The yeast protein Atg11, whose structure is unknown, is a central organizer of autophagosome formation that recruits Atg9 during selective autophagy. Although the residues in Atg9 responsible for this interaction are known, those in Atg11 are not. In an attempt to discover the binding site of Atg9 on Atg11, we screened a number of mutants within amino acid residues 455-627 of Atg11, guided in part by an AlphaFold2-generated model of the Atg11 dimer. However, we were not able to identify specific residues essential for the interaction with Atg9, suggesting that the binding region may lie elsewhere on Atg11.
","acknowledgements":"","authors":[{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"chimids@umich.edu","firstName":"Chimi Dolker","lastName":"Sherpa","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0003-4253-0827"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"omo14patric@gmail.com","firstName":"Patricia","lastName":"Woghiren","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0003-6468-2661"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"erinleo@umich.edu","firstName":"Erin","lastName":"Leonello","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-5163-1973"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_originalDraft","visualization"],"email":"mabdelkh@emich.edu","firstName":"Mina","lastName":"Abdel-Khalek","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-3140-3827"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_originalDraft","visualization"],"email":"bschuess@emich.edu","firstName":"Benjamin J. ","lastName":"Schuessler","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-2920-8932"},{"affiliations":["Michigan State University"],"departments":["MSU-DOE Plant Research Laboratory"],"credit":["investigation","writing_reviewEditing"],"email":"vermaasj@msu.edu","firstName":"Josh V.","lastName":"Vermaas","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3139-6469"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","methodology","supervision","writing_originalDraft"],"email":"sbackues@emich.edu","firstName":"Steven K.","lastName":"Backues","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-7346-1428"}],"awards":[{"awardId":"2243163","funderName":"U.S. National Science Foundation (United States)","awardRecipient":"Steven K. Backues"},{"awardId":"R35GM155317","funderName":"National Institutes of Health (United States)","awardRecipient":"Josh V. Vermaas"}],"conflictsOfInterest":null,"dataTable":null,"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/9a197fa218f42310f8a5378fc1549bd9.png"},"imageCaption":"(A) Schematic representation of Atg11 showing the coiled-coil domains (black boxes) and the CLAW domain (grey box), with a.a. shown by italicized numbers. Fragments previously reported to bind or not bind with Atg9 are indicated. (B) Yeast 2 hybrid assay of BD-Atg9 with the indicated AD-Atg11 mutants. Non-selective media is SMD -ura -leu; selective media is SMD -ura -leu -his +1.5 mM 3-AT. On selective media, (+) indicates growth and (-) indicates no growth across multiple replicates of the assay. (C) Front and side view of the flask-shaped Atg11 dimer and (D) front view of the Z-shaped Atg11 dimer predicted with AlphaFold2 Multimer. (E) pLDDT confidence map of the flask-shaped Atg11 structure. (F) Close-up of flask-shaped dimer showing predicted locations of YDLL residues. (G) Surface rendering of flask-shaped model highlighting predicted surface exposed residues in the 455-535 region. (H) CoIP of various overexpressed GFP-Atg11 mutants by overexpressed PA-Atg9. Blots were probed with anti-GFP, which also detects the PA tag. (I) Quantitative analysis of CoIP results. The Atg11 to Atg9 band intensity ratio was normalized to the values from WT for each replicate. For the CoIP graph, the GFP-Atg11 band intensity of the 𝚫CC2 samples, which are known to show no binding (Meyer et al., 2022), were used as the background and subtracted from the GFP-Atg11 band intensity of the other samples before normalizing. Error bars are 95% confidence intervals.
","imageTitle":"Mutations in the 455-535 and 576-627 regions of Atg11 do not cause full loss of interaction with Atg9:
","methods":"Strain and plasmid construction: The pGAD-atg11 mutant plasmids were ordered from GenScript. The pRS416-Cu-GFP-atg11 mutant plasmids (YDLL, YDL, and DLL) were made using InFusion cloning. The vector pRS416-Cu-GFP-ATG11 was digested with EcoRI-HF (NEB), which cuts at two endogenous EcoRI sites in Atg11. The insert was amplified by PCR using Phusion polymerase (NEB) from the respective pGAD-Atg11 mutant with primers agaagaagaagaattcaatagtcaag and atttgctatagaattctcattttcatc, ordered from IDT. The vector and insert were combined by InFusion reaction (Clontech, Takara Bio USA Inc.) and transformed into E. coli DH5ɑ (Stellar Competent Cells - HST08 strain) and plated on LB carbenicillin plates for colony growth. pRS416-Cu-GFP-Atg11IA3 was generated by similar methods, except the digest was performed with AvrII and HindIII and the primers used were cagatggaaatcctaggtatta and caacttcataaagcttattgtc.
Plasmids were purified using Purelink plasmid miniprep kits (ThermoFisher), verified by Sanger sequencing (Eton Biosciences) and/or whole plasmid sequencing (Plasmidsaurus) and introduced into yeast cells using standard transformation procedures (Gietz & Schiestl, 2007).
Yeast-2-hybrid: Yeast multiple-knockout cells (lacking 25 ATG genes to minimize indirect or interfering interactions; YCY149) expressing BD-ATG9 and AD-ATG11 or mutants thereof were patched on both selective (SMD -ura -leu -his w/ 1.5 mM 3-amino-triazol) and nonselective (SMD -ura -leu) plates and grown for 4–5 days at 30°C before imaging. Results shown are representative of multiple replicates from multiple independent transformants.
Co-Immunoprecipitation and Western Blotting: Co-immunoprecipitation was carried out exactly as described previously (Meyer et al., 2022) except that all washes were performed in the 4℃ cold room to help prevent breakdown. Precast Bio-Rad 4-15% gradient SDS-PAGE gels and GoldBio BLUEstain2 protein ladder were used. The electrophoresis was run for ~3 hours, starting at 80 V and increasing to 120 V after initial band separation.
Structural Modeling: To develop structure-based hypotheses for potential interaction sites between Atg9 and Atg11, AlphaFold-Multimer version 2.3.2 (Evans et al., 2022) was used to generate 25 potential interaction complexes. These complexes were optimized using the FoldX4 “repair” function (Delgado et al., 2019). Visualization was performed in PyMol 3 (Schrödinger, LLC, 2015).
","reagents":"Table 1: Strains, Plasmids and antibodies used in this study
Saccharomyces cerevisiae strains used in this study | ||
Name | Genotype | Source |
atg11Δ | MATα his3Δ200 leu2-3,112 lys2-801 suc2-Δ9 trp1Δ901 ura3-52 atg11Δ::KanMX | Meyer et al., 2022 |
YCY149 | MATα his3-Δ200 leu2-3,112 lys2-801 trp1-Δ901 suc2-Δ9 ura3-52 atg1Δ, 2Δ, 3Δ, 4Δ, 5Δ, 6Δ, 7Δ, 8Δ, 9Δ, 10Δ, 11Δ, 12Δ, 13Δ, 14Δ, 16Δ, 17Δ, 18Δ, 19Δ, 20Δ, 21Δ, 23Δ, 24Δ, 27Δ, 29Δ gal4Δ gal80Δ GAL1-HIS3 GAL2-ADE2 met2∷GAL7-lacZ atg31Δ∷KanMX | Cao et al., 2009 |
Plasmids used in this study | ||
Name | Description | Source |
pGBDU-ATG9 | BD vector with full length ATG9 | He et al., 2006 |
pGAD-ATG11 | AD vector with full length WT ATG11 | Meyer et al., 2022 |
pGAD-atg11ΔCC2 | AD vector with atg11∆536-576 | Meyer et al., 2022 |
pGAD-atg11Δ455-535 | AD vector with atg11∆455-535 | This study |
pGAD-atg11YDLL | AD vector with atg11Y468A, D516A, L517A, L526A | This study |
pGAD-atg11YDL | AD vector with atg11Y468A, D516A, L517A | This study |
pGAD-atg11DLL | AD vector with atg11 D516A, L517A, L526A | This study |
pGAD-atg11DL | AD vector with atg11 D516A, L517A | This study |
pGAD-atg11EDLLS | AD vector with atg11 E515A, D516A, L517A, L518A, S519A | This study |
pGAD-atg11QQ | AD vector with atg11 Q475A, Q476A | This study |
pGAD-atg11QNLNK | AD vector with atg11 Q493A, N494A, L496A, N500A, K501A | This study |
pGAD-atg11TV | AD vector with atg11 T511A, V512A | This study |
pGAD-atg11IA3 | AD vector with atg11 where residues 576-627 were replaced with residues 2-53 of scPAI3 (aka IA3). | This study |
pRS414-Cu-ATG9-PA | ATG9 tagged with Protein A, driven by the CUP1 promoter | Meyer et al., 2022 |
pRS416-Cu-GFP-ATG11 | GFP-ATG11 WT driven by the CUP1 promoter | Kim et al., 2001 |
pRS416-Cu-GFP-Atg11ΔCC2 | GFP-atg11∆536-576 driven by the CUP1 promoter | Meyer et al., 2022 |
pRS416-Cu-GFP-Atg11YDLL | GFP-atg11Y468A, D516A, L517A, L526A driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-Atg11YDL | GFP-atg11Y468A, D516A, L517A, driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-Atg11DLL | GFP-atg11 D516A, L517A, L526A driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-Atg11IA3 | GFP-atg11 with residues 576-627 replaced with residues 2-53 of scPAI3 (aka IA3). Driven by the CUP1 promoter. | This study |
Antibodies used in this study | ||
Name | Identifier (Source) | Concentration |
“Living Colors” mouse monoclonal anti-GFP (JL-8) | Cat# 632381 (Clontech / Takara) | 1:500 |
Peroxidase AffiniPure® Goat Anti-Mouse IgG | Cat# 115-035-003 (Jackson ImmunoResearch) | 1:5000 |
Macroautophagy (hereafter referred to simply as autophagy) is a critical stress-response pathway conserved in all eukaryotes. Bulk autophagy, triggered by starvation, semi-randomly degrades materials from the cytoplasm in order to reuse the nutrients for cellular survival. In contrast, selective autophagy is not primarily regulated by a need for nutrients but targets specific cytoplasmic cargo to the lysosome (in animals) or vacuole (in other eukaryotes) for degradation (Xie & Klionsky, 2007). Selective autophagy contributes to the health of the cell by breaking down intracellular pathogens, protein aggregates, and malfunctioning organelles. In humans, it is particularly important for long-lived cells such as neurons and helps prevent neurodegenerative diseases such as Parkinson’s and Alzheimer’s (Choi et al., 2013; Lu et al., 2022). For this reason, there is great interest in understanding the proteins that control selective autophagy and how they interact. Much of this research has focused on autophagy in the model eukaryote Saccharomyces cerevisiae, baker’s yeast.
Selective autophagy in yeast begins when cargo receptor proteins are recruited to a specific autophagic cargo. These receptors bind to Atg11, the central organizer of the autophagy initiation complex during selective autophagy (Yorimitsu & Klionsky, 2005; Zientara-Rytter & Subramani, 2020). This then arranges the proteins that start the process of building the autophagosome - the double-membrane vesicle that will envelop the cargo and deliver it to the vacuole for degradation.
The structure of Atg11 is unknown, as is the manner by which it recruits and organizes the autophagic machinery. It is predicted to be a dimer with many coiled-coil domains (Yorimitsu & Klionsky, 2005). Biophysical data has verified it to be a rod-shaped parallel dimer (Suzuki & Noda, 2018), and a crystal structure of a portion of coiled-coil domain 3 shows it to be a flexible coil (Margolis et al., 2020). Atg11 binds to cargo receptors via its C-terminal claw domain, the structure of which has been solved for its human homolog FIP200 (Turco et al., 2019). A cryo-EM structure the N-terminal half of the FIP200 protein is also available (Chen et al., 2025); however, the N-terminal region of FIP200 is not homologous to that of Atg11. This region binds to core autophagic machinery such as the kinase Atg1 and the scramblase Atg9 (He et al., 2006; Meyer et al., 2022; Yorimitsu & Klionsky, 2005). Atg9 is a trimeric transmembrane protein that is found in populations of small vesicles, and Atg11 binding to Atg9 recruits these vesicles and causes their fusion to form the phagophore (Backues et al., 2015; Yamamoto et al., 2012). Atg9 equilibrates lipids delivered from the ER to both bilayers of this membrane; as such, it is critical for the formation of the autophagosome (Guardia et al., 2020; Orii et al., 2021; Sawa-Makarska et al., 2020).
Atg9 has been shown to interact with Atg11 via two PLF motifs in its N-terminal unstructured region: PLF163-165 and PLF187-189 (Coudevylle et al., 2022). A neighboring histidine, H192, is also involved (He et al., 2006), and mutation of these residues blocks autophagy via preventing recruitment of Atg9 to the site of autophagosome formation (Coudevylle et al., 2022; He et al., 2006). However, it is unknown which residues in Atg11 interact with Atg9.
Previous studies have shown that amino acid residues (a.a.) 1-627 of Atg11 are sufficient for binding to Atg9 (He et al., 2006) while a.a. 1-454 are not (Hollenstein et al., 2021), suggesting that the Atg9 binding site might be between a.a. 455-627. Our lab previously investigated part of this region: a.a. 536-576, termed coiled-coil domain 2 (CC2), which had initially been implicated as a likely site for the binding of both Atg1 and Atg9 as well as Atg11 dimerization (Yorimitsu & Klionsky, 2005). However, our systematic mutagenesis data suggested that CC2 is more likely to be involved in overall folding and stability of the N-terminus of Atg11 (Meyer et al., 2022). Therefore, we focused on a.a. 455-535, as that region had not been previously investigated (Figure 1A).
Yeast-2-Hybrid (Y2H) results showed that atg11Δ455-535 lost interaction with Atg9, just like atg11ΔCC2 (Figure 1B). We then examined sequence of the 455-535 region across various yeast species, looking for residues that were conserved in the family Saccharomycetacea, where the Atg11-binding region of Atg9 was conserved, but not conserved in other species from order Saccharomycetales where the Atg11-binding region of Atg9 was not conserved. This analysis yielded four residues: Y468, D516, L517 and L526. A quadruple mutant of all of those residues to alanine (YDLL) mostly lost interaction with Atg9 by yeast-2-hybrid. However, subsets of 2 or 3 of these mutations (YDL, DLL, or DL) did not lose interaction, suggesting that none of these was a critical residue (Figure 1B).
We used AlphaFold2 Multimer to predict the structure of the Atg11 dimer. The top-ranked model was a “flask-shaped” parallel dimer (Figure 1C). However, some other models predicted a Z-shaped dimer (Figure 1D). Both models showed extensive monomer-monomer interactions in CC2, CC3 and CC4, consistent with previous reports that both the N- and C- termini of Atg11 could dimerize (Suzuki & Noda, 2018). They both suggested that CC1 and CC2 formed an L-shaped helical bundle, with CC3 and the C-terminus connected by disordered linkers; however, the placement of CC3 and the C-terminus varied between these models - in the flask-shaped, they were neatly packed against each other, while in the Z-shaped dimer, they were placed at random angles, not interacting with CC1, CC2, or each other. The pLDDT for both models was relatively low, particularly at a critical interface at the bottom of the flask-shape, raising the possibility that Atg11 can take on multiple conformations (Figure 1E).
Y468 and L526 were placed on the interior of the Atg11 dimer in both AlphaFold models, which would not allow a direct role in Atg9 binding, while D516 and L517 were partially surface exposed (Figure 1F). We mutated residues E515-S519 to alanine (EDLLS) to target that entire surface, but this mutant did not lose interaction with Atg9 (Figure 1B). We also generated three additional mutants, QQ, QNLNK, and TV, all of which targeted sets of residues within the 455-535 region that the AlphaFold models predicted to be surface exposed (Figure 1G). However, none of these mutants lost interaction, either (Figure 1B).
The region downstream of CC2 was primarily disordered in our AlphaFold models. To determine if this region was important for Atg9 binding, we replaced residues 576-627 of Atg11 with residues 2-53 of an intrinsically unstructured protein, PAI3. The Atg11_IA3 mutant showed a partial loss of interaction with Atg9 by yeast-2-hybrid (Figure 1B).
Finally, we confirmed our yeast-2-hybrid results by performing co-immunprecipitation (CoIP) assays between Atg9-PA and selected GFP-Atg11 mutants. These showed a partial loss of interaction between Atg9 and all of the Atg11 mutants tested - YDLL, YDL, DLL and IA3. In addition, there was a reduction of the levels of the YDLL, YDL and DLL mutants in the lysates, suggesting that these mutations might be detrimental to the overall stability of Atg11 (Figure 1H,I).
Overall, none of the residues or regions we mutated emerged as strong candidates for an Atg9 binding site. The YDLL mutant showed a loss of interaction only when all four residues were mutated, and CoIP results showed that this was only a partial loss of interaction. The fact that these residues are predicted to be in different locations on the folded protein and two of them are predicted to be interior-facing, along with the lower expression observed for this mutant, suggests that they have a primary effect on Atg11 folding and only a secondary effect on Atg9 binding. Similarly, the fact that replacement of 52 residues with those of an unrelated protein led to only a partial loss in binding suggests that the a.a. 576-627 is also not the binding site for Atg9. Interestingly, a recent study showed that an overlapping region, a.a. 612-646, has membrane-binding properties, supporting a different role for this part of Atg11 (Andhare et al., 2025).
We have not exhaustively mutated a.a. 455-627, so we can not rule out the possibility that Atg9 binds in this region. However, we have mutated the most likely candidate residues without finding any specifically responsible for Atg9 binding, suggesting that the core Atg9 binding region may lie elsewhere in the Atg11 N-terminus, while a.a. 455-627 have an indirect effect. The AlphaFold multimer model predicts a.a. 454-591 to be a dimerization interface for Atg11; therefore, we speculate that the removal of a.a. 455-627 from the N-terminal construct may disrupt its proper folding and dimerization, leading indirectly to a loss of Atg9 binding.
","references":[{"reference":"Andhare D, Katzenell S, Najera SI, Mauras SC, Bauer KM, Ragusa MJ. 2025. Reconstitution of autophagic-like membrane tethering reveals that Atg11 can bind and cluster vesicles on cargo mimetics. Autophagy : 1-20.
","pubmedId":"","doi":"10.1080/15548627.2025.2551678"},{"reference":"Backues SK, Orban DP, Bernard Al, Singh K, Cao Y, Klionsky DJ. 2014. Atg23 and Atg27 Act at the Early Stages of Atg9 Trafficking in S. cerevisiae. Traffic 16: 172-190.
","pubmedId":"","doi":"10.1111/tra.12240"},{"reference":"Cao Y, Nair U, Yasumura-Yorimitsu K, Klionsky DJ. 2009. A multipleATGgene knockout strain for yeast two-hybrid analysis. Autophagy 5: 699-705.
","pubmedId":"","doi":"10.4161/auto.5.5.8382"},{"reference":"Chen M, Nguyen TN, Ren X, Khuu G, Cook ASI, Zhao Y, et al., Hurley. 2025. Structure and activation of the human autophagy-initiating ULK1C:PI3KC3-C1 supercomplex. Nature Structural & Molecular Biology 32: 1596-1605.
","pubmedId":"","doi":"10.1038/s41594-025-01557-x"},{"reference":"Choi AMK, Ryter SW, Levine B. 2013. Autophagy in Human Health and Disease. New England Journal of Medicine 368: 651-662.
","pubmedId":"","doi":"10.1056/NEJMra1205406"},{"reference":"Coudevylle N, Banaś Bo, Baumann V, Schuschnig M, Zawadzka-Kazimierczuk A, Koźmiński W, Martens S. 2022. Mechanism of Atg9 recruitment by Atg11 in the cytoplasm-to-vacuole targeting pathway. Journal of Biological Chemistry 298: 101573.
","pubmedId":"","doi":"10.1016/j.jbc.2022.101573"},{"reference":"Delgado J, Radusky LG, Cianferoni D, Serrano L. 2019. FoldX 5.0: working with RNA, small molecules and a new graphical interface. Bioinformatics 35: 4168-4169.
","pubmedId":"","doi":"10.1093/bioinformatics/btz184"},{"reference":"Evans R, O’Neill M, Pritzel A, Antropova N, Senior A, Green T, et al., Hassabis. 2021. Protein complex prediction with AlphaFold-Multimer. : 10.1101/2021.10.04.463034.
","pubmedId":"","doi":"10.1101/2021.10.04.463034"},{"reference":"Gietz RD, Schiestl RH. 2007. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols 2: 31-34.
","pubmedId":"","doi":"10.1038/nprot.2007.13"},{"reference":"Guardia CM, Tan XF, Lian T, Rana MS, Zhou W, Christenson ET, et al., Banerjee. 2020. Structure of Human ATG9A, the Only Transmembrane Protein of the Core Autophagy Machinery. Cell Reports 31: 107837.
","pubmedId":"","doi":"10.1016/j.celrep.2020.107837"},{"reference":"He C, Song H, Yorimitsu T, Monastyrska I, Yen WL, Legakis JE, Klionsky DJ. 2006. Recruitment of Atg9 to the preautophagosomal structure by Atg11 is essential for selective autophagy in budding yeast. The Journal of Cell Biology 175: 925-935.
","pubmedId":"","doi":"10.1083/jcb.200606084"},{"reference":"Hollenstein DM, Licheva M, Konradi N, Schweida D, Mancilla H, Mari M, Reggiori F, Kraft C. 2021. Spatial control of avidity regulates initiation and progression of selective autophagy. Nature Communications 12: 10.1038/s41467-021-27420-3.
","pubmedId":"","doi":"10.1038/s41467-021-27420-3"},{"reference":"Kim J, Kamada Y, Stromhaug PE, Guan J, Hefner-Gravink A, Baba M, et al., Klionsky. 2001. Cvt9/Gsa9 Functions in Sequestering Selective Cytosolic Cargo Destined for the Vacuole. The Journal of Cell Biology 153: 381-396.
","pubmedId":"","doi":"10.1083/jcb.153.2.381"},{"reference":"Lu G, Wang Y, Shi Y, Zhang Z, Huang C, He W, Wang C, Shen HM. 2022. Autophagy in health and disease: From molecular mechanisms to therapeutic target. MedComm 3: 10.1002/mco2.150.
","pubmedId":"","doi":"10.1002/mco2.150"},{"reference":"Margolis HK, Katzenell S, Leary KA, Ragusa MJ. 2020. The Third Coiled Coil Domain of Atg11 Is Required for Shaping Mitophagy Initiation Sites. Journal of Molecular Biology 432: 5752-5764.
","pubmedId":"","doi":"10.1016/j.jmb.2020.08.025"},{"reference":"Meyer MD, Winzeler J, Taylor SM, Kilgore A, Edicha K, Chitwood C, et al., Backues. 2022. Mapping Critical Residues in ATG11’s Coiled-Coil 2 Domain that Block Multiple Interactions and Disrupt Selective Autophagy. Frontiers in Cell and Developmental Biology 9: 10.3389/fcell.2021.775364.
","pubmedId":"","doi":"10.3389/fcell.2021.775364"},{"reference":"Orii M, Tsuji T, Ogasawara Y, Fujimoto T. 2021. Transmembrane phospholipid translocation mediated by Atg9 is involved in autophagosome formation. Journal of Cell Biology 220: 10.1083/jcb.202009194.
","pubmedId":"","doi":"10.1083/jcb.202009194"},{"reference":"Sawa-Makarska J, Baumann V, Coudevylle N, von Bülow Sr, Nogellova V, Abert C, et al., Martens. 2020. Reconstitution of autophagosome nucleation defines Atg9 vesicles as seeds for membrane formation. Science 369: 10.1126/science.aaz7714.
","pubmedId":"","doi":"10.1126/science.aaz7714"},{"reference":"Schrödinger, LLC. (2015). The PyMOL Molecular Graphics System, Version 1.8.
","pubmedId":"","doi":""},{"reference":"Suzuki H, Noda NN. 2017. Biophysical characterization of Atg11, a scaffold protein essential for selective autophagy in yeast. FEBS Open Bio 8: 110-116.
","pubmedId":"","doi":"10.1002/2211-5463.12355"},{"reference":"Turco E, Witt M, Abert C, Bock-Bierbaum T, Su MY, Trapannone R, et al., Martens. 2019. FIP200 Claw Domain Binding to p62 Promotes Autophagosome Formation at Ubiquitin Condensates. Molecular Cell 74: 330-346.e11.
","pubmedId":"","doi":"10.1016/j.molcel.2019.01.035"},{"reference":"Xie Z, Klionsky DJ. 2007. Autophagosome formation: core machinery and adaptations. Nature Cell Biology 9: 1102-1109.
","pubmedId":"","doi":"10.1038/ncb1007-1102"},{"reference":"Yamamoto H, Kakuta S, Watanabe TM, Kitamura A, Sekito T, Kondo-Kakuta C, et al., Ohsumi. 2012. Atg9 vesicles are an important membrane source during early steps of autophagosome formation. Journal of Cell Biology 198: 219-233.
","pubmedId":"","doi":"10.1083/jcb.201202061"},{"reference":"Yorimitsu T, Klionsky DJ. 2005. Atg11 Links Cargo to the Vesicle-forming Machinery in the Cytoplasm to Vacuole Targeting Pathway. Molecular Biology of the Cell 16: 1593-1605.
","pubmedId":"","doi":"10.1091/mbc.e04-11-1035"},{"reference":"Zientara-Rytter K, Subramani S. 2020. Mechanistic Insights into the Role of Atg11 in Selective Autophagy. Journal of Molecular Biology 432: 104-122.
","pubmedId":"","doi":"10.1016/j.jmb.2019.06.017"}],"title":"Screening for residues in Atg11, a central organizer of selective autophagy in yeast, important for binding with Atg9
","reviews":[{"reviewer":{"displayName":"Elizabeth Delorme-Axford "},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[]},{"id":"2d614cb2-0c55-4b75-ae77-5eb192f568c1","decision":"accept","abstract":"The yeast protein Atg11, whose structure is not fully solved, is a central organizer of autophagosome formation that recruits Atg9 during selective autophagy. Although the residues in Atg9 responsible for this interaction are known, those in Atg11 are not. In an attempt to discover the binding site of Atg9 on Atg11, we screened a number of mutants within amino acid residues 455-627 of Atg11, guided in part by an AlphaFold2-generated model of the Atg11 dimer. However, we were not able to identify specific residues essential for the interaction with Atg9, suggesting that the binding region may lie elsewhere on Atg11.
","acknowledgements":"","authors":[{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"chimids@umich.edu","firstName":"Chimi Dolker","lastName":"Sherpa","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0003-4253-0827"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"omo14patric@gmail.com","firstName":"Patricia","lastName":"Woghiren","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0003-6468-2661"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"erinleo@umich.edu","firstName":"Erin","lastName":"Leonello","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-5163-1973"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_originalDraft","visualization"],"email":"mabdelkh@emich.edu","firstName":"Mina","lastName":"Abdel-Khalek","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-3140-3827"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_originalDraft","visualization"],"email":"bschuess@emich.edu","firstName":"Benjamin J. ","lastName":"Schuessler","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-2920-8932"},{"affiliations":["Michigan State University"],"departments":["MSU-DOE Plant Research Laboratory"],"credit":["investigation","writing_reviewEditing"],"email":"vermaasj@msu.edu","firstName":"Josh V.","lastName":"Vermaas","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3139-6469"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","methodology","supervision","writing_originalDraft"],"email":"sbackues@emich.edu","firstName":"Steven K.","lastName":"Backues","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-7346-1428"}],"awards":[{"awardId":"2243163","funderName":"U.S. National Science Foundation (United States)","awardRecipient":"Steven K. Backues"},{"awardId":"R35GM155317","funderName":"National Institutes of Health (United States)","awardRecipient":"Josh V. Vermaas"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/96aea156fe28eda5d76ab4fa0b9ca791.png"},"imageCaption":"(A) Schematic representation of Atg11 showing the coiled-coil domains (black boxes) and the CLAW domain (grey box), with a.a. shown by italicized numbers. Fragments previously reported to bind or not bind with Atg9 are indicated. (B) Yeast 2 hybrid assay of BD-Atg9 with the indicated AD-Atg11 mutants. Non-selective media is SMD -ura -leu; selective media is SMD -ura -leu -his +1.5 mM 3-AT. On selective media, (+) indicates growth and (-) indicates no growth across multiple replicates of the assay. AD-EV = pGAD empty vector; other mutants as described in text. (C) Alignment analysis of the conservation of Atg11 residues 467-469 across yeast species where the Atg11-interacting residues of Atg9 are conserved or are not as conserved. (D) Front and side view of the flask-shaped Atg11 dimer and (E) front view of the Z-shaped Atg11 dimer predicted with AlphaFold2 Multimer. (F) pLDDT confidence map of the flask-shaped Atg11 structure. (G) Close-up of flask-shaped dimer showing predicted locations of YDLL residues. (H) Surface rendering of flask-shaped model highlighting predicted surface exposed residues in the 455-535 region. (I) CoIP of various overexpressed GFP-Atg11 mutants by overexpressed Atg9-PA. Blots were probed with anti-GFP, which also detects the PA tag. (J) Quantitative analysis of CoIP results. The Atg11 to Atg9 band intensity ratio was normalized to the values from WT for each replicate. For the CoIP graph, the GFP-Atg11 band intensity of the 𝚫CC2 samples, which are known to show no binding (Meyer et al., 2022), were used as the background and subtracted from the GFP-Atg11 band intensity of the other samples before normalizing. Error bars are 95% confidence intervals.
","imageTitle":"Mutations in the 455-535 and 576-627 regions of Atg11 do not cause full loss of interaction with Atg9:
","methods":"Sequence analysis to identify candidate Atg9-binding residues: Atg9 homologues in 23 yeast species were scored as “conserved” or “not conserved” based on the conservation of residues known to be involved in binding of Atg11 (H192, PLF163-165, and PLF187-189). Then, an alignment of Atg11 residues 455-535 in the same species was manually screened for residues that were conserved only in species where Atg9 was conserved. A full description of this process and the alignments can be found in the supporting data at https://osf.io/rnx7v.
Strain and plasmid construction: The pGAD-ATG11 mutant plasmids were ordered from GenScript. The pRS416-Cu-GFP-ATG11 mutant plasmids (YDLL, YDL, and DLL) were made using InFusion cloning. The vector pRS416-Cu-GFP-ATG11 was digested with EcoRI-HF (NEB), which cuts at two endogenous EcoRI sites in Atg11. The insert was amplified by PCR using Phusion polymerase (NEB) from the respective pGAD-ATG11 mutant with primers 5’-AGAAGAAGAAGAATTCAATAGTCAAG-3’ and 5’-ATTTGCTATAGAATTCTCATTTTCATC-3’, ordered from IDT. The vector and insert were combined by InFusion reaction (Clontech, Takara Bio USA Inc.) and transformed into E. coli DH5ɑ (Stellar Competent Cells - HST08 strain) and plated on LB carbenicillin plates for colony growth. pRS416-Cu-GFP-ATG11IA3 was generated by similar methods, except the digest was performed with AvrII and HindIII and the primers used were 5’-CAGATGGAAATCCTAGGTATTA-3’ and 5’-CAACTTCATAAAGCTTATTGTC-3’.
Plasmids were purified using Purelink plasmid miniprep kits (ThermoFisher), verified by Sanger sequencing (Eton Biosciences) and/or whole plasmid sequencing (Plasmidsaurus) and introduced into yeast cells using standard transformation procedures (Gietz & Schiestl, 2007).
Yeast-2-hybrid: Yeast multiple-knockout cells (lacking 25 ATG genes to minimize indirect or interfering interactions; YCY149) expressing BD-ATG9 and AD-ATG11 or mutants thereof were patched on both selective (SMD -ura -leu -his w/ 1.5 mM 3-amino-triazol) and nonselective (SMD -ura -leu) plates and grown for 4–5 days at 30°C before imaging. Results shown are representative of at least five replicates per strain (except for AD-EV and QNLNK, where only two replicates were performed). Full results of all replicates and representative images of complete plates can be found in the supporting data at https://osf.io/4h6bz/.
Co-Immunoprecipitation and Western Blotting: Yeast were grown under nutrient rich conditions using SMD -ura -trp media at 30°C with shaking at 300 rpm, and harvested while in log phase (OD600 < 1). Co-immunoprecipitation was carried out exactly as described previously (Meyer et al., 2022) except that all washes were performed in the 4℃ cold room to help prevent breakdown. Precast 4-15% gradient SDS-PAGE gels (Bio-Rad) and BLUEstain2 protein ladder (GoldBio) were used. The electrophoresis was run for ~3 hours, starting at 80 V and increasing to 120 V after initial band separation. Gels were transferred to PVDF membranes via tank transfer, which was run for 1 hour at 120 V. Membranes were incubated in blocking solution (4% non-fat dry milk in tris-buffered saline). To detect Atg9-PA tag pulldowns, 1:500 mouse anti-GFP primary antibody (Takara; JL-8) and 1:5000 peroxidase-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch; 115-035-003) were used.
Structural Modeling: To develop structure-based hypotheses for potential interaction sites between Atg9 and Atg11, AlphaFold-Multimer version 2.3.2 (Evans et al., 2022) was used to generate 25 potential interaction complexes. These complexes were optimized using the FoldX4 “repair” function (Delgado et al., 2019). Visualization was performed in PyMol 3 (Schrödinger, LLC, 2015).
","reagents":"Saccharomyces cerevisiae strains used in this study | ||
Name | Genotype | Source |
atg11Δ | MATα his3Δ200 leu2-3,112 lys2-801 suc2-Δ9 trp1Δ901 ura3-52 atg11Δ::KanMX | Meyer et al., 2022 |
YCY149 | MATα his3-Δ200 leu2-3,112 lys2-801 trp1-Δ901 suc2-Δ9 ura3-52 atg1Δ, 2Δ, 3Δ, 4Δ, 5Δ, 6Δ, 7Δ, 8Δ, 9Δ, 10Δ, 11Δ, 12Δ, 13Δ, 14Δ, 16Δ, 17Δ, 18Δ, 19Δ, 20Δ, 21Δ, 23Δ, 24Δ, 27Δ, 29Δ gal4Δ gal80Δ GAL1-HIS3 GAL2-ADE2 met2∷GAL7-lacZ atg31Δ∷KanMX | Cao et al., 2009 |
Plasmids used in this study | ||
Name | Description | Source |
pGBDU-Atg9 | BD vector with full length Atg9 | He et al., 2006 |
pGAD-ATG11 | AD vector with full length WT Atg11 | Meyer et al., 2022 |
pGAD-ATG11ΔCC2 | AD vector with atg11∆536-576 | Meyer et al., 2022 |
pGAD-ATG11Δ455-535 | AD vector with atg11∆455-535 | This study |
pGAD-ATG11YDLL | AD vector with atg11Y468A, D516A, L517A, L526A | This study |
pGAD-ATG11YDL | AD vector with atg11Y468A, D516A, L517A | This study |
pGAD-ATG11DLL | AD vector with atg11 D516A, L517A, L526A | This study |
pGAD-ATG11DL | AD vector with atg11 D516A, L517A | This study |
pGAD-ATG11EDLLS | AD vector with atg11 E515A, D516A, L517A, L518A, S519A | This study |
pGAD-ATG11QQ | AD vector with atg11 Q475A, Q476A | This study |
pGAD-ATG11QNLNK | AD vector with atg11 Q493A, N494A, L496A, N500A, K501A | This study |
pGAD-ATG11TV | AD vector with atg11 T511A, V512A | This study |
pGAD-ATG11IA3 | AD vector with atg11 where residues 576-627 were replaced with residues 2-53 of scPAI3 (aka IA3). | This study |
pRS414-Cu-ATG9-PA | ATG9 tagged with Protein A, driven by the CUP1 promoter | Meyer et al., 2022 |
pRS416-Cu-GFP-ATG11 | GFP-ATG11 WT driven by the CUP1 promoter | Kim et al., 2001 |
pRS416-Cu-GFP-ATG11ΔCC2 | GFP-atg11∆536-576 driven by the CUP1 promoter | Meyer et al., 2022 |
pRS416-Cu-GFP-ATG11YDLL | GFP-atg11Y468A, D516A, L517A, L526A driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-ATG11YDL | GFP-atg11Y468A, D516A, L517A, driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-ATG11DLL | GFP-atg11 D516A, L517A, L526A driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-ATG11IA3 | GFP-atg11 with residues 576-627 replaced with residues 2-53 of scPAI3 (aka IA3). Driven by the CUP1 promoter. | This study |
Antibodies used in this study | ||
Name | Identifier (Source) | Concentration |
“Living Colors” mouse monoclonal anti-GFP (JL-8) | Cat# 632381 (Clontech / Takara) | 1:500 |
Peroxidase AffiniPure® Goat Anti-Mouse IgG | Cat# 115-035-003 (Jackson ImmunoResearch) | 1:5000 |
Macroautophagy (hereafter referred to simply as autophagy) is a critical stress-response pathway conserved in all eukaryotes. Bulk autophagy, triggered by starvation, semi-randomly degrades materials from the cytoplasm in order to reuse the nutrients for cellular survival. In contrast, selective autophagy is not primarily regulated by a need for nutrients but targets specific cytoplasmic cargo to the lysosome (in animals) or vacuole (in other eukaryotes) for degradation (Xie & Klionsky, 2007). Selective autophagy contributes to the health of the cell by breaking down intracellular pathogens, protein aggregates, and malfunctioning organelles. In humans, it is particularly important for long-lived cells such as neurons and helps prevent neurodegenerative diseases such as Parkinson’s and Alzheimer’s (Choi et al., 2013; Lu et al., 2022). For this reason, there is great interest in understanding the proteins that control selective autophagy and how they interact. Much of this research has focused on autophagy in the model eukaryote Saccharomyces cerevisiae, baker’s yeast.
Selective autophagy in yeast begins when cargo receptor proteins are recruited to a specific autophagic cargo. These receptors bind to Atg11, the central organizer of the autophagy initiation complex during selective autophagy (Yorimitsu & Klionsky, 2005; Zientara-Rytter & Subramani, 2020). This then arranges the proteins that start the process of building the autophagosome - the double-membrane vesicle that will envelop the cargo and deliver it to the vacuole for degradation.
The structure of Atg11 is not fully solved, nor is the manner by which it recruits and organizes the autophagic machinery fully understood. It is predicted to be a dimer with many coiled-coil domains (Yorimitsu & Klionsky, 2005). Biophysical data has verified it to be a rod-shaped parallel dimer (Suzuki & Noda, 2018), and a crystal structure of a portion of coiled-coil domain 3 shows this to be a flexible coil (Margolis et al., 2020). Atg11 binds to cargo receptors via its C-terminal claw domain, the structure of which has been solved for its human homolog FIP200 (Turco et al., 2019). A cryo-EM structure of the N-terminal half of the FIP200 protein is also available (Chen et al., 2025); however, the N-terminal region of FIP200 is not homologous to that of Atg11. This region binds to core autophagic machinery such as the kinase Atg1 and the scramblase Atg9 (He et al., 2006; Meyer et al., 2022; Yorimitsu & Klionsky, 2005). Atg9 is a trimeric transmembrane protein that is found in populations of small vesicles, and Atg11 binding to Atg9 recruits these vesicles and causes their fusion to form the phagophore (Backues et al., 2015; Yamamoto et al., 2012). Atg9 equilibrates lipids delivered from the ER to both bilayers of the phagophore membrane; as such, it is critical for the formation of the autophagosome (Guardia et al., 2020; Orii et al., 2021; Sawa-Makarska et al., 2020).
Atg9 has been shown to interact with Atg11 via two PLF (Pro-Leu-Phe) motifs in its N-terminal unstructured region: PLF163-165 and PLF187-189 (Coudevylle et al., 2022). A neighboring histidine, H192, is also involved (He et al., 2006), and mutation of these residues blocks selective autophagy by preventing recruitment of Atg9 to the site of autophagosome formation (Coudevylle et al., 2022; He et al., 2006). However, it is unknown which residues in Atg11 interact with Atg9.
Previous studies have shown that amino acid residues (a.a.) 1-627 of Atg11 are sufficient for binding to Atg9 (He et al., 2006) while a.a. 1-454 are not (Hollenstein et al., 2021), suggesting that the Atg9 binding site might be between a.a. 455-627. Our lab previously investigated part of this region: a.a. 536-576, termed coiled-coil domain 2 (CC2), which had initially been implicated as a likely site for the binding of both Atg1 and Atg9 as well as Atg11 dimerization (Yorimitsu & Klionsky, 2005). However, our systematic mutagenesis data suggested that CC2 is more likely to be involved in overall folding and stability of the N-terminus of Atg11 (Meyer et al., 2022). Therefore, we focused on a.a. 455-535, as that region had not been previously investigated (Figure 1A).
Yeast-2-Hybrid (Y2H) results showed that atg11Δ455-535 lost interaction with Atg9, just like atg11ΔCC2 (Figure 1B). We then examined the sequence of the 455-535 region across various yeast species, looking for residues that are conserved in the family Saccharomycetacea, where the Atg11-binding region of Atg9 is conserved, but not conserved in other species from order Saccharomycetales where the Atg11-binding region of Atg9 is not conserved (Figure 1C). This analysis yielded four residues: Y468, D516, L517 and L526. A quadruple mutant of all of those residues to alanine (YDLL) mostly lost interaction with Atg9, though a little bit of growth could still be detected in the Y2H assay. However, subsets of 2 or 3 of these mutations (YDL, DLL, or DL) did not lose interaction in this assay, suggesting that none of these was a critical residue (Figure 1B).
We used AlphaFold2 Multimer to predict the structure of the Atg11 dimer. The top-ranked model was a “flask-shaped” parallel dimer (Figure 1D). However, some other models predicted a Z-shaped dimer (Figure 1E). Both models showed extensive monomer-monomer interactions in CC2, CC3 and CC4, consistent with previous reports that both the N- and C- termini of Atg11 could dimerize (Suzuki & Noda, 2018). They both suggested that CC1 and CC2 formed an L-shaped helical bundle, with CC3 and the C-terminus connected by disordered linkers; however, the placement of CC3 and the C-terminus varied between these models - in the flask-shaped, they were neatly packed against each other, while in the Z-shaped dimer, they were placed at random angles, not interacting with CC1, CC2, or each other. The pLDDT for both models was relatively low, particularly at a critical interface at the bottom of the flask-shape, raising the possibility that Atg11 can take on multiple conformations (Figure 1F).
Y468 and L526 were placed on the interior of the Atg11 dimer in both AlphaFold models, which would not allow a direct role in Atg9 binding, while D516 and L517 were partially surface exposed (Figure 1G). We mutated residues E515-S519 to alanine (EDLLS) to target that entire surface, but this mutant did not lose interaction with Atg9 (Figure 1B). We also generated three additional mutants, QQ (Q475A, Q476A), QNLNK (Q493A, N494A, L496A, N500A, K501A), and TV (T511A, V512A), all of which targeted sets of residues within the 455-535 region that the AlphaFold models predicted to be surface exposed (Figure 1H). However, none of these mutants lost interaction, either (Figure 1B).
The region downstream of CC2 was primarily disordered in our AlphaFold models. To determine if this region was important for Atg9 binding, we replaced residues 576-627 of Atg11 with residues 2-53 of an intrinsically unstructured protein, PAI3. The Atg11_IA3 mutant showed a partial loss of interaction with Atg9 by yeast-2-hybrid (Figure 1B).
Finally, we confirmed our yeast-2-hybrid results by performing co-immunprecipitation (CoIP) assays between Atg9-PA and selected GFP-Atg11 mutants. These were performed in growing conditions, where this interaction has previously been assessed (Coudevylle et al., 2022; He et al., 2006; Meyer et al., 2022). These showed a partial loss of interaction between Atg9 and all of the Atg11 mutants tested - YDLL, YDL, DLL and IA3. In addition, there was a reduction of the levels of the YDLL, YDL and DLL mutants in the lysates, suggesting that these mutations might be detrimental to the overall stability of Atg11 (Figure 1I,J).
Overall, none of the residues or regions we mutated emerged as strong candidates for an Atg9 binding site. The YDLL mutant showed a loss of interaction only when all four residues were mutated, and CoIP results showed that this was only a partial loss of interaction. The fact that these residues are predicted to be in different locations on the folded protein and two of them are predicted to be interior-facing, along with the lower expression observed for this mutant, suggests that they have a primary effect on Atg11 folding and only a secondary effect on Atg9 binding. Similarly, the fact that replacement of 52 residues with those of an unrelated protein led to only a partial loss in binding suggests that the a.a. 576-627 is also not the binding site for Atg9. Interestingly, a recent study showed that an overlapping region, a.a. 612-646, has membrane-binding properties, supporting a different role for this part of Atg11 (Andhare et al., 2025).
We have not exhaustively mutated a.a. 455-627, so we can not rule out the possibility that Atg9 binds in this region. However, we have mutated the most likely candidate residues without finding any specifically responsible for Atg9 binding, suggesting that the core Atg9 binding region may lie elsewhere in the Atg11 N-terminus, while a.a. 455-627 have an indirect effect. The AlphaFold multimer model predicts a.a. 454-591 to be a dimerization interface for Atg11; therefore, we speculate that the removal of a.a. 455-627 from the N-terminal construct may disrupt its proper folding and dimerization, leading indirectly to a loss of Atg9 binding.
","references":[{"reference":"Andhare D, Katzenell S, Najera SI, Mauras SC, Bauer KM, Ragusa MJ. 2025. Reconstitution of autophagic-like membrane tethering reveals that Atg11 can bind and cluster vesicles on cargo mimetics. Autophagy : 1-20.
","pubmedId":"","doi":"10.1080/15548627.2025.2551678"},{"reference":"Backues SK, Orban DP, Bernard Al, Singh K, Cao Y, Klionsky DJ. 2014. Atg23 and Atg27 Act at the Early Stages of Atg9 Trafficking in S. cerevisiae. Traffic 16: 172-190.
","pubmedId":"","doi":"10.1111/tra.12240"},{"reference":"Cao Y, Nair U, Yasumura-Yorimitsu K, Klionsky DJ. 2009. A multipleATGgene knockout strain for yeast two-hybrid analysis. Autophagy 5: 699-705.
","pubmedId":"","doi":"10.4161/auto.5.5.8382"},{"reference":"Chen M, Nguyen TN, Ren X, Khuu G, Cook ASI, Zhao Y, et al., Hurley. 2025. Structure and activation of the human autophagy-initiating ULK1C:PI3KC3-C1 supercomplex. Nature Structural & Molecular Biology 32: 1596-1605.
","pubmedId":"","doi":"10.1038/s41594-025-01557-x"},{"reference":"Choi AMK, Ryter SW, Levine B. 2013. Autophagy in Human Health and Disease. New England Journal of Medicine 368: 651-662.
","pubmedId":"","doi":"10.1056/NEJMra1205406"},{"reference":"Coudevylle N, Banaś Bo, Baumann V, Schuschnig M, Zawadzka-Kazimierczuk A, Koźmiński W, Martens S. 2022. Mechanism of Atg9 recruitment by Atg11 in the cytoplasm-to-vacuole targeting pathway. Journal of Biological Chemistry 298: 101573.
","pubmedId":"","doi":"10.1016/j.jbc.2022.101573"},{"reference":"Delgado J, Radusky LG, Cianferoni D, Serrano L. 2019. FoldX 5.0: working with RNA, small molecules and a new graphical interface. Bioinformatics 35: 4168-4169.
","pubmedId":"","doi":"10.1093/bioinformatics/btz184"},{"reference":"Evans R, O’Neill M, Pritzel A, Antropova N, Senior A, Green T, et al., Hassabis. 2021. Protein complex prediction with AlphaFold-Multimer. : 10.1101/2021.10.04.463034.
","pubmedId":"","doi":"10.1101/2021.10.04.463034"},{"reference":"Gietz RD, Schiestl RH. 2007. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols 2: 31-34.
","pubmedId":"","doi":"10.1038/nprot.2007.13"},{"reference":"Guardia CM, Tan XF, Lian T, Rana MS, Zhou W, Christenson ET, et al., Banerjee. 2020. Structure of Human ATG9A, the Only Transmembrane Protein of the Core Autophagy Machinery. Cell Reports 31: 107837.
","pubmedId":"","doi":"10.1016/j.celrep.2020.107837"},{"reference":"He C, Song H, Yorimitsu T, Monastyrska I, Yen WL, Legakis JE, Klionsky DJ. 2006. Recruitment of Atg9 to the preautophagosomal structure by Atg11 is essential for selective autophagy in budding yeast. The Journal of Cell Biology 175: 925-935.
","pubmedId":"","doi":"10.1083/jcb.200606084"},{"reference":"Hollenstein DM, Licheva M, Konradi N, Schweida D, Mancilla H, Mari M, Reggiori F, Kraft C. 2021. Spatial control of avidity regulates initiation and progression of selective autophagy. Nature Communications 12: 10.1038/s41467-021-27420-3.
","pubmedId":"","doi":"10.1038/s41467-021-27420-3"},{"reference":"Kim J, Kamada Y, Stromhaug PE, Guan J, Hefner-Gravink A, Baba M, et al., Klionsky. 2001. Cvt9/Gsa9 Functions in Sequestering Selective Cytosolic Cargo Destined for the Vacuole. The Journal of Cell Biology 153: 381-396.
","pubmedId":"","doi":"10.1083/jcb.153.2.381"},{"reference":"Lu G, Wang Y, Shi Y, Zhang Z, Huang C, He W, Wang C, Shen HM. 2022. Autophagy in health and disease: From molecular mechanisms to therapeutic target. MedComm 3: 10.1002/mco2.150.
","pubmedId":"","doi":"10.1002/mco2.150"},{"reference":"Margolis HK, Katzenell S, Leary KA, Ragusa MJ. 2020. The Third Coiled Coil Domain of Atg11 Is Required for Shaping Mitophagy Initiation Sites. Journal of Molecular Biology 432: 5752-5764.
","pubmedId":"","doi":"10.1016/j.jmb.2020.08.025"},{"reference":"Meyer MD, Winzeler J, Taylor SM, Kilgore A, Edicha K, Chitwood C, et al., Backues. 2022. Mapping Critical Residues in ATG11’s Coiled-Coil 2 Domain that Block Multiple Interactions and Disrupt Selective Autophagy. Frontiers in Cell and Developmental Biology 9: 10.3389/fcell.2021.775364.
","pubmedId":"","doi":"10.3389/fcell.2021.775364"},{"reference":"Orii M, Tsuji T, Ogasawara Y, Fujimoto T. 2021. Transmembrane phospholipid translocation mediated by Atg9 is involved in autophagosome formation. Journal of Cell Biology 220: 10.1083/jcb.202009194.
","pubmedId":"","doi":"10.1083/jcb.202009194"},{"reference":"Sawa-Makarska J, Baumann V, Coudevylle N, von Bülow Sr, Nogellova V, Abert C, et al., Martens. 2020. Reconstitution of autophagosome nucleation defines Atg9 vesicles as seeds for membrane formation. Science 369: 10.1126/science.aaz7714.
","pubmedId":"","doi":"10.1126/science.aaz7714"},{"reference":"Schrödinger, LLC. (2015). The PyMOL Molecular Graphics System, Version 1.8.
","pubmedId":"","doi":""},{"reference":"Suzuki H, Noda NN. 2017. Biophysical characterization of Atg11, a scaffold protein essential for selective autophagy in yeast. FEBS Open Bio 8: 110-116.
","pubmedId":"","doi":"10.1002/2211-5463.12355"},{"reference":"Turco E, Witt M, Abert C, Bock-Bierbaum T, Su MY, Trapannone R, et al., Martens. 2019. FIP200 Claw Domain Binding to p62 Promotes Autophagosome Formation at Ubiquitin Condensates. Molecular Cell 74: 330-346.e11.
","pubmedId":"","doi":"10.1016/j.molcel.2019.01.035"},{"reference":"Xie Z, Klionsky DJ. 2007. Autophagosome formation: core machinery and adaptations. Nature Cell Biology 9: 1102-1109.
","pubmedId":"","doi":"10.1038/ncb1007-1102"},{"reference":"Yamamoto H, Kakuta S, Watanabe TM, Kitamura A, Sekito T, Kondo-Kakuta C, et al., Ohsumi. 2012. Atg9 vesicles are an important membrane source during early steps of autophagosome formation. Journal of Cell Biology 198: 219-233.
","pubmedId":"","doi":"10.1083/jcb.201202061"},{"reference":"Yorimitsu T, Klionsky DJ. 2005. Atg11 Links Cargo to the Vesicle-forming Machinery in the Cytoplasm to Vacuole Targeting Pathway. Molecular Biology of the Cell 16: 1593-1605.
","pubmedId":"","doi":"10.1091/mbc.e04-11-1035"},{"reference":"Zientara-Rytter K, Subramani S. 2020. Mechanistic Insights into the Role of Atg11 in Selective Autophagy. Journal of Molecular Biology 432: 104-122.
","pubmedId":"","doi":"10.1016/j.jmb.2019.06.017"}],"title":"Screening Atg11, a central organizer of yeast selective autophagy, for residues involved in the Atg11-Atg9 interaction
","reviews":[{"reviewer":{"displayName":"Elizabeth Delorme-Axford "},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Stacia Engel"},"openAcknowledgement":false,"submitted":"1771972776439"}]},{"id":"50387485-ba5c-4bc1-848c-5091ff44772e","decision":"edit","abstract":"The yeast protein Atg11, whose structure is not fully solved, is a central organizer of autophagosome formation that recruits Atg9 during selective autophagy. Although the residues in Atg9 responsible for this interaction are known, those in Atg11 are not. In an attempt to discover the binding site of Atg9 on Atg11, we screened a number of mutants within amino acid residues 455-627 of Atg11, guided in part by an AlphaFold2-generated model of the Atg11 dimer. However, we were not able to identify specific residues essential for the interaction with Atg9, suggesting that the binding region may lie elsewhere on Atg11.
","acknowledgements":"","authors":[{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"chimids@umich.edu","firstName":"Chimi Dolker","lastName":"Sherpa","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0003-4253-0827"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"omo14patric@gmail.com","firstName":"Patricia","lastName":"Woghiren","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0003-6468-2661"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"erinleo@umich.edu","firstName":"Erin","lastName":"Leonello","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-5163-1973"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_originalDraft","visualization"],"email":"mabdelkh@emich.edu","firstName":"Mina","lastName":"Abdel-Khalek","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-3140-3827"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_originalDraft","visualization"],"email":"bschuess@emich.edu","firstName":"Benjamin J. ","lastName":"Schuessler","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-2920-8932"},{"affiliations":["Michigan State University"],"departments":["MSU-DOE Plant Research Laboratory"],"credit":["investigation","writing_reviewEditing"],"email":"vermaasj@msu.edu","firstName":"Josh V.","lastName":"Vermaas","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3139-6469"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","methodology","supervision","writing_originalDraft"],"email":"sbackues@emich.edu","firstName":"Steven K.","lastName":"Backues","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-7346-1428"}],"awards":[{"awardId":"2243163","funderName":"U.S. National Science Foundation (United States)","awardRecipient":"Steven K. Backues"},{"awardId":"R35GM155317","funderName":"National Institutes of Health (United States)","awardRecipient":"Josh V. Vermaas"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/96aea156fe28eda5d76ab4fa0b9ca791.png"},"imageCaption":"(A) Schematic representation of Atg11 showing the coiled-coil domains (black boxes) and the CLAW domain (grey box), with a.a. shown by italicized numbers. Fragments previously reported to bind or not bind with Atg9 are indicated. (B) Yeast 2 hybrid assay of BD-Atg9 with the indicated AD-Atg11 mutants. Non-selective media is SMD -ura -leu; selective media is SMD -ura -leu -his +1.5 mM 3-AT. On selective media, (+) indicates growth and (-) indicates no growth across multiple replicates of the assay. AD-EV = pGAD empty vector; other mutants as described in text. (C) Alignment analysis of the conservation of Atg11 residues 467-469 across yeast species where the Atg11-interacting residues of Atg9 are conserved or are not as conserved. (D) Front and side view of the flask-shaped Atg11 dimer and (E) front view of the Z-shaped Atg11 dimer predicted with AlphaFold2 Multimer. (F) pLDDT confidence map of the flask-shaped Atg11 structure. (G) Close-up of flask-shaped dimer showing predicted locations of YDLL residues. (H) Surface rendering of flask-shaped model highlighting predicted surface exposed residues in the 455-535 region. (I) CoIP of various overexpressed GFP-Atg11 mutants by overexpressed Atg9-PA. Blots were probed with anti-GFP, which also detects the PA tag. (J) Quantitative analysis of CoIP results. The Atg11 to Atg9 band intensity ratio was normalized to the values from WT for each replicate. For the CoIP graph, the GFP-Atg11 band intensity of the 𝚫CC2 samples, which are known to show no binding (Meyer et al., 2022), were used as the background and subtracted from the GFP-Atg11 band intensity of the other samples before normalizing. Error bars are 95% confidence intervals.
","imageTitle":"Mutations in the 455-535 and 576-627 regions of Atg11 do not cause full loss of interaction with Atg9:
","methods":"Sequence analysis to identify candidate Atg9-binding residues: Atg9 homologues in 23 yeast species were scored as “conserved” or “not conserved” based on the conservation of residues known to be involved in binding of Atg11 (H192, PLF163-165, and PLF187-189). Then, an alignment of Atg11 residues 455-535 in the same species was manually screened for residues that were conserved only in species where Atg9 was conserved. A full description of this process and the alignments can be found in the supporting data at https://osf.io/rnx7v.
Strain and plasmid construction: The pGAD-ATG11 mutant plasmids were ordered from GenScript. The pRS416-Cu-GFP-ATG11 mutant plasmids (YDLL, YDL, and DLL) were made using InFusion cloning. The vector pRS416-Cu-GFP-ATG11 was digested with EcoRI-HF (NEB), which cuts at two endogenous EcoRI sites in Atg11. The insert was amplified by PCR using Phusion polymerase (NEB) from the respective pGAD-ATG11 mutant with primers 5’-AGAAGAAGAAGAATTCAATAGTCAAG-3’ and 5’-ATTTGCTATAGAATTCTCATTTTCATC-3’, ordered from IDT. The vector and insert were combined by InFusion reaction (Clontech, Takara Bio USA Inc.) and transformed into E. coli DH5ɑ (Stellar Competent Cells - HST08 strain) and plated on LB carbenicillin plates for colony growth. pRS416-Cu-GFP-ATG11IA3 was generated by similar methods, except the digest was performed with AvrII and HindIII and the primers used were 5’-CAGATGGAAATCCTAGGTATTA-3’ and 5’-CAACTTCATAAAGCTTATTGTC-3’.
Plasmids were purified using Purelink plasmid miniprep kits (ThermoFisher), verified by Sanger sequencing (Eton Biosciences) and/or whole plasmid sequencing (Plasmidsaurus) and introduced into yeast cells using standard transformation procedures (Gietz & Schiestl, 2007).
Yeast-2-hybrid: Yeast multiple-knockout cells (lacking 25 ATG genes to minimize indirect or interfering interactions; YCY149) expressing BD-ATG9 and AD-ATG11 or mutants thereof were patched on both selective (SMD -ura -leu -his w/ 1.5 mM 3-amino-triazol) and nonselective (SMD -ura -leu) plates and grown for 4–5 days at 30°C before imaging. Results shown are representative of at least five replicates per strain (except for AD-EV and QNLNK, where only two replicates were performed). Full results of all replicates and representative images of complete plates can be found in the supporting data at https://osf.io/4h6bz/.
Co-Immunoprecipitation and Western Blotting: Yeast were grown under nutrient rich conditions using SMD -ura -trp media at 30°C with shaking at 300 rpm, and harvested while in log phase (OD600 < 1). Co-immunoprecipitation was carried out exactly as described previously (Meyer et al., 2022) except that all washes were performed in the 4℃ cold room to help prevent breakdown. Precast 4-15% gradient SDS-PAGE gels (Bio-Rad) and BLUEstain2 protein ladder (GoldBio) were used. The electrophoresis was run for ~3 hours, starting at 80 V and increasing to 120 V after initial band separation. Gels were transferred to PVDF membranes via tank transfer, which was run for 1 hour at 120 V. Membranes were incubated in blocking solution (4% non-fat dry milk in tris-buffered saline). To detect Atg9-PA tag pulldowns, 1:500 mouse anti-GFP primary antibody (Takara; JL-8) and 1:5000 peroxidase-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch; 115-035-003) were used.
Structural Modeling: To develop structure-based hypotheses for potential interaction sites between Atg9 and Atg11, AlphaFold-Multimer version 2.3.2 (Evans et al., 2022) was used to generate 25 potential interaction complexes. These complexes were optimized using the FoldX4 “repair” function (Delgado et al., 2019). Visualization was performed in PyMol 3 (Schrödinger, LLC, 2015).
","reagents":"Saccharomyces cerevisiae strains used in this study | ||
Name | Genotype | Source |
atg11Δ | MATα his3Δ200 leu2-3,112 lys2-801 suc2-Δ9 trp1Δ901 ura3-52 atg11Δ::KanMX | Meyer et al., 2022 |
YCY149 | MATα his3-Δ200 leu2-3,112 lys2-801 trp1-Δ901 suc2-Δ9 ura3-52 atg1Δ, 2Δ, 3Δ, 4Δ, 5Δ, 6Δ, 7Δ, 8Δ, 9Δ, 10Δ, 11Δ, 12Δ, 13Δ, 14Δ, 16Δ, 17Δ, 18Δ, 19Δ, 20Δ, 21Δ, 23Δ, 24Δ, 27Δ, 29Δ gal4Δ gal80Δ GAL1-HIS3 GAL2-ADE2 met2∷GAL7-lacZ atg31Δ∷KanMX | Cao et al., 2009 |
Plasmids used in this study | ||
Name | Description | Source |
pGBDU-Atg9 | BD vector with full length Atg9 | He et al., 2006 |
pGAD-ATG11 | AD vector with full length WT Atg11 | Meyer et al., 2022 |
pGAD-ATG11ΔCC2 | AD vector with atg11∆536-576 | Meyer et al., 2022 |
pGAD-ATG11Δ455-535 | AD vector with atg11∆455-535 | This study |
pGAD-ATG11YDLL | AD vector with atg11Y468A, D516A, L517A, L526A | This study |
pGAD-ATG11YDL | AD vector with atg11Y468A, D516A, L517A | This study |
pGAD-ATG11DLL | AD vector with atg11 D516A, L517A, L526A | This study |
pGAD-ATG11DL | AD vector with atg11 D516A, L517A | This study |
pGAD-ATG11EDLLS | AD vector with atg11 E515A, D516A, L517A, L518A, S519A | This study |
pGAD-ATG11QQ | AD vector with atg11 Q475A, Q476A | This study |
pGAD-ATG11QNLNK | AD vector with atg11 Q493A, N494A, L496A, N500A, K501A | This study |
pGAD-ATG11TV | AD vector with atg11 T511A, V512A | This study |
pGAD-ATG11IA3 | AD vector with atg11 where residues 576-627 were replaced with residues 2-53 of scPAI3 (aka IA3). | This study |
pRS414-Cu-ATG9-PA | ATG9 tagged with Protein A, driven by the CUP1 promoter | Meyer et al., 2022 |
pRS416-Cu-GFP-ATG11 | GFP-ATG11 WT driven by the CUP1 promoter | Kim et al., 2001 |
pRS416-Cu-GFP-ATG11ΔCC2 | GFP-atg11∆536-576 driven by the CUP1 promoter | Meyer et al., 2022 |
pRS416-Cu-GFP-ATG11YDLL | GFP-atg11Y468A, D516A, L517A, L526A driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-ATG11YDL | GFP-atg11Y468A, D516A, L517A, driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-ATG11DLL | GFP-atg11 D516A, L517A, L526A driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-ATG11IA3 | GFP-atg11 with residues 576-627 replaced with residues 2-53 of scPAI3 (aka IA3). Driven by the CUP1 promoter. | This study |
Antibodies used in this study | ||
Name | Identifier (Source) | Concentration |
“Living Colors” mouse monoclonal anti-GFP (JL-8) | Cat# 632381 (Clontech / Takara) | 1:500 |
Peroxidase AffiniPure® Goat Anti-Mouse IgG | Cat# 115-035-003 (Jackson ImmunoResearch) | 1:5000 |
Macroautophagy (hereafter referred to simply as autophagy) is a critical stress-response pathway conserved in all eukaryotes. Bulk autophagy, triggered by starvation, semi-randomly degrades materials from the cytoplasm in order to reuse the nutrients for cellular survival. In contrast, selective autophagy is not primarily regulated by a need for nutrients but targets specific cytoplasmic cargo to the lysosome (in animals) or vacuole (in other eukaryotes) for degradation (Xie & Klionsky, 2007). Selective autophagy contributes to the health of the cell by breaking down intracellular pathogens, protein aggregates, and malfunctioning organelles. In humans, it is particularly important for long-lived cells such as neurons and helps prevent neurodegenerative diseases such as Parkinson’s and Alzheimer’s (Choi et al., 2013; Lu et al., 2022). For this reason, there is great interest in understanding the proteins that control selective autophagy and how they interact. Much of this research has focused on autophagy in the model eukaryote Saccharomyces cerevisiae, baker’s yeast.
Selective autophagy in yeast begins when cargo receptor proteins are recruited to a specific autophagic cargo. These receptors bind to Atg11, the central organizer of the autophagy initiation complex during selective autophagy (Yorimitsu & Klionsky, 2005; Zientara-Rytter & Subramani, 2020). This then arranges the proteins that start the process of building the autophagosome - the double-membrane vesicle that will envelop the cargo and deliver it to the vacuole for degradation.
The structure of Atg11 is not fully solved, nor is the manner by which it recruits and organizes the autophagic machinery fully understood. It is predicted to be a dimer with many coiled-coil domains (Yorimitsu & Klionsky, 2005). Biophysical data has verified it to be a rod-shaped parallel dimer (Suzuki & Noda, 2018), and a crystal structure of a portion of coiled-coil domain 3 shows this to be a flexible coil (Margolis et al., 2020). Atg11 binds to cargo receptors via its C-terminal claw domain, the structure of which has been solved for its human homolog FIP200 (Turco et al., 2019). A cryo-EM structure of the N-terminal half of the FIP200 protein is also available (Chen et al., 2025); however, the N-terminal region of FIP200 is not homologous to that of Atg11. This region binds to core autophagic machinery such as the kinase Atg1 and the scramblase Atg9 (He et al., 2006; Meyer et al., 2022; Yorimitsu & Klionsky, 2005). Atg9 is a trimeric transmembrane protein that is found in populations of small vesicles, and Atg11 binding to Atg9 recruits these vesicles and causes their fusion to form the phagophore (Backues et al., 2015; Yamamoto et al., 2012). Atg9 equilibrates lipids delivered from the ER to both bilayers of the phagophore membrane; as such, it is critical for the formation of the autophagosome (Guardia et al., 2020; Orii et al., 2021; Sawa-Makarska et al., 2020).
Atg9 has been shown to interact with Atg11 via two PLF (Pro-Leu-Phe) motifs in its N-terminal unstructured region: PLF163-165 and PLF187-189 (Coudevylle et al., 2022). A neighboring histidine, H192, is also involved (He et al., 2006), and mutation of these residues blocks selective autophagy by preventing recruitment of Atg9 to the site of autophagosome formation (Coudevylle et al., 2022; He et al., 2006). However, it is unknown which residues in Atg11 interact with Atg9.
Previous studies have shown that amino acid residues (a.a.) 1-627 of Atg11 are sufficient for binding to Atg9 (He et al., 2006) while a.a. 1-454 are not (Hollenstein et al., 2021), suggesting that the Atg9 binding site might be between a.a. 455-627. Our lab previously investigated part of this region: a.a. 536-576, termed coiled-coil domain 2 (CC2), which had initially been implicated as a likely site for the binding of both Atg1 and Atg9 as well as Atg11 dimerization (Yorimitsu & Klionsky, 2005). However, our systematic mutagenesis data suggested that CC2 is more likely to be involved in overall folding and stability of the N-terminus of Atg11 (Meyer et al., 2022). Therefore, we focused on a.a. 455-535, as that region had not been previously investigated (Figure 1A).
Yeast-2-Hybrid (Y2H) results showed that atg11Δ455-535 lost interaction with Atg9, just like atg11ΔCC2 (Figure 1B). We then examined the sequence of the 455-535 region across various yeast species, looking for residues that are conserved in the family Saccharomycetacea, where the Atg11-binding region of Atg9 is conserved, but not conserved in other species from order Saccharomycetales where the Atg11-binding region of Atg9 is not conserved (Figure 1C). This analysis yielded four residues: Y468, D516, L517 and L526. A quadruple mutant of all of those residues to alanine (YDLL) mostly lost interaction with Atg9, though a little bit of growth could still be detected in the Y2H assay. However, subsets of 2 or 3 of these mutations (YDL, DLL, or DL) did not lose interaction in this assay, suggesting that none of these was a critical residue (Figure 1B).
We used AlphaFold2 Multimer to predict the structure of the Atg11 dimer. The top-ranked model was a “flask-shaped” parallel dimer (Figure 1D). However, some other models predicted a Z-shaped dimer (Figure 1E). Both models showed extensive monomer-monomer interactions in CC2, CC3 and CC4, consistent with previous reports that both the N- and C- termini of Atg11 could dimerize (Suzuki & Noda, 2018). They both suggested that CC1 and CC2 formed an L-shaped helical bundle, with CC3 and the C-terminus connected by disordered linkers; however, the placement of CC3 and the C-terminus varied between these models - in the flask-shaped, they were neatly packed against each other, while in the Z-shaped dimer, they were placed at random angles, not interacting with CC1, CC2, or each other. The pLDDT for both models was relatively low, particularly at a critical interface at the bottom of the flask-shape, raising the possibility that Atg11 can take on multiple conformations (Figure 1F).
Y468 and L526 were placed on the interior of the Atg11 dimer in both AlphaFold models, which would not allow a direct role in Atg9 binding, while D516 and L517 were partially surface exposed (Figure 1G). We mutated residues E515-S519 to alanine (EDLLS) to target that entire surface, but this mutant did not lose interaction with Atg9 (Figure 1B). We also generated three additional mutants, QQ (Q475A, Q476A), QNLNK (Q493A, N494A, L496A, N500A, K501A), and TV (T511A, V512A), all of which targeted sets of residues within the 455-535 region that the AlphaFold models predicted to be surface exposed (Figure 1H). However, none of these mutants lost interaction, either (Figure 1B).
The region downstream of CC2 was primarily disordered in our AlphaFold models. To determine if this region was important for Atg9 binding, we replaced residues 576-627 of Atg11 with residues 2-53 of an intrinsically unstructured protein, PAI3. The Atg11_IA3 mutant showed a partial loss of interaction with Atg9 by yeast-2-hybrid (Figure 1B).
Finally, we confirmed our yeast-2-hybrid results by performing co-immunprecipitation (CoIP) assays between Atg9-PA and selected GFP-Atg11 mutants. These were performed in growing conditions, where this interaction has previously been assessed (Coudevylle et al., 2022; He et al., 2006; Meyer et al., 2022). These showed a partial loss of interaction between Atg9 and all of the Atg11 mutants tested - YDLL, YDL, DLL and IA3. In addition, there was a reduction of the levels of the YDLL, YDL and DLL mutants in the lysates, suggesting that these mutations might be detrimental to the overall stability of Atg11 (Figure 1I,J).
Overall, none of the residues or regions we mutated emerged as strong candidates for an Atg9 binding site. The YDLL mutant showed a loss of interaction only when all four residues were mutated, and CoIP results showed that this was only a partial loss of interaction. The fact that these residues are predicted to be in different locations on the folded protein and two of them are predicted to be interior-facing, along with the lower expression observed for this mutant, suggests that they have a primary effect on Atg11 folding and only a secondary effect on Atg9 binding. Similarly, the fact that replacement of 52 residues with those of an unrelated protein led to only a partial loss in binding suggests that the a.a. 576-627 is also not the binding site for Atg9. Interestingly, a recent study showed that an overlapping region, a.a. 612-646, has membrane-binding properties, supporting a different role for this part of Atg11 (Andhare et al., 2025).
We have not exhaustively mutated a.a. 455-627, so we can not rule out the possibility that Atg9 binds in this region. However, we have mutated the most likely candidate residues without finding any specifically responsible for Atg9 binding, suggesting that the core Atg9 binding region may lie elsewhere in the Atg11 N-terminus, while a.a. 455-627 have an indirect effect. The AlphaFold multimer model predicts a.a. 454-591 to be a dimerization interface for Atg11; therefore, we speculate that the removal of a.a. 455-627 from the N-terminal construct may disrupt its proper folding and dimerization, leading indirectly to a loss of Atg9 binding.
","references":[{"reference":"Andhare D, Katzenell S, Najera SI, Mauras SC, Bauer KM, Ragusa MJ. 2025. Reconstitution of autophagic-like membrane tethering reveals that Atg11 can bind and cluster vesicles on cargo mimetics. Autophagy : 1-20.
","pubmedId":"","doi":"10.1080/15548627.2025.2551678"},{"reference":"Backues SK, Orban DP, Bernard Al, Singh K, Cao Y, Klionsky DJ. 2014. Atg23 and Atg27 Act at the Early Stages of Atg9 Trafficking in S. cerevisiae. Traffic 16: 172-190.
","pubmedId":"","doi":"10.1111/tra.12240"},{"reference":"Cao Y, Nair U, Yasumura-Yorimitsu K, Klionsky DJ. 2009. A multipleATGgene knockout strain for yeast two-hybrid analysis. Autophagy 5: 699-705.
","pubmedId":"","doi":"10.4161/auto.5.5.8382"},{"reference":"Chen M, Nguyen TN, Ren X, Khuu G, Cook ASI, Zhao Y, et al., Hurley. 2025. Structure and activation of the human autophagy-initiating ULK1C:PI3KC3-C1 supercomplex. Nature Structural & Molecular Biology 32: 1596-1605.
","pubmedId":"","doi":"10.1038/s41594-025-01557-x"},{"reference":"Choi AMK, Ryter SW, Levine B. 2013. Autophagy in Human Health and Disease. New England Journal of Medicine 368: 651-662.
","pubmedId":"","doi":"10.1056/NEJMra1205406"},{"reference":"Coudevylle N, Banaś Bo, Baumann V, Schuschnig M, Zawadzka-Kazimierczuk A, Koźmiński W, Martens S. 2022. Mechanism of Atg9 recruitment by Atg11 in the cytoplasm-to-vacuole targeting pathway. Journal of Biological Chemistry 298: 101573.
","pubmedId":"","doi":"10.1016/j.jbc.2022.101573"},{"reference":"Delgado J, Radusky LG, Cianferoni D, Serrano L. 2019. FoldX 5.0: working with RNA, small molecules and a new graphical interface. Bioinformatics 35: 4168-4169.
","pubmedId":"","doi":"10.1093/bioinformatics/btz184"},{"reference":"Evans R, O’Neill M, Pritzel A, Antropova N, Senior A, Green T, et al., Hassabis. 2021. Protein complex prediction with AlphaFold-Multimer. : 10.1101/2021.10.04.463034.
","pubmedId":"","doi":"10.1101/2021.10.04.463034"},{"reference":"Gietz RD, Schiestl RH. 2007. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols 2: 31-34.
","pubmedId":"","doi":"10.1038/nprot.2007.13"},{"reference":"Guardia CM, Tan XF, Lian T, Rana MS, Zhou W, Christenson ET, et al., Banerjee. 2020. Structure of Human ATG9A, the Only Transmembrane Protein of the Core Autophagy Machinery. Cell Reports 31: 107837.
","pubmedId":"","doi":"10.1016/j.celrep.2020.107837"},{"reference":"He C, Song H, Yorimitsu T, Monastyrska I, Yen WL, Legakis JE, Klionsky DJ. 2006. Recruitment of Atg9 to the preautophagosomal structure by Atg11 is essential for selective autophagy in budding yeast. The Journal of Cell Biology 175: 925-935.
","pubmedId":"","doi":"10.1083/jcb.200606084"},{"reference":"Hollenstein DM, Licheva M, Konradi N, Schweida D, Mancilla H, Mari M, Reggiori F, Kraft C. 2021. Spatial control of avidity regulates initiation and progression of selective autophagy. Nature Communications 12: 10.1038/s41467-021-27420-3.
","pubmedId":"","doi":"10.1038/s41467-021-27420-3"},{"reference":"Kim J, Kamada Y, Stromhaug PE, Guan J, Hefner-Gravink A, Baba M, et al., Klionsky. 2001. Cvt9/Gsa9 Functions in Sequestering Selective Cytosolic Cargo Destined for the Vacuole. The Journal of Cell Biology 153: 381-396.
","pubmedId":"","doi":"10.1083/jcb.153.2.381"},{"reference":"Lu G, Wang Y, Shi Y, Zhang Z, Huang C, He W, Wang C, Shen HM. 2022. Autophagy in health and disease: From molecular mechanisms to therapeutic target. MedComm 3: 10.1002/mco2.150.
","pubmedId":"","doi":"10.1002/mco2.150"},{"reference":"Margolis HK, Katzenell S, Leary KA, Ragusa MJ. 2020. The Third Coiled Coil Domain of Atg11 Is Required for Shaping Mitophagy Initiation Sites. Journal of Molecular Biology 432: 5752-5764.
","pubmedId":"","doi":"10.1016/j.jmb.2020.08.025"},{"reference":"Meyer MD, Winzeler J, Taylor SM, Kilgore A, Edicha K, Chitwood C, et al., Backues. 2022. Mapping Critical Residues in ATG11’s Coiled-Coil 2 Domain that Block Multiple Interactions and Disrupt Selective Autophagy. Frontiers in Cell and Developmental Biology 9: 10.3389/fcell.2021.775364.
","pubmedId":"","doi":"10.3389/fcell.2021.775364"},{"reference":"Orii M, Tsuji T, Ogasawara Y, Fujimoto T. 2021. Transmembrane phospholipid translocation mediated by Atg9 is involved in autophagosome formation. Journal of Cell Biology 220: 10.1083/jcb.202009194.
","pubmedId":"","doi":"10.1083/jcb.202009194"},{"reference":"Sawa-Makarska J, Baumann V, Coudevylle N, von Bülow Sr, Nogellova V, Abert C, et al., Martens. 2020. Reconstitution of autophagosome nucleation defines Atg9 vesicles as seeds for membrane formation. Science 369: 10.1126/science.aaz7714.
","pubmedId":"","doi":"10.1126/science.aaz7714"},{"reference":"Schrödinger, LLC. (2015). The PyMOL Molecular Graphics System, Version 1.8.
","pubmedId":"","doi":""},{"reference":"Suzuki H, Noda NN. 2017. Biophysical characterization of Atg11, a scaffold protein essential for selective autophagy in yeast. FEBS Open Bio 8: 110-116.
","pubmedId":"","doi":"10.1002/2211-5463.12355"},{"reference":"Turco E, Witt M, Abert C, Bock-Bierbaum T, Su MY, Trapannone R, et al., Martens. 2019. FIP200 Claw Domain Binding to p62 Promotes Autophagosome Formation at Ubiquitin Condensates. Molecular Cell 74: 330-346.e11.
","pubmedId":"","doi":"10.1016/j.molcel.2019.01.035"},{"reference":"Xie Z, Klionsky DJ. 2007. Autophagosome formation: core machinery and adaptations. Nature Cell Biology 9: 1102-1109.
","pubmedId":"","doi":"10.1038/ncb1007-1102"},{"reference":"Yamamoto H, Kakuta S, Watanabe TM, Kitamura A, Sekito T, Kondo-Kakuta C, et al., Ohsumi. 2012. Atg9 vesicles are an important membrane source during early steps of autophagosome formation. Journal of Cell Biology 198: 219-233.
","pubmedId":"","doi":"10.1083/jcb.201202061"},{"reference":"Yorimitsu T, Klionsky DJ. 2005. Atg11 Links Cargo to the Vesicle-forming Machinery in the Cytoplasm to Vacuole Targeting Pathway. Molecular Biology of the Cell 16: 1593-1605.
","pubmedId":"","doi":"10.1091/mbc.e04-11-1035"},{"reference":"Zientara-Rytter K, Subramani S. 2020. Mechanistic Insights into the Role of Atg11 in Selective Autophagy. Journal of Molecular Biology 432: 104-122.
","pubmedId":"","doi":"10.1016/j.jmb.2019.06.017"}],"title":"Screening Atg11, a central organizer of yeast selective autophagy, for residues involved in the Atg11-Atg9 interaction
","reviews":[],"curatorReviews":[]},{"id":"6942979f-4119-4ed4-95f4-96a4dd1a30bc","decision":"publish","abstract":"The yeast protein Atg11, whose structure is not fully solved, is a central organizer of autophagosome formation that recruits Atg9 during selective autophagy. Although the residues in Atg9 responsible for this interaction are known, those in Atg11 are not. In an attempt to discover the binding site of Atg9 on Atg11, we screened a number of mutants within amino acid residues 455-627 of Atg11, guided in part by an AlphaFold2-generated model of the Atg11 dimer. However, we were not able to identify specific residues essential for the interaction with Atg9, suggesting that the binding region may lie elsewhere on Atg11.
","acknowledgements":"","authors":[{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"chimids@umich.edu","firstName":"Chimi Dolker","lastName":"Sherpa","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0003-4253-0827"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"omo14patric@gmail.com","firstName":"Patricia","lastName":"Woghiren","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0003-6468-2661"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_reviewEditing","methodology"],"email":"erinleo@umich.edu","firstName":"Erin","lastName":"Leonello","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0009-5163-1973"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_originalDraft","visualization"],"email":"mabdelkh@emich.edu","firstName":"Mina","lastName":"Abdel-Khalek","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-3140-3827"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["investigation","writing_originalDraft","visualization"],"email":"bschuess@emich.edu","firstName":"Benjamin J. ","lastName":"Schuessler","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-2920-8932"},{"affiliations":["Michigan State University"],"departments":["MSU-DOE Plant Research Laboratory"],"credit":["investigation","writing_reviewEditing"],"email":"vermaasj@msu.edu","firstName":"Josh V.","lastName":"Vermaas","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3139-6469"},{"affiliations":["Eastern Michigan University"],"departments":["Chemistry"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","methodology","supervision","writing_originalDraft"],"email":"sbackues@emich.edu","firstName":"Steven K.","lastName":"Backues","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-7346-1428"}],"awards":[{"awardId":"2243163","funderName":"U.S. National Science Foundation (United States)","awardRecipient":"Steven K. Backues"},{"awardId":"R35GM155317","funderName":"National Institutes of Health (United States)","awardRecipient":"Josh V. Vermaas"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/96aea156fe28eda5d76ab4fa0b9ca791.png"},"imageCaption":"(A) Schematic representation of Atg11 showing the coiled-coil domains (black boxes) and the CLAW domain (grey box), with a.a. shown by italicized numbers. Fragments previously reported to bind or not bind with Atg9 are indicated. (B) Yeast 2 hybrid assay of BD-Atg9 with the indicated AD-Atg11 mutants. Non-selective media is SMD -ura -leu; selective media is SMD -ura -leu -his +1.5 mM 3-AT. On selective media, (+) indicates growth and (-) indicates no growth across multiple replicates of the assay. AD-EV = pGAD empty vector; other mutants as described in text. (C) Alignment analysis of the conservation of Atg11 residues 467-469 across yeast species where the Atg11-interacting residues of Atg9 are conserved or are not as conserved. (D) Front and side view of the flask-shaped Atg11 dimer and (E) front view of the Z-shaped Atg11 dimer predicted with AlphaFold2 Multimer. (F) pLDDT confidence map of the flask-shaped Atg11 structure. (G) Close-up of flask-shaped dimer showing predicted locations of YDLL residues. (H) Surface rendering of flask-shaped model highlighting predicted surface exposed residues in the 455-535 region. (I) CoIP of various overexpressed GFP-Atg11 mutants by overexpressed Atg9-PA. Blots were probed with anti-GFP, which also detects the PA tag. (J) Quantitative analysis of CoIP results. The Atg11 to Atg9 band intensity ratio was normalized to the values from WT for each replicate. For the CoIP graph, the GFP-Atg11 band intensity of the 𝚫CC2 samples, which are known to show no binding (Meyer et al., 2022), were used as the background and subtracted from the GFP-Atg11 band intensity of the other samples before normalizing. Error bars are 95% confidence intervals.
","imageTitle":"Mutations in the 455-535 and 576-627 regions of Atg11 do not cause full loss of interaction with Atg9
","methods":"Sequence analysis to identify candidate Atg9-binding residues: Atg9 homologues in 23 yeast species were scored as “conserved” or “not conserved” based on the conservation of residues known to be involved in binding of Atg11 (H192, PLF163-165, and PLF187-189). Then, an alignment of Atg11 residues 455-535 in the same species was manually screened for residues that were conserved only in species where Atg9 was conserved. A full description of this process and the alignments can be found in the supporting data at https://osf.io/rnx7v.
Strain and plasmid construction: The pGAD-ATG11 mutant plasmids were ordered from GenScript. The pRS416-Cu-GFP-ATG11 mutant plasmids (YDLL, YDL, and DLL) were made using InFusion cloning. The vector pRS416-Cu-GFP-ATG11 was digested with EcoRI-HF (NEB), which cuts at two endogenous EcoRI sites in Atg11. The insert was amplified by PCR using Phusion polymerase (NEB) from the respective pGAD-ATG11 mutant with primers 5’-AGAAGAAGAAGAATTCAATAGTCAAG-3’ and 5’-ATTTGCTATAGAATTCTCATTTTCATC-3’, ordered from IDT. The vector and insert were combined by InFusion reaction (Clontech, Takara Bio USA Inc.) and transformed into E. coli DH5ɑ (Stellar Competent Cells - HST08 strain) and plated on LB carbenicillin plates for colony growth. pRS416-Cu-GFP-ATG11IA3 was generated by similar methods, except the digest was performed with AvrII and HindIII and the primers used were 5’-CAGATGGAAATCCTAGGTATTA-3’ and 5’-CAACTTCATAAAGCTTATTGTC-3’.
Plasmids were purified using Purelink plasmid miniprep kits (ThermoFisher), verified by Sanger sequencing (Eton Biosciences) and/or whole plasmid sequencing (Plasmidsaurus) and introduced into yeast cells using standard transformation procedures (Gietz & Schiestl, 2007).
Yeast-2-hybrid: Yeast multiple-knockout cells (lacking 25 ATG genes to minimize indirect or interfering interactions; YCY149) expressing BD-ATG9 and AD-ATG11 or mutants thereof were patched on both selective (SMD -ura -leu -his w/ 1.5 mM 3-amino-triazol) and nonselective (SMD -ura -leu) plates and grown for 4–5 days at 30°C before imaging. Results shown are representative of at least five replicates per strain (except for AD-EV and QNLNK, where only two replicates were performed). Full results of all replicates and representative images of complete plates can be found in the supporting data at https://osf.io/4h6bz/.
Co-Immunoprecipitation and Western Blotting: Yeast were grown under nutrient rich conditions using SMD -ura -trp media at 30°C with shaking at 300 rpm, and harvested while in log phase (OD600 < 1). Co-immunoprecipitation was carried out exactly as described previously (Meyer et al., 2022) except that all washes were performed in the 4℃ cold room to help prevent breakdown. Precast 4-15% gradient SDS-PAGE gels (Bio-Rad) and BLUEstain2 protein ladder (GoldBio) were used. The electrophoresis was run for ~3 hours, starting at 80 V and increasing to 120 V after initial band separation. Gels were transferred to PVDF membranes via tank transfer, which was run for 1 hour at 120 V. Membranes were incubated in blocking solution (4% non-fat dry milk in tris-buffered saline). To detect Atg9-PA tag pulldowns, 1:500 mouse anti-GFP primary antibody (Takara; JL-8) and 1:5000 peroxidase-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch; 115-035-003) were used.
Structural Modeling: To develop structure-based hypotheses for potential interaction sites between Atg9 and Atg11, AlphaFold-Multimer version 2.3.2 (Evans et al., 2022) was used to generate 25 potential interaction complexes. These complexes were optimized using the FoldX4 “repair” function (Delgado et al., 2019). Visualization was performed in PyMol 3 (Schrödinger, LLC, 2015).
","reagents":"Saccharomyces cerevisiae strains used in this study | ||
Name | Genotype | Source |
atg11Δ | MATα his3Δ200 leu2-3,112 lys2-801 suc2-Δ9 trp1Δ901 ura3-52 atg11Δ::KanMX | Meyer et al., 2022 |
YCY149 | MATα his3-Δ200 leu2-3,112 lys2-801 trp1-Δ901 suc2-Δ9 ura3-52 atg1Δ, 2Δ, 3Δ, 4Δ, 5Δ, 6Δ, 7Δ, 8Δ, 9Δ, 10Δ, 11Δ, 12Δ, 13Δ, 14Δ, 16Δ, 17Δ, 18Δ, 19Δ, 20Δ, 21Δ, 23Δ, 24Δ, 27Δ, 29Δ gal4Δ gal80Δ GAL1-HIS3 GAL2-ADE2 met2∷GAL7-lacZ atg31Δ∷KanMX | Cao et al., 2009 |
Plasmids used in this study | ||
Name | Description | Source |
pGBDU-Atg9 | BD vector with full length Atg9 | He et al., 2006 |
pGAD-ATG11 | AD vector with full length WT Atg11 | Meyer et al., 2022 |
pGAD-ATG11ΔCC2 | AD vector with atg11∆536-576 | Meyer et al., 2022 |
pGAD-ATG11Δ455-535 | AD vector with atg11∆455-535 | This study |
pGAD-ATG11YDLL | AD vector with atg11Y468A, D516A, L517A, L526A | This study |
pGAD-ATG11YDL | AD vector with atg11Y468A, D516A, L517A | This study |
pGAD-ATG11DLL | AD vector with atg11 D516A, L517A, L526A | This study |
pGAD-ATG11DL | AD vector with atg11 D516A, L517A | This study |
pGAD-ATG11EDLLS | AD vector with atg11 E515A, D516A, L517A, L518A, S519A | This study |
pGAD-ATG11QQ | AD vector with atg11 Q475A, Q476A | This study |
pGAD-ATG11QNLNK | AD vector with atg11 Q493A, N494A, L496A, N500A, K501A | This study |
pGAD-ATG11TV | AD vector with atg11 T511A, V512A | This study |
pGAD-ATG11IA3 | AD vector with atg11 where residues 576-627 were replaced with residues 2-53 of scPAI3 (aka IA3). | This study |
pRS414-Cu-ATG9-PA | ATG9 tagged with Protein A, driven by the CUP1 promoter | Meyer et al., 2022 |
pRS416-Cu-GFP-ATG11 | GFP-ATG11 WT driven by the CUP1 promoter | Kim et al., 2001 |
pRS416-Cu-GFP-ATG11ΔCC2 | GFP-atg11∆536-576 driven by the CUP1 promoter | Meyer et al., 2022 |
pRS416-Cu-GFP-ATG11YDLL | GFP-atg11Y468A, D516A, L517A, L526A driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-ATG11YDL | GFP-atg11Y468A, D516A, L517A, driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-ATG11DLL | GFP-atg11 D516A, L517A, L526A driven by the CUP1 promoter | This study |
pRS416-Cu-GFP-ATG11IA3 | GFP-atg11 with residues 576-627 replaced with residues 2-53 of scPAI3 (aka IA3). Driven by the CUP1 promoter. | This study |
Antibodies used in this study | ||
Name | Identifier (Source) | Concentration |
“Living Colors” mouse monoclonal anti-GFP (JL-8) | Cat# 632381 (Clontech / Takara) | 1:500 |
Peroxidase AffiniPure® Goat Anti-Mouse IgG | Cat# 115-035-003 (Jackson ImmunoResearch) | 1:5000 |
Macroautophagy (hereafter referred to simply as autophagy) is a critical stress-response pathway conserved in all eukaryotes. Bulk autophagy, triggered by starvation, semi-randomly degrades materials from the cytoplasm in order to reuse the nutrients for cellular survival. In contrast, selective autophagy is not primarily regulated by a need for nutrients but targets specific cytoplasmic cargo to the lysosome (in animals) or vacuole (in other eukaryotes) for degradation (Xie & Klionsky, 2007). Selective autophagy contributes to the health of the cell by breaking down intracellular pathogens, protein aggregates, and malfunctioning organelles. In humans, it is particularly important for long-lived cells such as neurons and helps prevent neurodegenerative diseases such as Parkinson’s and Alzheimer’s (Choi et al., 2013; Lu et al., 2022). For this reason, there is great interest in understanding the proteins that control selective autophagy and how they interact. Much of this research has focused on autophagy in the model eukaryote Saccharomyces cerevisiae, baker’s yeast.
Selective autophagy in yeast begins when cargo receptor proteins are recruited to a specific autophagic cargo. These receptors bind to Atg11, the central organizer of the autophagy initiation complex during selective autophagy (Yorimitsu & Klionsky, 2005; Zientara-Rytter & Subramani, 2020). This then arranges the proteins that start the process of building the autophagosome - the double-membrane vesicle that will envelop the cargo and deliver it to the vacuole for degradation.
The structure of Atg11 is not fully solved, nor is the manner by which it recruits and organizes the autophagic machinery fully understood. It is predicted to be a dimer with many coiled-coil domains (Yorimitsu & Klionsky, 2005). Biophysical data has verified it to be a rod-shaped parallel dimer (Suzuki & Noda, 2018), and a crystal structure of a portion of coiled-coil domain 3 shows this to be a flexible coil (Margolis et al., 2020). Atg11 binds to cargo receptors via its C-terminal claw domain, the structure of which has been solved for its human homolog FIP200 (Turco et al., 2019). A cryo-EM structure of the N-terminal half of the FIP200 protein is also available (Chen et al., 2025); however, the N-terminal region of FIP200 is not homologous to that of Atg11. This region binds to core autophagic machinery such as the kinase Atg1 and the scramblase Atg9 (He et al., 2006; Meyer et al., 2022; Yorimitsu & Klionsky, 2005). Atg9 is a trimeric transmembrane protein that is found in populations of small vesicles, and Atg11 binding to Atg9 recruits these vesicles and causes their fusion to form the phagophore (Backues et al., 2015; Yamamoto et al., 2012). Atg9 equilibrates lipids delivered from the ER to both bilayers of the phagophore membrane; as such, it is critical for the formation of the autophagosome (Guardia et al., 2020; Orii et al., 2021; Sawa-Makarska et al., 2020).
Atg9 has been shown to interact with Atg11 via two PLF (Pro-Leu-Phe) motifs in its N-terminal unstructured region: PLF163-165 and PLF187-189 (Coudevylle et al., 2022). A neighboring histidine, H192, is also involved (He et al., 2006), and mutation of these residues blocks selective autophagy by preventing recruitment of Atg9 to the site of autophagosome formation (Coudevylle et al., 2022; He et al., 2006). However, it is unknown which residues in Atg11 interact with Atg9.
Previous studies have shown that amino acid residues (a.a.) 1-627 of Atg11 are sufficient for binding to Atg9 (He et al., 2006) while a.a. 1-454 are not (Hollenstein et al., 2021), suggesting that the Atg9 binding site might be between a.a. 455-627. Our lab previously investigated part of this region: a.a. 536-576, termed coiled-coil domain 2 (CC2), which had initially been implicated as a likely site for the binding of both Atg1 and Atg9 as well as Atg11 dimerization (Yorimitsu & Klionsky, 2005). However, our systematic mutagenesis data suggested that CC2 is more likely to be involved in overall folding and stability of the N-terminus of Atg11 (Meyer et al., 2022). Therefore, we focused on a.a. 455-535, as that region had not been previously investigated (Figure 1A).
Yeast-2-Hybrid (Y2H) results showed that atg11Δ455-535 lost interaction with Atg9, just like atg11ΔCC2 (Figure 1B). We then examined the sequence of the 455-535 region across various yeast species, looking for residues that are conserved in the family Saccharomycetacea, where the Atg11-binding region of Atg9 is conserved, but not conserved in other species from order Saccharomycetales where the Atg11-binding region of Atg9 is not conserved (Figure 1C). This analysis yielded four residues: Y468, D516, L517 and L526. A quadruple mutant of all of those residues to alanine (YDLL) mostly lost interaction with Atg9, though a little bit of growth could still be detected in the Y2H assay. However, subsets of 2 or 3 of these mutations (YDL, DLL, or DL) did not lose interaction in this assay, suggesting that none of these was a critical residue (Figure 1B).
We used AlphaFold2 Multimer to predict the structure of the Atg11 dimer. The top-ranked model was a “flask-shaped” parallel dimer (Figure 1D). However, some other models predicted a Z-shaped dimer (Figure 1E). Both models showed extensive monomer-monomer interactions in CC2, CC3 and CC4, consistent with previous reports that both the N- and C- termini of Atg11 could dimerize (Suzuki & Noda, 2018). They both suggested that CC1 and CC2 formed an L-shaped helical bundle, with CC3 and the C-terminus connected by disordered linkers; however, the placement of CC3 and the C-terminus varied between these models - in the flask-shaped, they were neatly packed against each other, while in the Z-shaped dimer, they were placed at random angles, not interacting with CC1, CC2, or each other. The pLDDT for both models was relatively low, particularly at a critical interface at the bottom of the flask-shape, raising the possibility that Atg11 can take on multiple conformations (Figure 1F).
Y468 and L526 were placed on the interior of the Atg11 dimer in both AlphaFold models, which would not allow a direct role in Atg9 binding, while D516 and L517 were partially surface exposed (Figure 1G). We mutated residues E515-S519 to alanine (EDLLS) to target that entire surface, but this mutant did not lose interaction with Atg9 (Figure 1B). We also generated three additional mutants, QQ (Q475A, Q476A), QNLNK (Q493A, N494A, L496A, N500A, K501A), and TV (T511A, V512A), all of which targeted sets of residues within the 455-535 region that the AlphaFold models predicted to be surface exposed (Figure 1H). However, none of these mutants lost interaction, either (Figure 1B).
The region downstream of CC2 was primarily disordered in our AlphaFold models. To determine if this region was important for Atg9 binding, we replaced residues 576-627 of Atg11 with residues 2-53 of an intrinsically unstructured protein, PAI3. The Atg11_IA3 mutant showed a partial loss of interaction with Atg9 by yeast-2-hybrid (Figure 1B).
Finally, we confirmed our yeast-2-hybrid results by performing co-immunprecipitation (CoIP) assays between Atg9-PA and selected GFP-Atg11 mutants. These were performed in growing conditions, where this interaction has previously been assessed (Coudevylle et al., 2022; He et al., 2006; Meyer et al., 2022). These showed a partial loss of interaction between Atg9 and all of the Atg11 mutants tested - YDLL, YDL, DLL and IA3. In addition, there was a reduction of the levels of the YDLL, YDL and DLL mutants in the lysates, suggesting that these mutations might be detrimental to the overall stability of Atg11 (Figure 1I,J).
Overall, none of the residues or regions we mutated emerged as strong candidates for an Atg9 binding site. The YDLL mutant showed a loss of interaction only when all four residues were mutated, and CoIP results showed that this was only a partial loss of interaction. The fact that these residues are predicted to be in different locations on the folded protein and two of them are predicted to be interior-facing, along with the lower expression observed for this mutant, suggests that they have a primary effect on Atg11 folding and only a secondary effect on Atg9 binding. Similarly, the fact that replacement of 52 residues with those of an unrelated protein led to only a partial loss in binding suggests that the a.a. 576-627 is also not the binding site for Atg9. Interestingly, a recent study showed that an overlapping region, a.a. 612-646, has membrane-binding properties, supporting a different role for this part of Atg11 (Andhare et al., 2025).
We have not exhaustively mutated a.a. 455-627, so we can not rule out the possibility that Atg9 binds in this region. However, we have mutated the most likely candidate residues without finding any specifically responsible for Atg9 binding, suggesting that the core Atg9 binding region may lie elsewhere in the Atg11 N-terminus, while a.a. 455-627 have an indirect effect. The AlphaFold multimer model predicts a.a. 454-591 to be a dimerization interface for Atg11; therefore, we speculate that the removal of a.a. 455-627 from the N-terminal construct may disrupt its proper folding and dimerization, leading indirectly to a loss of Atg9 binding.
","references":[{"reference":"Andhare D, Katzenell S, Najera SI, Mauras SC, Bauer KM, Ragusa MJ. 2025. Reconstitution of autophagic-like membrane tethering reveals that Atg11 can bind and cluster vesicles on cargo mimetics. Autophagy : 1-20.
","pubmedId":"","doi":"10.1080/15548627.2025.2551678"},{"reference":"Backues SK, Orban DP, Bernard Al, Singh K, Cao Y, Klionsky DJ. 2014. Atg23 and Atg27 Act at the Early Stages of Atg9 Trafficking in S. cerevisiae. Traffic 16: 172-190.
","pubmedId":"","doi":"10.1111/tra.12240"},{"reference":"Cao Y, Nair U, Yasumura-Yorimitsu K, Klionsky DJ. 2009. A multipleATGgene knockout strain for yeast two-hybrid analysis. Autophagy 5: 699-705.
","pubmedId":"","doi":"10.4161/auto.5.5.8382"},{"reference":"Chen M, Nguyen TN, Ren X, Khuu G, Cook ASI, Zhao Y, et al., Hurley. 2025. Structure and activation of the human autophagy-initiating ULK1C:PI3KC3-C1 supercomplex. Nature Structural & Molecular Biology 32: 1596-1605.
","pubmedId":"","doi":"10.1038/s41594-025-01557-x"},{"reference":"Choi AMK, Ryter SW, Levine B. 2013. Autophagy in Human Health and Disease. New England Journal of Medicine 368: 651-662.
","pubmedId":"","doi":"10.1056/NEJMra1205406"},{"reference":"Coudevylle N, Banaś Bo, Baumann V, Schuschnig M, Zawadzka-Kazimierczuk A, Koźmiński W, Martens S. 2022. Mechanism of Atg9 recruitment by Atg11 in the cytoplasm-to-vacuole targeting pathway. Journal of Biological Chemistry 298: 101573.
","pubmedId":"","doi":"10.1016/j.jbc.2022.101573"},{"reference":"Delgado J, Radusky LG, Cianferoni D, Serrano L. 2019. FoldX 5.0: working with RNA, small molecules and a new graphical interface. Bioinformatics 35: 4168-4169.
","pubmedId":"","doi":"10.1093/bioinformatics/btz184"},{"reference":"Evans R, O’Neill M, Pritzel A, Antropova N, Senior A, Green T, et al., Hassabis. 2021. Protein complex prediction with AlphaFold-Multimer. : 10.1101/2021.10.04.463034.
","pubmedId":"","doi":"10.1101/2021.10.04.463034"},{"reference":"Gietz RD, Schiestl RH. 2007. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols 2: 31-34.
","pubmedId":"","doi":"10.1038/nprot.2007.13"},{"reference":"Guardia CM, Tan XF, Lian T, Rana MS, Zhou W, Christenson ET, et al., Banerjee. 2020. Structure of Human ATG9A, the Only Transmembrane Protein of the Core Autophagy Machinery. Cell Reports 31: 107837.
","pubmedId":"","doi":"10.1016/j.celrep.2020.107837"},{"reference":"He C, Song H, Yorimitsu T, Monastyrska I, Yen WL, Legakis JE, Klionsky DJ. 2006. Recruitment of Atg9 to the preautophagosomal structure by Atg11 is essential for selective autophagy in budding yeast. The Journal of Cell Biology 175: 925-935.
","pubmedId":"","doi":"10.1083/jcb.200606084"},{"reference":"Hollenstein DM, Licheva M, Konradi N, Schweida D, Mancilla H, Mari M, Reggiori F, Kraft C. 2021. Spatial control of avidity regulates initiation and progression of selective autophagy. Nature Communications 12: 10.1038/s41467-021-27420-3.
","pubmedId":"","doi":"10.1038/s41467-021-27420-3"},{"reference":"Kim J, Kamada Y, Stromhaug PE, Guan J, Hefner-Gravink A, Baba M, et al., Klionsky. 2001. Cvt9/Gsa9 Functions in Sequestering Selective Cytosolic Cargo Destined for the Vacuole. The Journal of Cell Biology 153: 381-396.
","pubmedId":"","doi":"10.1083/jcb.153.2.381"},{"reference":"Lu G, Wang Y, Shi Y, Zhang Z, Huang C, He W, Wang C, Shen HM. 2022. Autophagy in health and disease: From molecular mechanisms to therapeutic target. MedComm 3: 10.1002/mco2.150.
","pubmedId":"","doi":"10.1002/mco2.150"},{"reference":"Margolis HK, Katzenell S, Leary KA, Ragusa MJ. 2020. The Third Coiled Coil Domain of Atg11 Is Required for Shaping Mitophagy Initiation Sites. Journal of Molecular Biology 432: 5752-5764.
","pubmedId":"","doi":"10.1016/j.jmb.2020.08.025"},{"reference":"Meyer MD, Winzeler J, Taylor SM, Kilgore A, Edicha K, Chitwood C, et al., Backues. 2022. Mapping Critical Residues in ATG11’s Coiled-Coil 2 Domain that Block Multiple Interactions and Disrupt Selective Autophagy. Frontiers in Cell and Developmental Biology 9: 10.3389/fcell.2021.775364.
","pubmedId":"","doi":"10.3389/fcell.2021.775364"},{"reference":"Orii M, Tsuji T, Ogasawara Y, Fujimoto T. 2021. Transmembrane phospholipid translocation mediated by Atg9 is involved in autophagosome formation. Journal of Cell Biology 220: 10.1083/jcb.202009194.
","pubmedId":"","doi":"10.1083/jcb.202009194"},{"reference":"Sawa-Makarska J, Baumann V, Coudevylle N, von Bülow Sr, Nogellova V, Abert C, et al., Martens. 2020. Reconstitution of autophagosome nucleation defines Atg9 vesicles as seeds for membrane formation. Science 369: 10.1126/science.aaz7714.
","pubmedId":"","doi":"10.1126/science.aaz7714"},{"reference":"Schrödinger, LLC. (2015). The PyMOL Molecular Graphics System, Version 1.8.
","pubmedId":"","doi":""},{"reference":"Suzuki H, Noda NN. 2017. Biophysical characterization of Atg11, a scaffold protein essential for selective autophagy in yeast. FEBS Open Bio 8: 110-116.
","pubmedId":"","doi":"10.1002/2211-5463.12355"},{"reference":"Turco E, Witt M, Abert C, Bock-Bierbaum T, Su MY, Trapannone R, et al., Martens. 2019. FIP200 Claw Domain Binding to p62 Promotes Autophagosome Formation at Ubiquitin Condensates. Molecular Cell 74: 330-346.e11.
","pubmedId":"","doi":"10.1016/j.molcel.2019.01.035"},{"reference":"Xie Z, Klionsky DJ. 2007. Autophagosome formation: core machinery and adaptations. Nature Cell Biology 9: 1102-1109.
","pubmedId":"","doi":"10.1038/ncb1007-1102"},{"reference":"Yamamoto H, Kakuta S, Watanabe TM, Kitamura A, Sekito T, Kondo-Kakuta C, et al., Ohsumi. 2012. Atg9 vesicles are an important membrane source during early steps of autophagosome formation. Journal of Cell Biology 198: 219-233.
","pubmedId":"","doi":"10.1083/jcb.201202061"},{"reference":"Yorimitsu T, Klionsky DJ. 2005. Atg11 Links Cargo to the Vesicle-forming Machinery in the Cytoplasm to Vacuole Targeting Pathway. Molecular Biology of the Cell 16: 1593-1605.
","pubmedId":"","doi":"10.1091/mbc.e04-11-1035"},{"reference":"Zientara-Rytter K, Subramani S. 2020. Mechanistic Insights into the Role of Atg11 in Selective Autophagy. Journal of Molecular Biology 432: 104-122.
","pubmedId":"","doi":"10.1016/j.jmb.2019.06.017"}],"title":"Screening Atg11, a central organizer of yeast selective autophagy, for residues involved in the Atg11-Atg9 interaction
","reviews":[],"curatorReviews":[]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"386f8c38-5f8c-406c-9ace-6895413c170f","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}