box are shown in red. Number of arrows in the Black Box is for illustrative purpose only. B. Cartoon of the Cyp6t3 genomic region. Exons are shown in light blue and dashed lines denote the Cytochrome P450 domain. Sequences for the guide RNAs are shown in anti-sense because the targeted sequence is the negative DNA strand. Three new alleles are described below. C. Clustal alignment. Cyp6t3 aligned with Cyp6t3 mutant proteins. Pale green highlight indicates amino acid identity. Note that Cyp6t3[Cr1] and Cyp6t3[Cr3] are early truncations, while more than 80% of the protein is retained in Cyp6t3[Cr2]. D. Developmental timing. Cyp6t3 transheterozygous combinations and wild type (black line). Non-linear regression using Prism software with 50% pupariation indicated by dashed line.
","imageTitle":"","methods":"Crispr mutant generation
The CRISPR Optimal Target Finder (Gratz et al. 2014) was employed to identify two target sites within Cyp6t3 with no off-target sites. The targets with the PAM are: 5’ GGATCCCG¯AACCATAAGCGC CGG 3’ and 5’ GGATCAAA ¯ GACGCAGGGCTC CGG 3’. Sense and antisense oligonucleotides (Oligo Table) for the two guides RNAs were cloned into pU6-BbsI-chiRNA (Addgene #45946; Gratz et al. 2013). Both guide RNAs were injected into vas-Cas9 embryos (BDSC51323, BestGene, Chino Hills CA). Single G0 flies were screened by PCR using primers cyp6t3 01F and cyp6t3 02R (Oligo Table) for the presence of deletions, making them candidates for further analysis. Ten to fifteen individual F1 progeny of G0 flies that displayed multiple deletion bands by PCR (possible Cr mutant/+) were then crossed to a CyO balancer, homozygosed, the DNA region amplified by PCR and then sequenced for the presence of a mutation and its precise location. Both Cyp6t3[Cr1] and Cyp6t3[Cr2] mutations were obtained from a single G0 fly.
Clustal omega analysis used SnapGene software.
Developmental timing
Crosses were set up in cages. Four-hour collections of embryos on yeast-apple juice plates were aged about 16 hours, until 1st instar larvae started to emerge. 30-35 larvae were transferred to vial food (Bloomington standard cornmeal food) sprinkled with dry yeast and allowed to grow at 25° with a 12-hour light/dark cycle. Pupariation was scored every 2 hours with the data from 4 vials combined due to the speed of pupariation and lack of data points necessary for non-linear regression analysis in Prism (asymmetric Sigmoidal, 5PL).
","reagents":"Oligo Table
CTTCGGATCCCGAACCATAAGCGC | sense Guide 1 | Crispr |
AAACGCGCTTATGGTTCGGGATCC | antisense Guide 1 | Crispr |
CTTCGGATCAAAGACGCAGGGCTC | sense Guide 2 | Crispr |
AAACGAGCCCTGCGTCTTTGATCC | antisense Guide 2 | Crispr |
GTCCCATCAGGTTGCCC | cyp6t3 01F | PCR, sequencing |
GCAGAGCTTTGAATCGAATTTGG | cyp6t3 02R | PCR, sequencing |
Fly lines
y[1] M{RFP[3xP3.PB] GFP[E.3xP3]=vas-Cas9}ZH-2A w[1118]/FM7c | BDSC 51323 |
w[*]; sna[Sco]/CyO, S[*] bw[1] | BDSC 3198 |
In all Arthropods, the steroid hormone ecdysone (E) acts to control molting and metamorphosis (Qu et al. 2015). During the past two decades, many of the enzymatic steps that convert dietary cholesterol to ecdysone in the insect Drosophila melanogaster have been identified and their activities ordered within a biosynthetic pathway. (Figure 1A, Chávez et al. 2000, Warren et al. 2002, Warren et al. 2004, Niwa et al. 2004, Yoshiyama-Yanagawa et al. 2011). Collectively, these genes are referred to as the Halloween group (Warren et al. 2002) and include phm, dib, sad, sro,and spo which were first identified in the embryonic lethal screens of Nüsslein-Volhard, Wieschaus, and Jürgens as mutants that failed to produce differentiated cuticle (Nüsslein-Volhard et al. 1984, Wieschaus et al. 1984, Jürgens et al. 1984). A closer examination of the embryo proper revealed that null mutants in these genes all exhibit a common phenotype characterized by arrest at embryonic stages 15-17 with failures of head involution, dorsal closure, and cuticle production (Chávez et al. 2000, Warren et al. 2002, Petryk et al. 2003, Niwa et al. 2004, Warren et al. 2004). Subsequent genetic and biochemical analysis demonstrated that each of these gene products acts at a specific step in the biosynthetic pathway and their loss results in failure to synthesize ecdysone, and hence they all produce an identical loss-of-function phenotype.
Despite this progress, there remains uncertainty in the enzymes and reactions involved in an early step of the pathway termed the “Black Box”. The name arises because the chemical intermediates between the upstream 7-dehydrocholesterol (7dC) and the downstream 5b-ketodiol have eluded isolation (Gilbert et al. 2002). Nevertheless, the activity of several gene products including Shroud (Sro), Spo/Spok, Cyp6t3 and Cyp6u1 have been suggested to act within the Black Box based on rescue experiments that involve feeding mutant larvae intermediate compounds that are thought to be upstream and downstream of the Black Box enzymes. In these experiments, feeding the downstream intermediate 5b-ketodiol rescues loss-of-function larvae and enables them to progress through additional molts while feeding the upstream intermediate 7dC does not (Figure 1A). (Niwa et al. 2010; Ono et al. 2006; Ou et al. 2011; Christesen et al. 2017).
Since all Halloween null mutants are embryonic lethal, the feeding experiments which helped position various gene products in the biosynthetic pathway sometimes involved bypassing the embryonic lethality by using RNAi to specifically knockdown the function of these genes in the prothoracic gland (PG), the source of larval ecdysone. The embryonic tissue source of E is still unknown. Strong RNAi knockdown in the PG of any of the Halloween gene products leads to first instar arrest. However, feeding the larvae various intermediates often enables them to progress into the second and third instar stage, provided the intermediate is downstream of the enzymatic block. These types of experiments suggested that the Sro and Spo/Spok enzymes are components of the Black Box.
The identification of Cyp6t3 and Cyp6u1 genes as encoding possible factors of the E biosynthetic pathway came about differently from classical genetic studies. Cyp6t3 was identified as a gene that was specifically up-regulated in the PG in response to loss of the transcription factor DHR4. (Ou et al. 2011). DHR4 mutants pupariate early likely because of precocious ecdysone production, and simultaneous knockdown of Cyp6t3 in a DHR4 mutant background suppressed the early pupation phenotype. In addition, RNAi knockdown of Cyp6t3 in the PGs of wild type animals resulted in slow growth and large pupae, both of which were suppressed by feeding knockdown larvae ecdysone or 5b-ketodiol but not 7-dC suggesting that, like Spo/Spok and Sro, this enzyme works at the Black Box step. Because of the low transcript abundance of Cyp6t3, it was also hypothesized that Cyp6t3 might be a “bottleneck” in ecdysone biosynthesis, or even rate limiting. Cyp6u1 was identified in a genome wide transcriptome analysis of the PG as a P450 that showed high level expression specifically in the PG, and RNAi knockdown in the PG led to a developmental delay/arrest phenotype which was rescued by feeding ecdysone or 5b-ketodiol but not 7-dC, again positioning this enzyme at the Black Box step.
Since it has been reported that tissue-specific knockdown of genes can have more severe phenotypes than genetic null mutations (Gibbens et al. 2011, Ohhara et al. 2015), we made Crispr-mediated null mutations in Cyp6t3 as an additional means to assess its function during Drosophila development. Guide RNAs from both ends of the Cyp6t3 cytochrome P450 domain were simultaneously injected into a Cas9 stock (Bestgene Inc.) for the purpose of generating mutations at each individual site as well as potential deletions between the sites. After screening the progeny of the G0 flies, we obtained 3 mutations Cyp6t3[Cr1], a 1 bp deletion at Guide 1, Cyp6t3[Cr2], a 2 bp deletion at Guide 2, and Cyp6t3[Cr3], a 1 kbp deletion between Guides 1 and 2 (Figure 1B). Translation of these mutated genes yields proteins with different premature stops or a large deletion within the Cytochrome P450 domain of Cyp6t3 (Figure 1C). All three mutations are homozygous viable. For this reason alone, we deemed Cyp6t3 a non-essential gene for ecdysone biosynthesis.
Although loss of Cyp6t3 is not essential for animal survival, we reasoned that it could affect the rate of ecdysone biosynthesis. Previous work has shown that either raising or lowering the basal E biosynthetic rate leads to advanced or delayed timing of pupariation, respectively (Ou et al. 2016, Koyama et al. 2014, and Shimell et al. 2018). To address this issue, we assessed the time to pupariation of various Cyp6t3 mutant combinations (Figure 1D). In sum, we find no delay in developmental timing compared to the wild type control suggesting that the basal rate of ecdysone synthesis in the Cyp6t3 mutants is on par with wild type.
The fact that Cyp6t3 is not an essential component of the E biosynthetic pathway under lab growth conditions should not be surprising since, unlike the other Halloween genes that are highly conserved across all arthropods examined to date, Cyp6t3 has been lost in some clades (Ou et al. 2011 and Good RT et al. 2014). In addition, as previously noted, the transcript abundance of Cypt6t3 is very low by qRT-PCR (Ou et al. 2011) and did not make the cutoff in 2 different ring gland-specific transcriptional profiles, the only putative E biosynthetic P450 gene failing to do so (Ou et al. 2016 and Christesen et al. 2017). Despite these observations, the regulation of Cyp6t3 transcription by DHR4 and its ability to suppress the precocious DHR4 mutant phenotype when knocked down in the PG remains intriguing. It would be interesting to determine whether a Cyp6t3, DHR[1] double mutant shows the same suppression of precocious pupariation as found when RNAi is used to knockdown Cyp6t3 in the PG of a DHR[1] mutant. It is also possible that Cyp6t3 is important under specialized growth conditions that modulate DHR4 activity. Another possibility is that Cyp6t3 function is redundant in D. melanogaster, and perhaps other species, with another P450 enzyme. Precedence for the existence of partial redundance in E biosynthetic enzymes in insects is exemplified by the Spo/Spok relationship (Ono et al. 2006). Both are thought to function within the Black Box but at different developmental stages, Spo acting embryonically and in female follicle cells while Spok acts in the PG during larval stages. One intriguing candidate for a redundant activity could be Cyp6u1. This gene product is also a member of the P450 clade 6 subgroup but is highly conserved across Arthropoda (Good RT et al. 2014). Examining the phenotype of Cyp6u1 null mutants and Cyp6t3;Cyp6u1 double mutants might provide insight on the redundancy issue.
In summary, our studies do not resolve the enigma of the Black Box reaction mechanism in the E biosynthetic pathway. However, our elimination of Cyp6t3 involvement under standard growth conditions helps reduce the complexity of the necessary components. This should aid in simplifying the design of future studies aimed at understanding the details of the biochemical reactions catalyzed by the Blackbox enzymes and whether their regulation serves as a rate limiting step in E biosynthesis as previously suggested (Gilbert et al. 2002).
","references":[{"reference":"Christesen D, Yang YT, Somers J, Robin C, Sztal T, Batterham P, Perry T. 2017. Transcriptome Analysis of Drosophila melanogaster Third Instar Larval Ring Glands Points to Novel Functions and Uncovers a Cytochrome p450 Required for Development. G3 (Bethesda) 7: 467-479.","pubmedId":"27974438","doi":""},{"reference":"Chávez VM, Marqués G, Delbecque JP, Kobayashi K, Hollingsworth M, Burr J, Natzle JE, O'Connor MB. 2000. The Drosophila disembodied gene controls late embryonic morphogenesis and codes for a cytochrome P450 enzyme that regulates embryonic ecdysone levels. Development 127: 4115-26.","pubmedId":"10976044","doi":""},{"reference":"Gibbens YY, Warren JT, Gilbert LI, O'Connor MB. 2011. Neuroendocrine regulation of Drosophila metamorphosis requires TGFbeta/Activin signaling. Development 138: 2693-703.","pubmedId":"21613324","doi":""},{"reference":"Good RT, Gramzow L, Battlay P, Sztal T, Batterham P, Robin C. 2014. The molecular evolution of cytochrome P450 genes within and between drosophila species. Genome Biol Evol 6: 1118-34.","pubmedId":"24751979","doi":""},{"reference":"Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O'Connor-Giles KM. 2013. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 194: 1029-35.","pubmedId":"23709638","doi":""},{"reference":"Gratz SJ, Ukken FP, Rubinstein CD, Thiede G, Donohue LK, Cummings AM, O'Connor-Giles KM. 2014. Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila. Genetics 196: 961-71.","pubmedId":"24478335","doi":""},{"reference":"Jürgens G, Wieschaus E, Nüsslein-Volhard C, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : II. Zygotic loci on the third chromosome. Wilehm Roux Arch Dev Biol 193: 283-295.","pubmedId":"28305338","doi":""},{"reference":"Koyama T, Rodrigues MA, Athanasiadis A, Shingleton AW, Mirth CK. 2014. Nutritional control of body size through FoxO-Ultraspiracle mediated ecdysone biosynthesis. Elife 3: .","pubmedId":"25421296","doi":""},{"reference":"Niwa R, Matsuda T, Yoshiyama T, Namiki T, Mita K, Fujimoto Y, Kataoka H. 2004. CYP306A1, a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis in the prothoracic glands of Bombyx and Drosophila. J Biol Chem 279: 35942-9.","pubmedId":"15197185","doi":""},{"reference":"Niwa R; Namiki T; Ito K; Shimada-Niwa Y; Kiuchi M; Kawaoka S; et al.; Shinoda T. 2010. Non-molting glossy/shroud encodes a short-chain dehydrogenase/reductase that functions in the 'Black Box' of the ecdysteroid biosynthesis pathway. Development 137: 1991-9.","pubmedId":"20501590","doi":""},{"reference":"Nüsslein-Volhard C, Wieschaus E, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : I. Zygotic loci on the second chromosome. Wilehm Roux Arch Dev Biol 193: 267-282.","pubmedId":"28305337","doi":""},{"reference":"Ohhara Y; Shimada-Niwa Y; Niwa R; Kayashima Y; Hayashi Y; Akagi K; et al.; Kobayashi S. 2015. Autocrine regulation of ecdysone synthesis by β3-octopamine receptor in the prothoracic gland is essential for Drosophila metamorphosis. Proc Natl Acad Sci U S A 112: 1452-7.","pubmedId":"25605909","doi":""},{"reference":"Ono H; Rewitz KF; Shinoda T; Itoyama K; Petryk A; Rybczynski R; et al.; O'Connor MB. 2006. Spook and Spookier code for stage-specific components of the ecdysone biosynthetic pathway in Diptera. Dev Biol 298: 555-70.","pubmedId":"16949568","doi":""},{"reference":"Ou Q, Zeng J, Yamanaka N, Brakken-Thal C, O'Connor MB, King-Jones K. 2016. The Insect Prothoracic Gland as a Model for Steroid Hormone Biosynthesis and Regulation. Cell Rep 16: 247-262.","pubmedId":"27320926","doi":""},{"reference":"Petryk A; Warren JT; Marqués G; Jarcho MP; Gilbert LI; Kahler J; et al.; O'Connor MB. 2003. Shade is the Drosophila P450 enzyme that mediates the hydroxylation of ecdysone to the steroid insect molting hormone 20-hydroxyecdysone. Proc Natl Acad Sci U S A 100: 13773-8.","pubmedId":"14610274","doi":""},{"reference":"Qu Z, Kenny NJ, Lam HM, Chan TF, Chu KH, Bendena WG, Tobe SS, Hui JH. 2015. How Did Arthropod Sesquiterpenoids and Ecdysteroids Arise? Comparison of Hormonal Pathway Genes in Noninsect Arthropod Genomes. Genome Biol Evol 7: 1951-9.","pubmedId":"26112967","doi":""},{"reference":"Saito J, Kimura R, Kaieda Y, Nishida R, Ono H. 2016. Characterization of candidate intermediates in the Black Box of the ecdysone biosynthetic pathway in Drosophila melanogaster: Evaluation of molting activities on ecdysteroid-defective larvae. J Insect Physiol 93-94: 94-104.","pubmedId":"27662806","doi":""},{"reference":"Shimell M, Pan X, Martin FA, Ghosh AC, Leopold P, O'Connor MB, Romero NM. 2018. Prothoracicotropic hormone modulates environmental adaptive plasticity through the control of developmental timing. Development 145: .","pubmedId":"29467242","doi":""},{"reference":"Warren JT, O'Connor MB, Gilbert LI. 2009. Studies on the Black Box: incorporation of 3-oxo-7-dehydrocholesterol into ecdysteroids by Drosophila melanogaster and Manduca sexta. Insect Biochem Mol Biol 39: 677-87.","pubmedId":"19699302","doi":""},{"reference":"Warren JT, Petryk A, Marques G, Jarcho M, Parvy JP, Dauphin-Villemant C, O'Connor MB, Gilbert LI. 2002. Molecular and biochemical characterization of two P450 enzymes in the ecdysteroidogenic pathway of Drosophila melanogaster. Proc Natl Acad Sci U S A 99: 11043-8.","pubmedId":"12177427","doi":""},{"reference":"Warren JT; Petryk A; Marqués G; Parvy JP; Shinoda T; Itoyama K; et al.; Gilbert LI. 2004. Phantom encodes the 25-hydroxylase of Drosophila melanogaster and Bombyx mori: a P450 enzyme critical in ecdysone biosynthesis. Insect Biochem Mol Biol 34: 991-1010.","pubmedId":"15350618","doi":""},{"reference":"Wieschaus E, Nüsslein-Volhard C, Jürgens G. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : III. Zygotic loci on the X-chromosome and fourth chromosome. Wilehm Roux Arch Dev Biol 193: 296-307.","pubmedId":"28305339","doi":""}],"title":"The cytochrome P450 Cyp6t3 is not required for ecdysone biosynthesis in Drosophila melanogaster
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"b6cc0316-070f-4aa0-8503-e6e5fbed9692","decision":"revise","abstract":"The steroid hormone 20-hydroxyecdysone (20E) is essential for proper development and the timing of intermediary stage transitions in insects. As a result, there is intense interest in identifying and defining the roles of the enzymes and signaling pathways that regulate 20E production in the prothoracic gland (PG), the major endocrine organ of juvenile insect phases. Transcriptomics is one powerful tool that has been used to identify novel genes that are up- or down-regulated in the PG which may contribute to 20E regulation. Additional functional characterization of putative regulatory candidate genes typically involves qRT-PCR and/or RNAi mediated knockdown of the candidate mRNA in the PG to assess whether the gene’s expression shows temporal regulation in the PG and whether its expression is essential for proper 20E production and the correct timing of developmental transitions. While these methods have proved fruitful for identifying novel regulators of 20E production, characterizing the null phenotype of putative regulatory genes is the gold standard for assigning gene function since RNAi is known to generate various types of “off target” effects. Here we describe the genetic null mutant phenotype of the Drosophila melanogaster Cyp6t3 gene. Cyp6t3 was originally identified as a differentially regulated gene in a PG microarray screen and assigned a place in the “Black Box” step of the E biosynthetic pathway based on RNAi mediated knockdown phenotypes and rescue experiments involving feeding of various intermediate compounds of the E biosynthetic pathway. In contrast, we find that Crispr generated null mutations in Cyp6t3 are viable and have normal developmental timing. Therefore, we conclude that Cyp6t3 is not required for E production under typical lab growth conditions and therefore is not an obligate enzymatic component of the Black Box.
","acknowledgements":"The authors wish to thank Aidan Peterson for critical review and helpful comments.","authors":[{"affiliations":["University of Minnesota"],"departments":[""],"credit":["writing_originalDraft","methodology","formalAnalysis"],"email":"oconn033@umn.edu","firstName":"MaryJane ","lastName":"Shimell ","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":"","orcid":""},{"affiliations":["University of Minnesota"],"departments":[""],"credit":["conceptualization","fundingAcquisition","writing_reviewEditing"],"email":"moconnor@umn.edu","firstName":"Michael B","lastName":"O'Connor","submittingAuthor":false,"correspondingAuthor":null,"equalContribution":null,"WBId":"","orcid":null}],"awards":null,"conflictsOfInterest":null,"dataTable":null,"extendedData":[],"funding":"NIGMS R35-118029","image":{"url":"https://portal.micropublication.org/uploads/91fc4f74af78a0d8ce163b8e445f323a.jpg"},"imageCaption":"A. Ecdysone biosynthetic pathway. The feeding substrates for placement in the Black Box are shown in red. Number of arrows in the Black Box is for illustrative purpose only. B. Cartoon of the Cyp6t3 genomic region. Exons are shown in light blue and dashed lines denote the Cytochrome P450 domain. Sequences for the guide RNAs are shown in anti-sense because the targeted sequence is the negative DNA strand. Three new alleles are described below. C. Clustal alignment. Cyp6t3 aligned with Cyp6t3 mutant proteins. Pale green highlight indicates amino acid identity. Note that Cyp6t3[Cr1] and Cyp6t3[Cr3] are early truncations, while more than 80% of the protein is retained in Cyp6t3[Cr2]. D. Developmental timing. Cyp6t3 transheterozygous combinations and wild type (black line). Non-linear regression using Prism software with 50% pupariation indicated by dashed line.
","imageTitle":"","methods":"Crispr mutant generation
The CRISPR Optimal Target Finder (Gratz et al. 2014) was employed to identify two target sites within Cyp6t3 with no off-target sites. The targets with the PAM are: 5’ GGATCCCG¯AACCATAAGCGC CGG 3’ and 5’ GGATCAAA ¯ GACGCAGGGCTC CGG 3’. Sense and antisense oligonucleotides (Oligo Table) for the two guides RNAs were cloned into pU6-BbsI-chiRNA (Addgene #45946; Gratz et al. 2013). Both guide RNAs were injected into vas-Cas9 embryos (BDSC51323, BestGene, Chino Hills CA). Single G0 flies were screened by PCR using primers cyp6t3 01F and cyp6t3 02R (Oligo Table) for the presence of deletions, making them candidates for further analysis. Ten to fifteen individual F1 progeny of G0 flies that displayed multiple deletion bands by PCR (possible Cr mutant/+) were then crossed to a CyO balancer, homozygosed, the DNA region amplified by PCR and then sequenced for the presence of a mutation and its precise location. Both Cyp6t3[Cr1] and Cyp6t3[Cr2] mutations were obtained from a single G0 fly.
Clustal omega analysis used SnapGene software.
Developmental timing
Crosses were set up in cages. Four-hour collections of embryos on yeast-apple juice plates were aged about 16 hours, until 1st instar larvae started to emerge. 30-35 larvae were transferred to vial food (Bloomington standard cornmeal food) sprinkled with dry yeast and allowed to grow at 25° with a 12-hour light/dark cycle. Pupariation was scored every 2 hours with the data from 4 vials combined due to the speed of pupariation and lack of data points necessary for non-linear regression analysis in Prism (asymmetric Sigmoidal, 5PL).
","reagents":"Oligo Table
CTTCGGATCCCGAACCATAAGCGC | sense Guide 1 | Crispr |
AAACGCGCTTATGGTTCGGGATCC | antisense Guide 1 | Crispr |
CTTCGGATCAAAGACGCAGGGCTC | sense Guide 2 | Crispr |
AAACGAGCCCTGCGTCTTTGATCC | antisense Guide 2 | Crispr |
GTCCCATCAGGTTGCCC | cyp6t3 01F | PCR, sequencing |
GCAGAGCTTTGAATCGAATTTGG | cyp6t3 02R | PCR, sequencing |
Fly lines
y[1] M{RFP[3xP3.PB] GFP[E.3xP3]=vas-Cas9}ZH-2A w[1118]/FM7c | BDSC 51323 |
w[*]; sna[Sco]/CyO, S[*] bw[1] | BDSC 3198 |
In all Arthropods, the steroid hormone ecdysone (E) acts to control molting and metamorphosis (Qu et al. 2015). During the past two decades, many of the enzymatic steps that convert dietary cholesterol to ecdysone in the insect Drosophila melanogaster have been identified and their activities ordered within a biosynthetic pathway. (Figure 1A, Chávez et al. 2000, Warren et al. 2002, Warren et al. 2004, Niwa et al. 2004, Yoshiyama-Yanagawa et al. 2011). Collectively, these genes are referred to as the Halloween group (Warren et al. 2002) and include phm, dib, sad, sro,and spo which were first identified in the embryonic lethal screens of Nüsslein-Volhard, Wieschaus, and Jürgens as mutants that failed to produce differentiated cuticle (Nüsslein-Volhard et al. 1984, Wieschaus et al. 1984, Jürgens et al. 1984). A closer examination of the embryo proper revealed that null mutants in these genes all exhibit a common phenotype characterized by arrest at embryonic stages 15-17 with failures of head involution, dorsal closure, and cuticle production (Chávez et al. 2000, Warren et al. 2002, Petryk et al. 2003, Niwa et al. 2004, Warren et al. 2004). Subsequent genetic and biochemical analysis demonstrated that each of these gene products acts at a specific step in the biosynthetic pathway and their loss results in failure to synthesize ecdysone, and hence they all produce an identical loss-of-function phenotype.
Despite this progress, there remains uncertainty in the enzymes and reactions involved in an early step of the pathway termed the “Black Box”. The name arises because the chemical intermediates between the upstream 7-dehydrocholesterol (7dC) and the downstream 5b-ketodiol have eluded isolation (Gilbert et al. 2002). Nevertheless, the activity of several gene products including Shroud (Sro), Spo/Spok, Cyp6t3 and Cyp6u1 have been suggested to act within the Black Box based on rescue experiments that involve feeding mutant larvae intermediate compounds that are thought to be upstream and downstream of the Black Box enzymes. In these experiments, feeding the downstream intermediate 5b-ketodiol rescues loss-of-function larvae and enables them to progress through additional molts while feeding the upstream intermediate 7dC does not (Figure 1A). (Niwa et al. 2010; Ono et al. 2006; Ou et al. 2011; Christesen et al. 2017).
Since all Halloween null mutants are embryonic lethal, the feeding experiments which helped position various gene products in the biosynthetic pathway sometimes involved bypassing the embryonic lethality by using RNAi to specifically knockdown the function of these genes in the prothoracic gland (PG), the source of larval ecdysone. The embryonic tissue source of E is still unknown. Strong RNAi knockdown in the PG of any of the Halloween gene products leads to first instar arrest. However, feeding the larvae various intermediates often enables them to progress into the second and third instar stage, provided the intermediate is downstream of the enzymatic block. These types of experiments suggested that the Sro and Spo/Spok enzymes are components of the Black Box.
The identification of Cyp6t3 and Cyp6u1 genes as encoding possible factors of the E biosynthetic pathway came about differently from classical genetic studies. Cyp6t3 was identified as a gene that was specifically up-regulated in the PG in response to loss of the transcription factor DHR4. (Ou et al. 2011). DHR4 mutants pupariate early likely because of precocious ecdysone production, and simultaneous knockdown of Cyp6t3 in a DHR4 mutant background suppressed the early pupation phenotype. In addition, RNAi knockdown of Cyp6t3 in the PGs of wild type animals resulted in slow growth and large pupae, both of which were suppressed by feeding knockdown larvae ecdysone or 5b-ketodiol but not 7-dC suggesting that, like Spo/Spok and Sro, this enzyme works at the Black Box step. Because of the low transcript abundance of Cyp6t3, it was also hypothesized that Cyp6t3 might be a “bottleneck” in ecdysone biosynthesis, or even rate limiting. Cyp6u1 was identified in a genome wide transcriptome analysis of the PG as a P450 that showed high level expression specifically in the PG, and RNAi knockdown in the PG led to a developmental delay/arrest phenotype which was rescued by feeding ecdysone or 5b-ketodiol but not 7-dC, again positioning this enzyme at the Black Box step.
Since it has been reported that tissue-specific knockdown of genes can have more severe phenotypes than genetic null mutations (Gibbens et al. 2011, Ohhara et al. 2015), we made Crispr-mediated null mutations in Cyp6t3 as an additional means to assess its function during Drosophila development. Guide RNAs from both ends of the Cyp6t3 cytochrome P450 domain were simultaneously injected into a Cas9 stock (Bestgene Inc.) for the purpose of generating mutations at each individual site as well as potential deletions between the sites. After screening the progeny of the G0 flies, we obtained 3 mutations Cyp6t3[Cr1], a 1 bp deletion at Guide 1, Cyp6t3[Cr2], a 2 bp deletion at Guide 2, and Cyp6t3[Cr3], a 1 kbp deletion between Guides 1 and 2 (Figure 1B). Translation of these mutated genes yields proteins with different premature stops or a large deletion within the Cytochrome P450 domain of Cyp6t3 (Figure 1C). All three mutations are homozygous viable. For this reason alone, we deemed Cyp6t3 a non-essential gene for ecdysone biosynthesis.
Although loss of Cyp6t3 is not essential for animal survival, we reasoned that it could affect the rate of ecdysone biosynthesis. Previous work has shown that either raising or lowering the basal E biosynthetic rate leads to advanced or delayed timing of pupariation, respectively (Ou et al. 2016, Koyama et al. 2014, and Shimell et al. 2018). To address this issue, we assessed the time to pupariation of various Cyp6t3 mutant combinations (Figure 1D). In sum, we find no delay in developmental timing compared to the wild type control suggesting that the basal rate of ecdysone synthesis in the Cyp6t3 mutants is on par with wild type.
The fact that Cyp6t3 is not an essential component of the E biosynthetic pathway under lab growth conditions should not be surprising since, unlike the other Halloween genes that are highly conserved across all arthropods examined to date, Cyp6t3 has been lost in some clades (Ou et al. 2011 and Good RT et al. 2014). In addition, as previously noted, the transcript abundance of Cypt6t3 is very low by qRT-PCR (Ou et al. 2011) and did not make the cutoff in 2 different ring gland-specific transcriptional profiles, the only putative E biosynthetic P450 gene failing to do so (Ou et al. 2016 and Christesen et al. 2017). Despite these observations, the regulation of Cyp6t3 transcription by DHR4 and its ability to suppress the precocious DHR4 mutant phenotype when knocked down in the PG remains intriguing. It would be interesting to determine whether a Cyp6t3, DHR[1] double mutant shows the same suppression of precocious pupariation as found when RNAi is used to knockdown Cyp6t3 in the PG of a DHR[1] mutant. It is also possible that Cyp6t3 is important under specialized growth conditions that modulate DHR4 activity. Another possibility is that Cyp6t3 function is redundant in D. melanogaster, and perhaps other species, with another P450 enzyme. Precedence for the existence of partial redundance in E biosynthetic enzymes in insects is exemplified by the Spo/Spok relationship (Ono et al. 2006). Both are thought to function within the Black Box but at different developmental stages, Spo acting embryonically and in female follicle cells while Spok acts in the PG during larval stages. One intriguing candidate for a redundant activity could be Cyp6u1. This gene product is also a member of the P450 clade 6 subgroup but is highly conserved across Arthropoda (Good RT et al. 2014). Examining the phenotype of Cyp6u1 null mutants and Cyp6t3;Cyp6u1 double mutants might provide insight on the redundancy issue.
In summary, our studies do not resolve the enigma of the Black Box reaction mechanism in the E biosynthetic pathway. However, our elimination of Cyp6t3 involvement under standard growth conditions helps reduce the complexity of the necessary components. This should aid in simplifying the design of future studies aimed at understanding the details of the biochemical reactions catalyzed by the Blackbox enzymes and whether their regulation serves as a rate limiting step in E biosynthesis as previously suggested (Gilbert et al. 2002).
","references":[{"reference":"Christesen D, Yang YT, Somers J, Robin C, Sztal T, Batterham P, Perry T. 2017. Transcriptome Analysis of Drosophila melanogaster Third Instar Larval Ring Glands Points to Novel Functions and Uncovers a Cytochrome p450 Required for Development. G3 (Bethesda) 7: 467-479.","pubmedId":"27974438","doi":""},{"reference":"Chávez VM, Marqués G, Delbecque JP, Kobayashi K, Hollingsworth M, Burr J, Natzle JE, O'Connor MB. 2000. The Drosophila disembodied gene controls late embryonic morphogenesis and codes for a cytochrome P450 enzyme that regulates embryonic ecdysone levels. Development 127: 4115-26.","pubmedId":"10976044","doi":""},{"reference":"Gibbens YY, Warren JT, Gilbert LI, O'Connor MB. 2011. Neuroendocrine regulation of Drosophila metamorphosis requires TGFbeta/Activin signaling. Development 138: 2693-703.","pubmedId":"21613324","doi":""},{"reference":"Good RT, Gramzow L, Battlay P, Sztal T, Batterham P, Robin C. 2014. The molecular evolution of cytochrome P450 genes within and between drosophila species. Genome Biol Evol 6: 1118-34.","pubmedId":"24751979","doi":""},{"reference":"Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O'Connor-Giles KM. 2013. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 194: 1029-35.","pubmedId":"23709638","doi":""},{"reference":"Gratz SJ, Ukken FP, Rubinstein CD, Thiede G, Donohue LK, Cummings AM, O'Connor-Giles KM. 2014. Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila. Genetics 196: 961-71.","pubmedId":"24478335","doi":""},{"reference":"Jürgens G, Wieschaus E, Nüsslein-Volhard C, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : II. Zygotic loci on the third chromosome. Wilehm Roux Arch Dev Biol 193: 283-295.","pubmedId":"28305338","doi":""},{"reference":"Koyama T, Rodrigues MA, Athanasiadis A, Shingleton AW, Mirth CK. 2014. Nutritional control of body size through FoxO-Ultraspiracle mediated ecdysone biosynthesis. Elife 3: .","pubmedId":"25421296","doi":""},{"reference":"Niwa R, Matsuda T, Yoshiyama T, Namiki T, Mita K, Fujimoto Y, Kataoka H. 2004. CYP306A1, a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis in the prothoracic glands of Bombyx and Drosophila. J Biol Chem 279: 35942-9.","pubmedId":"15197185","doi":""},{"reference":"Niwa R; Namiki T; Ito K; Shimada-Niwa Y; Kiuchi M; Kawaoka S; et al.; Shinoda T. 2010. Non-molting glossy/shroud encodes a short-chain dehydrogenase/reductase that functions in the 'Black Box' of the ecdysteroid biosynthesis pathway. Development 137: 1991-9.","pubmedId":"20501590","doi":""},{"reference":"Nüsslein-Volhard C, Wieschaus E, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : I. Zygotic loci on the second chromosome. Wilehm Roux Arch Dev Biol 193: 267-282.","pubmedId":"28305337","doi":""},{"reference":"Ohhara Y; Shimada-Niwa Y; Niwa R; Kayashima Y; Hayashi Y; Akagi K; et al.; Kobayashi S. 2015. Autocrine regulation of ecdysone synthesis by β3-octopamine receptor in the prothoracic gland is essential for Drosophila metamorphosis. Proc Natl Acad Sci U S A 112: 1452-7.","pubmedId":"25605909","doi":""},{"reference":"Ono H; Rewitz KF; Shinoda T; Itoyama K; Petryk A; Rybczynski R; et al.; O'Connor MB. 2006. Spook and Spookier code for stage-specific components of the ecdysone biosynthetic pathway in Diptera. Dev Biol 298: 555-70.","pubmedId":"16949568","doi":""},{"reference":"Ou Q, Zeng J, Yamanaka N, Brakken-Thal C, O'Connor MB, King-Jones K. 2016. The Insect Prothoracic Gland as a Model for Steroid Hormone Biosynthesis and Regulation. Cell Rep 16: 247-262.","pubmedId":"27320926","doi":""},{"reference":"Petryk A; Warren JT; Marqués G; Jarcho MP; Gilbert LI; Kahler J; et al.; O'Connor MB. 2003. Shade is the Drosophila P450 enzyme that mediates the hydroxylation of ecdysone to the steroid insect molting hormone 20-hydroxyecdysone. Proc Natl Acad Sci U S A 100: 13773-8.","pubmedId":"14610274","doi":""},{"reference":"Qu Z, Kenny NJ, Lam HM, Chan TF, Chu KH, Bendena WG, Tobe SS, Hui JH. 2015. How Did Arthropod Sesquiterpenoids and Ecdysteroids Arise? Comparison of Hormonal Pathway Genes in Noninsect Arthropod Genomes. Genome Biol Evol 7: 1951-9.","pubmedId":"26112967","doi":""},{"reference":"Saito J, Kimura R, Kaieda Y, Nishida R, Ono H. 2016. Characterization of candidate intermediates in the Black Box of the ecdysone biosynthetic pathway in Drosophila melanogaster: Evaluation of molting activities on ecdysteroid-defective larvae. J Insect Physiol 93-94: 94-104.","pubmedId":"27662806","doi":""},{"reference":"Shimell M, Pan X, Martin FA, Ghosh AC, Leopold P, O'Connor MB, Romero NM. 2018. Prothoracicotropic hormone modulates environmental adaptive plasticity through the control of developmental timing. Development 145: .","pubmedId":"29467242","doi":""},{"reference":"Warren JT, O'Connor MB, Gilbert LI. 2009. Studies on the Black Box: incorporation of 3-oxo-7-dehydrocholesterol into ecdysteroids by Drosophila melanogaster and Manduca sexta. Insect Biochem Mol Biol 39: 677-87.","pubmedId":"19699302","doi":""},{"reference":"Warren JT, Petryk A, Marques G, Jarcho M, Parvy JP, Dauphin-Villemant C, O'Connor MB, Gilbert LI. 2002. Molecular and biochemical characterization of two P450 enzymes in the ecdysteroidogenic pathway of Drosophila melanogaster. Proc Natl Acad Sci U S A 99: 11043-8.","pubmedId":"12177427","doi":""},{"reference":"Warren JT; Petryk A; Marqués G; Parvy JP; Shinoda T; Itoyama K; et al.; Gilbert LI. 2004. Phantom encodes the 25-hydroxylase of Drosophila melanogaster and Bombyx mori: a P450 enzyme critical in ecdysone biosynthesis. Insect Biochem Mol Biol 34: 991-1010.","pubmedId":"15350618","doi":""},{"reference":"Wieschaus E, Nüsslein-Volhard C, Jürgens G. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : III. Zygotic loci on the X-chromosome and fourth chromosome. Wilehm Roux Arch Dev Biol 193: 296-307.","pubmedId":"28305339","doi":""}],"title":"The cytochrome P450 Cyp6t3 is not required for ecdysone biosynthesis in Drosophila melanogaster
","reviews":[{"reviewer":{"displayName":"Jason Tennessen"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":"1655706562181"}]},{"id":"9ee3db4e-ecfe-4cee-86c0-bac686d11415","decision":"accept","abstract":"The steroid hormone 20-hydroxyecdysone (20E) is essential for proper development and the timing of intermediary stage transitions in insects. As a result, there is intense interest in identifying and defining the roles of the enzymes and signaling pathways that regulate 20E production in the prothoracic gland (PG), the major endocrine organ of juvenile insect phases. Transcriptomics is one powerful tool that has been used to identify novel genes that are up- or down-regulated in the PG which may contribute to 20E regulation. Additional functional characterization of putative regulatory candidate genes typically involves qRT-PCR and/or RNAi mediated knockdown of the candidate mRNA in the PG to assess whether the gene’s expression shows temporal regulation in the PG and whether its expression is essential for proper 20E production and the correct timing of developmental transitions. While these methods have proved fruitful for identifying novel regulators of 20E production, characterizing the null phenotype of putative regulatory genes is the gold standard for assigning gene function since RNAi is known to generate various types of “off target” effects. Here we describe the genetic null mutant phenotype of the Drosophila melanogaster Cyp6t3 gene. Cyp6t3 was originally identified as a differentially regulated gene in a PG microarray screen and assigned a place in the “Black Box” step of the E biosynthetic pathway based on RNAi mediated knockdown phenotypes and rescue experiments involving feeding of various intermediate compounds of the E biosynthetic pathway. In contrast, we find that Crispr generated null mutations in Cyp6t3 are viable and have normal developmental timing. Therefore, we conclude that Cyp6t3 is not required for E production under typical lab growth conditions and therefore is not an obligate enzymatic component of the Black Box.
","acknowledgements":"The authors wish to thank Aidan Peterson for critical review and helpful comments. Also sincere thanks to FlyBase for genetic information and sequences and BDSC for providing fly stocks. ","authors":[{"affiliations":["University of Minnesota"],"departments":[""],"credit":["writing_originalDraft","methodology","formalAnalysis"],"email":"oconn033@umn.edu","firstName":"MaryJane ","lastName":"Shimell ","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":"","orcid":""},{"affiliations":["University of Minnesota"],"departments":[""],"credit":["conceptualization","fundingAcquisition","writing_reviewEditing"],"email":"moconnor@umn.edu","firstName":"Michael B","lastName":"O'Connor","submittingAuthor":false,"correspondingAuthor":null,"equalContribution":null,"WBId":"","orcid":null}],"awards":null,"conflictsOfInterest":null,"dataTable":null,"extendedData":[],"funding":"NIGMS R35-118029","image":{"url":"https://portal.micropublication.org/uploads/024198bb86d7e625e7afad4faf0449eb.jpeg"},"imageCaption":"A. Ecdysone biosynthetic pathway. The feeding substrates for placement in the Black Box are shown in red. Number of arrows in the Black Box is for illustrative purpose only. B. Cartoon of the Cyp6t3 genomic region. Exons are shown in light blue and dashed lines denote the Cytochrome P450 domain. Sequences for the guide RNAs are shown in anti-sense because the targeted sequence is the negative DNA strand. Three new alleles are described below. C. Clustal alignment. Cyp6t3 aligned with Cyp6t3 mutant proteins. Pale green highlight indicates amino acid identity. Note that Cyp6t3[Cr1] and Cyp6t3[Cr3] are early truncations, while more than 80% of the protein is retained in Cyp6t3[Cr2]. D. Developmental timing. Cyp6t3 transheterozygous combinations and wild type (black line). Non-linear regression using Prism software with 50% pupariation indicated by dashed line.
","imageTitle":"","methods":"Crispr mutant generation
The CRISPR Optimal Target Finder (Gratz et al. 2014) was employed to identify two target sites within Cyp6t3 with no off-target sites. The targets with the PAM are: 5’ GGATCCCG¯AACCATAAGCGC CGG 3’ and 5’ GGATCAAA ¯ GACGCAGGGCTC CGG 3’. Sense and antisense oligonucleotides (Oligo Table) for the two guides RNAs were cloned into pU6-BbsI-chiRNA (Addgene #45946; Gratz et al. 2013). Both guide RNAs were injected into vas-Cas9 embryos (BDSC51323, BestGene, Chino Hills CA). Single G0 flies were screened by PCR using primers cyp6t3 01F and cyp6t3 02R (Oligo Table) for the presence of deletions, making them candidates for further analysis. Ten to fifteen individual F1 progeny of G0 flies that displayed multiple deletion bands by PCR (possible Cr mutant/+) were then crossed to a CyO* balancer (BDSC 3198), homozygosed, the DNA region amplified by PCR and then sequenced for the presence of a mutation and its precise location. Both Cyp6t3[Cr1] and Cyp6t3[Cr2] mutations were obtained from a single G0 fly.
Clustal omega analysis used SnapGene Version 6.0.7 software.
Developmental timing
Crosses were set up in cages. Four-hour collections of embryos on yeast-apple juice plates (yeast paste spread on 25% apple juice, 25 mg/mL dextrose, 1.5 mg/mL tegosept, 2.2% agar) were aged about 16 hours, until 1st instar larvae started to emerge. 30-35 larvae were transferred to vial food (Bloomington standard cornmeal food) sprinkled with dry yeast and allowed to grow at 25° with a 12-hour light/dark cycle. Pupariation was scored every 2 hours with the data from 4 vials combined due to the speed of pupariation and lack of data points necessary for non-linear regression analysis in Prism (asymmetric Sigmoidal, 5PL).
","reagents":"Oligo Table
CTTCGGATCCCGAACCATAAGCGC | sense Guide 1 | Crispr |
AAACGCGCTTATGGTTCGGGATCC | antisense Guide 1 | Crispr |
CTTCGGATCAAAGACGCAGGGCTC | sense Guide 2 | Crispr |
AAACGAGCCCTGCGTCTTTGATCC | antisense Guide 2 | Crispr |
GTCCCATCAGGTTGCCC | cyp6t3 01F | PCR, sequencing |
GCAGAGCTTTGAATCGAATTTGG | cyp6t3 02R | PCR, sequencing |
Fly lines
y[1] M{RFP[3xP3.PB] GFP[E.3xP3]=vas-Cas9}ZH-2A w[1118]/FM7c | BDSC 51323 |
w[*]; sna[Sco]/CyO, S[*] bw[1] | BDSC 3198 |
In all Arthropods, the steroid hormone ecdysone (E) acts to control molting and metamorphosis (Qu et al. 2015). During the past two decades, many of the enzymatic steps that convert dietary cholesterol to ecdysone in the insect Drosophila melanogaster have been identified and their activities ordered within a biosynthetic pathway. (Figure 1A, Chávez et al. 2000, Warren et al. 2002, Warren et al. 2004, Niwa et al. 2004, Yoshiyama-Yanagawa et al. 2011). Collectively, these genes are referred to as the Halloween group (Warren et al. 2002) and include phantom (phm), disembodied (dib), shadow (sad), shroud (sro),and spook (spo) which were first identified in the embryonic lethal screens of Nüsslein-Volhard, Wieschaus, and Jürgens as mutants that failed to produce differentiated cuticle (Nüsslein-Volhard et al. 1984, Wieschaus et al. 1984, Jürgens et al. 1984). A closer examination of the embryo proper revealed that null mutants in these genes all exhibit a common phenotype characterized by arrest at embryonic stages 15-17 with failures of head involution, dorsal closure, and cuticle production (Chávez et al. 2000, Warren et al. 2002, Petryk et al. 2003, Niwa et al. 2004, Warren et al. 2004). Subsequent genetic and biochemical analysis demonstrated that each of these gene products acts at a specific step in the biosynthetic pathway and their loss results in failure to synthesize ecdysone, and hence they all produce an identical loss-of-function phenotype.
Despite this progress, there remains uncertainty in the enzymes and reactions involved in an early step of the pathway termed the “Black Box”. The name arises because the chemical intermediates between the upstream 7-dehydrocholesterol (7dC) and the downstream 5beta-ketodiol have eluded isolation (Gilbert et al. 2002). Nevertheless, the activity of several gene products including Shroud (Sro), Spo/Spok, Cyp6t3 and Cyp6u1 have been suggested to act within the Black Box based on rescue experiments that involve feeding mutant larvae intermediate compounds that are thought to be upstream and downstream of the Black Box enzymes. In these experiments, feeding the downstream intermediate 5beta-ketodiol rescues loss-of-function larvae and enables them to progress through additional molts while feeding the upstream intermediate 7dC does not (Figure 1A). (Niwa et al. 2010; Ono et al. 2006; Ou et al. 2011; Christesen et al. 2017).
Since all Halloween null mutants are embryonic lethal, the feeding experiments which helped position various gene products in the biosynthetic pathway sometimes involved bypassing the embryonic lethality by using RNAi to specifically knockdown the function of these genes in the prothoracic gland (PG), the source of larval ecdysone. The embryonic tissue source of E is still unknown. Strong RNAi knockdown in the PG of any of the Halloween gene products leads to first instar arrest. However, feeding the larvae various intermediates often enables them to progress into the second and third instar stage, provided the intermediate is downstream of the enzymatic block. These types of experiments suggested that the Sro and Spo/Spok enzymes are components of the Black Box.
The identification of Cyp6t3 (FBgn0033697) and Cyp6u1 (FBgn0033121) genes as encoding possible factors of the E biosynthetic pathway came about differently from classical genetic studies. Cyp6t3 was identified as a gene that was specifically up-regulated in the PG in response to loss of the transcription factor DHR4. (Ou et al. 2011). DHR4 mutants pupariate early likely because of precocious ecdysone production, and simultaneous knockdown of Cyp6t3 in a DHR4 mutant background suppressed the early pupation phenotype. In addition, RNAi knockdown of Cyp6t3 in the PGs of wild type animals resulted in slow growth and large pupae, both of which were suppressed by feeding knockdown larvae ecdysone or 5beta-ketodiol but not 7-dC suggesting that, like Spo/Spok and Sro, this enzyme works at the Black Box step. Because of the low transcript abundance of Cyp6t3, it was also hypothesized that Cyp6t3 might be a “bottleneck” in ecdysone biosynthesis, or even rate limiting. Cyp6u1 was identified in a genome wide transcriptome analysis of the PG as a P450 that showed high level expression specifically in the PG, and RNAi knockdown in the PG led to a developmental delay/arrest phenotype which was rescued by feeding ecdysone or 5beta-ketodiol but not 7-dC, again positioning this enzyme at the Black Box step.
Since it has been reported that tissue-specific knockdown of genes can have more severe phenotypes than genetic null mutations (Gibbens et al. 2011, Ohhara et al. 2015), we made Crispr-mediated null mutations in Cyp6t3 as an additional means to assess its function during Drosophila development. Guide RNAs from both ends of the Cyp6t3 cytochrome P450 domain were simultaneously injected into a Cas9 stock (Bestgene Inc.) for the purpose of generating mutations at each individual site as well as potential deletions between the sites. After screening the progeny of the G0 flies, we obtained 3 mutations Cyp6t3[Cr1], a 1 bp deletion at Guide 1, Cyp6t3[Cr2], a 2 bp deletion at Guide 2, and Cyp6t3[Cr3], a 1 kbp deletion between Guides 1 and 2 (Figure 1B). Translation of these mutated genes yields proteins with different premature stops or a large deletion within the Cytochrome P450 domain of Cyp6t3 (Figure 1C). All three mutations are homozygous viable. For this reason alone, we deemed Cyp6t3 a non-essential gene for ecdysone biosynthesis.
Although loss of Cyp6t3 is not essential for animal survival, we reasoned that it could affect the rate of ecdysone biosynthesis. Previous work has shown that either raising or lowering the basal E biosynthetic rate leads to advanced or delayed timing of pupariation, respectively (Ou et al. 2016, Koyama et al. 2014, and Shimell et al. 2018). To address this issue, we assessed the time to pupariation of various Cyp6t3 mutant combinations (Figure 1D). In sum, we find no delay in developmental timing compared to the wild type control suggesting that the basal rate of ecdysone synthesis in the Cyp6t3 mutants is on par with wild type.
The fact that Cyp6t3 is not an essential component of the E biosynthetic pathway under lab growth conditions should not be surprising since, unlike the other Halloween genes that are highly conserved across all arthropods examined to date, Cyp6t3 has been lost in some clades (Ou et al. 2011 and Good RT et al. 2014). In addition, as previously noted, the transcript abundance of Cypt6t3 is very low by qRT-PCR (Ou et al. 2011) and did not make the cutoff in 2 different ring gland-specific transcriptional profiles, the only putative E biosynthetic P450 gene failing to do so (Ou et al. 2016 and Christesen et al. 2017). Despite these observations, the regulation of Cyp6t3 transcription by DHR4 and its ability to suppress the precocious DHR4 mutant phenotype when knocked down in the PG remains intriguing. It would be interesting to determine whether a Cyp6t3, DHR[1] double mutant shows the same suppression of precocious pupariation as found when RNAi is used to knockdown Cyp6t3 in the PG of a DHR[1] mutant. It is also possible that Cyp6t3 is important under specialized growth conditions that modulate DHR4 activity. Another possibility is that Cyp6t3 function is redundant in D. melanogaster, and perhaps other species, with another P450 enzyme. Precedence for the existence of partial redundance in E biosynthetic enzymes in insects is exemplified by the Spo/Spok relationship (Ono et al. 2006). Both are thought to function within the Black Box but at different developmental stages, Spo acting embryonically and in female follicle cells while Spok acts in the PG during larval stages. One intriguing candidate for a redundant activity could be Cyp6u1. This gene product is also a member of the P450 clade 6 subgroup but is highly conserved across Arthropoda (Good RT et al. 2014). Examining the phenotype of Cyp6u1 null mutants and Cyp6t3;Cyp6u1 double mutants might provide insight on the redundancy issue.
In summary, our studies do not resolve the enigma of the Black Box reaction mechanism in the E biosynthetic pathway. However, our elimination of Cyp6t3 involvement under standard growth conditions helps reduce the complexity of the necessary components. This should aid in simplifying the design of future studies aimed at understanding the details of the biochemical reactions catalyzed by the Blackbox enzymes and whether their regulation serves as a rate limiting step in E biosynthesis as previously suggested (Gilbert et al. 2002).
","references":[{"reference":"Christesen D, Yang YT, Somers J, Robin C, Sztal T, Batterham P, Perry T. 2017. Transcriptome Analysis of Drosophila melanogaster Third Instar Larval Ring Glands Points to Novel Functions and Uncovers a Cytochrome p450 Required for Development. G3 (Bethesda) 7: 467-479.","pubmedId":"27974438","doi":""},{"reference":"Chávez VM, Marqués G, Delbecque JP, Kobayashi K, Hollingsworth M, Burr J, Natzle JE, O'Connor MB. 2000. The Drosophila disembodied gene controls late embryonic morphogenesis and codes for a cytochrome P450 enzyme that regulates embryonic ecdysone levels. Development 127: 4115-26.","pubmedId":"10976044","doi":""},{"reference":"Gibbens YY, Warren JT, Gilbert LI, O'Connor MB. 2011. Neuroendocrine regulation of Drosophila metamorphosis requires TGFbeta/Activin signaling. Development 138: 2693-703.","pubmedId":"21613324","doi":""},{"reference":"Good RT, Gramzow L, Battlay P, Sztal T, Batterham P, Robin C. 2014. The molecular evolution of cytochrome P450 genes within and between drosophila species. Genome Biol Evol 6: 1118-34.","pubmedId":"24751979","doi":""},{"reference":"Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O'Connor-Giles KM. 2013. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 194: 1029-35.","pubmedId":"23709638","doi":""},{"reference":"Gratz SJ, Ukken FP, Rubinstein CD, Thiede G, Donohue LK, Cummings AM, O'Connor-Giles KM. 2014. Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila. Genetics 196: 961-71.","pubmedId":"24478335","doi":""},{"reference":"Jürgens G, Wieschaus E, Nüsslein-Volhard C, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : II. Zygotic loci on the third chromosome. Wilehm Roux Arch Dev Biol 193: 283-295.","pubmedId":"28305338","doi":""},{"reference":"Koyama T, Rodrigues MA, Athanasiadis A, Shingleton AW, Mirth CK. 2014. Nutritional control of body size through FoxO-Ultraspiracle mediated ecdysone biosynthesis. Elife 3: .","pubmedId":"25421296","doi":""},{"reference":"Niwa R, Matsuda T, Yoshiyama T, Namiki T, Mita K, Fujimoto Y, Kataoka H. 2004. CYP306A1, a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis in the prothoracic glands of Bombyx and Drosophila. J Biol Chem 279: 35942-9.","pubmedId":"15197185","doi":""},{"reference":"Niwa R; Namiki T; Ito K; Shimada-Niwa Y; Kiuchi M; Kawaoka S; et al.; Shinoda T. 2010. Non-molting glossy/shroud encodes a short-chain dehydrogenase/reductase that functions in the 'Black Box' of the ecdysteroid biosynthesis pathway. Development 137: 1991-9.","pubmedId":"20501590","doi":""},{"reference":"Nüsslein-Volhard C, Wieschaus E, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : I. Zygotic loci on the second chromosome. Wilehm Roux Arch Dev Biol 193: 267-282.","pubmedId":"28305337","doi":""},{"reference":"Ohhara Y; Shimada-Niwa Y; Niwa R; Kayashima Y; Hayashi Y; Akagi K; et al.; Kobayashi S. 2015. Autocrine regulation of ecdysone synthesis by β3-octopamine receptor in the prothoracic gland is essential for Drosophila metamorphosis. Proc Natl Acad Sci U S A 112: 1452-7.","pubmedId":"25605909","doi":""},{"reference":"Ono H; Rewitz KF; Shinoda T; Itoyama K; Petryk A; Rybczynski R; et al.; O'Connor MB. 2006. Spook and Spookier code for stage-specific components of the ecdysone biosynthetic pathway in Diptera. Dev Biol 298: 555-70.","pubmedId":"16949568","doi":""},{"reference":"Ou Q, Zeng J, Yamanaka N, Brakken-Thal C, O'Connor MB, King-Jones K. 2016. The Insect Prothoracic Gland as a Model for Steroid Hormone Biosynthesis and Regulation. Cell Rep 16: 247-262.","pubmedId":"27320926","doi":""},{"reference":"Petryk A; Warren JT; Marqués G; Jarcho MP; Gilbert LI; Kahler J; et al.; O'Connor MB. 2003. Shade is the Drosophila P450 enzyme that mediates the hydroxylation of ecdysone to the steroid insect molting hormone 20-hydroxyecdysone. Proc Natl Acad Sci U S A 100: 13773-8.","pubmedId":"14610274","doi":""},{"reference":"Qu Z, Kenny NJ, Lam HM, Chan TF, Chu KH, Bendena WG, Tobe SS, Hui JH. 2015. How Did Arthropod Sesquiterpenoids and Ecdysteroids Arise? Comparison of Hormonal Pathway Genes in Noninsect Arthropod Genomes. Genome Biol Evol 7: 1951-9.","pubmedId":"26112967","doi":""},{"reference":"Saito J, Kimura R, Kaieda Y, Nishida R, Ono H. 2016. Characterization of candidate intermediates in the Black Box of the ecdysone biosynthetic pathway in Drosophila melanogaster: Evaluation of molting activities on ecdysteroid-defective larvae. J Insect Physiol 93-94: 94-104.","pubmedId":"27662806","doi":""},{"reference":"Shimell M, Pan X, Martin FA, Ghosh AC, Leopold P, O'Connor MB, Romero NM. 2018. Prothoracicotropic hormone modulates environmental adaptive plasticity through the control of developmental timing. Development 145: .","pubmedId":"29467242","doi":""},{"reference":"Warren JT, Petryk A, Marques G, Jarcho M, Parvy JP, Dauphin-Villemant C, O'Connor MB, Gilbert LI. 2002. Molecular and biochemical characterization of two P450 enzymes in the ecdysteroidogenic pathway of Drosophila melanogaster. Proc Natl Acad Sci U S A 99: 11043-8.","pubmedId":"12177427","doi":""},{"reference":"Warren JT; Petryk A; Marqués G; Parvy JP; Shinoda T; Itoyama K; et al.; Gilbert LI. 2004. Phantom encodes the 25-hydroxylase of Drosophila melanogaster and Bombyx mori: a P450 enzyme critical in ecdysone biosynthesis. Insect Biochem Mol Biol 34: 991-1010.","pubmedId":"15350618","doi":""},{"reference":"Wieschaus E, Nüsslein-Volhard C, Jürgens G. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : III. Zygotic loci on the X-chromosome and fourth chromosome. Wilehm Roux Arch Dev Biol 193: 296-307.","pubmedId":"28305339","doi":""},{"reference":"Yoshiyama-Yanagawa T; Enya S; Shimada-Niwa Y; Yaguchi S; Haramoto Y; Matsuya T; et al.; Niwa R. 2011. The conserved Rieske oxygenase DAF-36/Neverland is a novel cholesterol-metabolizing enzyme. J Biol Chem 286: 25756-62.
","pubmedId":"21632547","doi":""}],"title":"The cytochrome P450 Cyp6t3 is not required for ecdysone biosynthesis in Drosophila melanogaster
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"00240916-7ce8-452c-b838-746788bb0d3a","decision":"publish","abstract":"The steroid hormone 20-hydroxyecdysone (20E) is essential for proper development and the timing of intermediary stage transitions in insects. As a result, there is intense interest in identifying and defining the roles of the enzymes and signaling pathways that regulate 20E production in the prothoracic gland (PG), the major endocrine organ of juvenile insect phases. Transcriptomics is one powerful tool that has been used to identify novel genes that are up- or down-regulated in the PG which may contribute to 20E regulation. Additional functional characterization of putative regulatory candidate genes typically involves qRT-PCR and/or RNAi mediated knockdown of the candidate mRNA in the PG to assess whether the gene’s expression shows temporal regulation in the PG and whether its expression is essential for proper 20E production and the correct timing of developmental transitions. While these methods have proved fruitful for identifying novel regulators of 20E production, characterizing the null phenotype of putative regulatory genes is the gold standard for assigning gene function since RNAi is known to generate various types of “off target” effects. Here we describe the genetic null mutant phenotype of the Drosophila melanogaster Cyp6t3 gene. Cyp6t3 was originally identified as a differentially regulated gene in a PG microarray screen and assigned a place in the “Black Box” step of the E biosynthetic pathway based on RNAi mediated knockdown phenotypes and rescue experiments involving feeding of various intermediate compounds of the E biosynthetic pathway. In contrast, we find that Crispr generated null mutations in Cyp6t3 are viable and have normal developmental timing. Therefore, we conclude that Cyp6t3 is not required for E production under typical lab growth conditions and therefore is not an obligate enzymatic component of the Black Box.
","acknowledgements":"The authors wish to thank Aidan Peterson for critical review and helpful comments. Also sincere thanks to FlyBase for genetic information and sequences and BDSC for providing fly stocks. ","authors":[{"affiliations":["University of Minnesota"],"departments":[""],"credit":["writing_originalDraft","methodology","formalAnalysis"],"email":"oconn033@umn.edu","firstName":"MaryJane ","lastName":"Shimell ","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":"","orcid":""},{"affiliations":["University of Minnesota"],"departments":[""],"credit":["conceptualization","fundingAcquisition","writing_reviewEditing"],"email":"moconnor@umn.edu","firstName":"Michael B","lastName":"O'Connor","submittingAuthor":false,"correspondingAuthor":null,"equalContribution":null,"WBId":"","orcid":null}],"awards":null,"conflictsOfInterest":null,"dataTable":null,"extendedData":[],"funding":"NIGMS R35-118029","image":{"url":"https://portal.micropublication.org/uploads/024198bb86d7e625e7afad4faf0449eb.jpeg"},"imageCaption":"A. Ecdysone biosynthetic pathway. The feeding substrates for placement in the Black Box are shown in red. Number of arrows in the Black Box is for illustrative purpose only. B. Cartoon of the Cyp6t3 genomic region. Exons are shown in light blue and dashed lines denote the Cytochrome P450 domain. Sequences for the guide RNAs are shown in anti-sense because the targeted sequence is the negative DNA strand. Three new alleles are described below. C. Clustal alignment. Cyp6t3 aligned with Cyp6t3 mutant proteins. Pale green highlight indicates amino acid identity. Note that Cyp6t3[Cr1] and Cyp6t3[Cr3] are early truncations, while more than 80% of the protein is retained in Cyp6t3[Cr2]. D. Developmental timing. Cyp6t3 transheterozygous combinations and wild type (black line). Non-linear regression using Prism software with 50% pupariation indicated by dashed line.
","imageTitle":"","methods":"Crispr mutant generation
The CRISPR Optimal Target Finder (Gratz et al. 2014) was employed to identify two target sites within Cyp6t3 with no off-target sites. The targets with the PAM are: 5’ GGATCCCG¯AACCATAAGCGC CGG 3’ and 5’ GGATCAAA ¯ GACGCAGGGCTC CGG 3’. Sense and antisense oligonucleotides (Oligo Table) for the two guides RNAs were cloned into pU6-BbsI-chiRNA (Addgene #45946; Gratz et al. 2013). Both guide RNAs were injected into vas-Cas9 embryos (BDSC51323, BestGene, Chino Hills CA). Single G0 flies were screened by PCR using primers cyp6t3 01F and cyp6t3 02R (Oligo Table) for the presence of deletions, making them candidates for further analysis. Ten to fifteen individual F1 progeny of G0 flies that displayed multiple deletion bands by PCR (possible Cr mutant/+) were then crossed to a CyO* balancer (BDSC 3198), homozygosed, the DNA region amplified by PCR and then sequenced for the presence of a mutation and its precise location. Both Cyp6t3[Cr1] and Cyp6t3[Cr2] mutations were obtained from a single G0 fly.
Clustal omega analysis used SnapGene Version 6.0.7 software.
Developmental timing
Crosses were set up in cages. Four-hour collections of embryos on yeast-apple juice plates (yeast paste spread on 25% apple juice, 25 mg/mL dextrose, 1.5 mg/mL tegosept, 2.2% agar) were aged about 16 hours, until 1st instar larvae started to emerge. 30-35 larvae were transferred to vial food (Bloomington standard cornmeal food) sprinkled with dry yeast and allowed to grow at 25° with a 12-hour light/dark cycle. Pupariation was scored every 2 hours with the data from 4 vials combined due to the speed of pupariation and lack of data points necessary for non-linear regression analysis in Prism (asymmetric Sigmoidal, 5PL).
","reagents":"Oligo Table
CTTCGGATCCCGAACCATAAGCGC | sense Guide 1 | Crispr |
AAACGCGCTTATGGTTCGGGATCC | antisense Guide 1 | Crispr |
CTTCGGATCAAAGACGCAGGGCTC | sense Guide 2 | Crispr |
AAACGAGCCCTGCGTCTTTGATCC | antisense Guide 2 | Crispr |
GTCCCATCAGGTTGCCC | cyp6t3 01F | PCR, sequencing |
GCAGAGCTTTGAATCGAATTTGG | cyp6t3 02R | PCR, sequencing |
Fly lines
y[1] M{RFP[3xP3.PB] GFP[E.3xP3]=vas-Cas9}ZH-2A w[1118]/FM7c | BDSC 51323 |
w[*]; sna[Sco]/CyO, S[*] bw[1] | BDSC 3198 |
In all Arthropods, the steroid hormone ecdysone (E) acts to control molting and metamorphosis (Qu et al. 2015). During the past two decades, many of the enzymatic steps that convert dietary cholesterol to ecdysone in the insect Drosophila melanogaster have been identified and their activities ordered within a biosynthetic pathway. (Figure 1A, Chávez et al. 2000, Warren et al. 2002, Warren et al. 2004, Niwa et al. 2004, Yoshiyama-Yanagawa et al. 2011). Collectively, these genes are referred to as the Halloween group (Warren et al. 2002) and include phantom (phm), disembodied (dib), shadow (sad), shroud (sro),and spook (spo) which were first identified in the embryonic lethal screens of Nüsslein-Volhard, Wieschaus, and Jürgens as mutants that failed to produce differentiated cuticle (Nüsslein-Volhard et al. 1984, Wieschaus et al. 1984, Jürgens et al. 1984). A closer examination of the embryo proper revealed that null mutants in these genes all exhibit a common phenotype characterized by arrest at embryonic stages 15-17 with failures of head involution, dorsal closure, and cuticle production (Chávez et al. 2000, Warren et al. 2002, Petryk et al. 2003, Niwa et al. 2004, Warren et al. 2004). Subsequent genetic and biochemical analysis demonstrated that each of these gene products acts at a specific step in the biosynthetic pathway and their loss results in failure to synthesize ecdysone, and hence they all produce an identical loss-of-function phenotype.
Despite this progress, there remains uncertainty in the enzymes and reactions involved in an early step of the pathway termed the “Black Box”. The name arises because the chemical intermediates between the upstream 7-dehydrocholesterol (7dC) and the downstream 5beta-ketodiol have eluded isolation (Gilbert et al. 2002). Nevertheless, the activity of several gene products including Shroud (Sro), Spo/Spok, Cyp6t3 and Cyp6u1 have been suggested to act within the Black Box based on rescue experiments that involve feeding mutant larvae intermediate compounds that are thought to be upstream and downstream of the Black Box enzymes. In these experiments, feeding the downstream intermediate 5beta-ketodiol rescues loss-of-function larvae and enables them to progress through additional molts while feeding the upstream intermediate 7dC does not (Figure 1A). (Niwa et al. 2010; Ono et al. 2006; Ou et al. 2011; Christesen et al. 2017).
Since all Halloween null mutants are embryonic lethal, the feeding experiments which helped position various gene products in the biosynthetic pathway sometimes involved bypassing the embryonic lethality by using RNAi to specifically knockdown the function of these genes in the prothoracic gland (PG), the source of larval ecdysone. The embryonic tissue source of E is still unknown. Strong RNAi knockdown in the PG of any of the Halloween gene products leads to first instar arrest. However, feeding the larvae various intermediates often enables them to progress into the second and third instar stage, provided the intermediate is downstream of the enzymatic block. These types of experiments suggested that the Sro and Spo/Spok enzymes are components of the Black Box.
The identification of Cyp6t3 (FBgn0033697) and Cyp6u1 (FBgn0033121) genes as encoding possible factors of the E biosynthetic pathway came about differently from classical genetic studies. Cyp6t3 was identified as a gene that was specifically up-regulated in the PG in response to loss of the transcription factor DHR4. (Ou et al. 2011). DHR4 mutants pupariate early likely because of precocious ecdysone production, and simultaneous knockdown of Cyp6t3 in a DHR4 mutant background suppressed the early pupation phenotype. In addition, RNAi knockdown of Cyp6t3 in the PGs of wild type animals resulted in slow growth and large pupae, both of which were suppressed by feeding knockdown larvae ecdysone or 5beta-ketodiol but not 7-dC suggesting that, like Spo/Spok and Sro, this enzyme works at the Black Box step. Because of the low transcript abundance of Cyp6t3, it was also hypothesized that Cyp6t3 might be a “bottleneck” in ecdysone biosynthesis, or even rate limiting. Cyp6u1 was identified in a genome wide transcriptome analysis of the PG as a P450 that showed high level expression specifically in the PG, and RNAi knockdown in the PG led to a developmental delay/arrest phenotype which was rescued by feeding ecdysone or 5beta-ketodiol but not 7-dC, again positioning this enzyme at the Black Box step.
Since it has been reported that tissue-specific knockdown of genes can have more severe phenotypes than genetic null mutations (Gibbens et al. 2011, Ohhara et al. 2015), we made Crispr-mediated null mutations in Cyp6t3 as an additional means to assess its function during Drosophila development. Guide RNAs from both ends of the Cyp6t3 cytochrome P450 domain were simultaneously injected into a Cas9 stock (Bestgene Inc.) for the purpose of generating mutations at each individual site as well as potential deletions between the sites. After screening the progeny of the G0 flies, we obtained 3 mutations Cyp6t3[Cr1], a 1 bp deletion at Guide 1, Cyp6t3[Cr2], a 2 bp deletion at Guide 2, and Cyp6t3[Cr3], a 1 kbp deletion between Guides 1 and 2 (Figure 1B). Translation of these mutated genes yields proteins with different premature stops or a large deletion within the Cytochrome P450 domain of Cyp6t3 (Figure 1C). All three mutations are homozygous viable. For this reason alone, we deemed Cyp6t3 a non-essential gene for ecdysone biosynthesis.
Although loss of Cyp6t3 is not essential for animal survival, we reasoned that it could affect the rate of ecdysone biosynthesis. Previous work has shown that either raising or lowering the basal E biosynthetic rate leads to advanced or delayed timing of pupariation, respectively (Ou et al. 2016, Koyama et al. 2014, and Shimell et al. 2018). To address this issue, we assessed the time to pupariation of various Cyp6t3 mutant combinations (Figure 1D). In sum, we find no delay in developmental timing compared to the wild type control suggesting that the basal rate of ecdysone synthesis in the Cyp6t3 mutants is on par with wild type.
The fact that Cyp6t3 is not an essential component of the E biosynthetic pathway under lab growth conditions should not be surprising since, unlike the other Halloween genes that are highly conserved across all arthropods examined to date, Cyp6t3 has been lost in some clades (Ou et al. 2011 and Good RT et al. 2014). In addition, as previously noted, the transcript abundance of Cypt6t3 is very low by qRT-PCR (Ou et al. 2011) and did not make the cutoff in 2 different ring gland-specific transcriptional profiles, the only putative E biosynthetic P450 gene failing to do so (Ou et al. 2016 and Christesen et al. 2017). Despite these observations, the regulation of Cyp6t3 transcription by DHR4 and its ability to suppress the precocious DHR4 mutant phenotype when knocked down in the PG remains intriguing. It would be interesting to determine whether a Cyp6t3, DHR[1] double mutant shows the same suppression of precocious pupariation as found when RNAi is used to knockdown Cyp6t3 in the PG of a DHR[1] mutant. It is also possible that Cyp6t3 is important under specialized growth conditions that modulate DHR4 activity. Another possibility is that Cyp6t3 function is redundant in D. melanogaster, and perhaps other species, with another P450 enzyme. Precedence for the existence of partial redundance in E biosynthetic enzymes in insects is exemplified by the Spo/Spok relationship (Ono et al. 2006). Both are thought to function within the Black Box but at different developmental stages, Spo acting embryonically and in female follicle cells while Spok acts in the PG during larval stages. One intriguing candidate for a redundant activity could be Cyp6u1. This gene product is also a member of the P450 clade 6 subgroup but is highly conserved across Arthropoda (Good RT et al. 2014). Examining the phenotype of Cyp6u1 null mutants and Cyp6t3;Cyp6u1 double mutants might provide insight on the redundancy issue.
In summary, our studies do not resolve the enigma of the Black Box reaction mechanism in the E biosynthetic pathway. However, our elimination of Cyp6t3 involvement under standard growth conditions helps reduce the complexity of the necessary components. This should aid in simplifying the design of future studies aimed at understanding the details of the biochemical reactions catalyzed by the Blackbox enzymes and whether their regulation serves as a rate limiting step in E biosynthesis as previously suggested (Gilbert et al. 2002).
","references":[{"reference":"Christesen D, Yang YT, Somers J, Robin C, Sztal T, Batterham P, Perry T. 2017. Transcriptome Analysis of Drosophila melanogaster Third Instar Larval Ring Glands Points to Novel Functions and Uncovers a Cytochrome p450 Required for Development. G3 (Bethesda) 7: 467-479.","pubmedId":"27974438","doi":""},{"reference":"Chávez VM, Marqués G, Delbecque JP, Kobayashi K, Hollingsworth M, Burr J, Natzle JE, O'Connor MB. 2000. The Drosophila disembodied gene controls late embryonic morphogenesis and codes for a cytochrome P450 enzyme that regulates embryonic ecdysone levels. Development 127: 4115-26.","pubmedId":"10976044","doi":""},{"reference":"Gibbens YY, Warren JT, Gilbert LI, O'Connor MB. 2011. Neuroendocrine regulation of Drosophila metamorphosis requires TGFbeta/Activin signaling. Development 138: 2693-703.","pubmedId":"21613324","doi":""},{"reference":"Good RT, Gramzow L, Battlay P, Sztal T, Batterham P, Robin C. 2014. The molecular evolution of cytochrome P450 genes within and between drosophila species. Genome Biol Evol 6: 1118-34.","pubmedId":"24751979","doi":""},{"reference":"Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O'Connor-Giles KM. 2013. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 194: 1029-35.","pubmedId":"23709638","doi":""},{"reference":"Gratz SJ, Ukken FP, Rubinstein CD, Thiede G, Donohue LK, Cummings AM, O'Connor-Giles KM. 2014. Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila. Genetics 196: 961-71.","pubmedId":"24478335","doi":""},{"reference":"Jürgens G, Wieschaus E, Nüsslein-Volhard C, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : II. Zygotic loci on the third chromosome. Wilehm Roux Arch Dev Biol 193: 283-295.","pubmedId":"28305338","doi":""},{"reference":"Koyama T, Rodrigues MA, Athanasiadis A, Shingleton AW, Mirth CK. 2014. Nutritional control of body size through FoxO-Ultraspiracle mediated ecdysone biosynthesis. Elife 3: .","pubmedId":"25421296","doi":""},{"reference":"Niwa R, Matsuda T, Yoshiyama T, Namiki T, Mita K, Fujimoto Y, Kataoka H. 2004. CYP306A1, a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis in the prothoracic glands of Bombyx and Drosophila. J Biol Chem 279: 35942-9.","pubmedId":"15197185","doi":""},{"reference":"Niwa R; Namiki T; Ito K; Shimada-Niwa Y; Kiuchi M; Kawaoka S; et al.; Shinoda T. 2010. Non-molting glossy/shroud encodes a short-chain dehydrogenase/reductase that functions in the 'Black Box' of the ecdysteroid biosynthesis pathway. Development 137: 1991-9.","pubmedId":"20501590","doi":""},{"reference":"Nüsslein-Volhard C, Wieschaus E, Kluding H. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : I. Zygotic loci on the second chromosome. Wilehm Roux Arch Dev Biol 193: 267-282.","pubmedId":"28305337","doi":""},{"reference":"Ohhara Y; Shimada-Niwa Y; Niwa R; Kayashima Y; Hayashi Y; Akagi K; et al.; Kobayashi S. 2015. Autocrine regulation of ecdysone synthesis by β3-octopamine receptor in the prothoracic gland is essential for Drosophila metamorphosis. Proc Natl Acad Sci U S A 112: 1452-7.","pubmedId":"25605909","doi":""},{"reference":"Ono H; Rewitz KF; Shinoda T; Itoyama K; Petryk A; Rybczynski R; et al.; O'Connor MB. 2006. Spook and Spookier code for stage-specific components of the ecdysone biosynthetic pathway in Diptera. Dev Biol 298: 555-70.","pubmedId":"16949568","doi":""},{"reference":"Ou Q, Zeng J, Yamanaka N, Brakken-Thal C, O'Connor MB, King-Jones K. 2016. The Insect Prothoracic Gland as a Model for Steroid Hormone Biosynthesis and Regulation. Cell Rep 16: 247-262.","pubmedId":"27320926","doi":""},{"reference":"Petryk A; Warren JT; Marqués G; Jarcho MP; Gilbert LI; Kahler J; et al.; O'Connor MB. 2003. Shade is the Drosophila P450 enzyme that mediates the hydroxylation of ecdysone to the steroid insect molting hormone 20-hydroxyecdysone. Proc Natl Acad Sci U S A 100: 13773-8.","pubmedId":"14610274","doi":""},{"reference":"Qu Z, Kenny NJ, Lam HM, Chan TF, Chu KH, Bendena WG, Tobe SS, Hui JH. 2015. How Did Arthropod Sesquiterpenoids and Ecdysteroids Arise? Comparison of Hormonal Pathway Genes in Noninsect Arthropod Genomes. Genome Biol Evol 7: 1951-9.","pubmedId":"26112967","doi":""},{"reference":"Saito J, Kimura R, Kaieda Y, Nishida R, Ono H. 2016. Characterization of candidate intermediates in the Black Box of the ecdysone biosynthetic pathway in Drosophila melanogaster: Evaluation of molting activities on ecdysteroid-defective larvae. J Insect Physiol 93-94: 94-104.","pubmedId":"27662806","doi":""},{"reference":"Shimell M, Pan X, Martin FA, Ghosh AC, Leopold P, O'Connor MB, Romero NM. 2018. Prothoracicotropic hormone modulates environmental adaptive plasticity through the control of developmental timing. Development 145: .","pubmedId":"29467242","doi":""},{"reference":"Warren JT, Petryk A, Marques G, Jarcho M, Parvy JP, Dauphin-Villemant C, O'Connor MB, Gilbert LI. 2002. Molecular and biochemical characterization of two P450 enzymes in the ecdysteroidogenic pathway of Drosophila melanogaster. Proc Natl Acad Sci U S A 99: 11043-8.","pubmedId":"12177427","doi":""},{"reference":"Warren JT; Petryk A; Marqués G; Parvy JP; Shinoda T; Itoyama K; et al.; Gilbert LI. 2004. Phantom encodes the 25-hydroxylase of Drosophila melanogaster and Bombyx mori: a P450 enzyme critical in ecdysone biosynthesis. Insect Biochem Mol Biol 34: 991-1010.","pubmedId":"15350618","doi":""},{"reference":"Wieschaus E, Nüsslein-Volhard C, Jürgens G. 1984. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : III. Zygotic loci on the X-chromosome and fourth chromosome. Wilehm Roux Arch Dev Biol 193: 296-307.","pubmedId":"28305339","doi":""},{"reference":"Yoshiyama-Yanagawa T; Enya S; Shimada-Niwa Y; Yaguchi S; Haramoto Y; Matsuya T; et al.; Niwa R. 2011. The conserved Rieske oxygenase DAF-36/Neverland is a novel cholesterol-metabolizing enzyme. J Biol Chem 286: 25756-62.
","pubmedId":"21632547","doi":""}],"title":"The cytochrome P450 Cyp6t3 is not required for ecdysone biosynthesis in Drosophila melanogaster
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"d7d5a475-a581-4237-b03d-3915a7110245","citedBy":[{"title":"Endoreplication in the Drosophila melanogaster prothoracic gland is dispensable for the critical weight checkpoint","url":"https://micropublication.org/journals/biology/micropub.biology.000741","journal":"microPublication Biology","datePublished":"2023","firstAuthor":"Shimell, M"},{"title":"Research Progress on the Regulation of Autophagy and Apoptosis in Insects by Sterol Hormone 20-Hydroxyecdysone","url":"http://dx.doi.org/10.3390/insects14110871","journal":"Insects","datePublished":"November 2023","firstAuthor":"Lin, L"},{"title":"Insect Sterols and Steroids","url":"http://dx.doi.org/10.1007/5584_2024_823","journal":"Advances in Experimental Medicine and Biology","datePublished":"2024","firstAuthor":"Lafont, R"}],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}