Congenital heart disease (CHD) is highly prevalent in live births and requires concise diagnoses and treatment plans. Although there is a vast amount of genetics research in the field of CHD, there are still knowledge gaps regarding the gene networks surrounding heart development. A literature review revealed that mutation in Leiomodin 2 is associated with dilated cardiomyopathy in humans. We selected lmod2b for further molecular analysis. In situ hybridization was conducted throughout zebrafish embryonic development to investigate the expression pattern of lmod2b. To further understand the function of lmod2b, CRISPR-Cas9 gene knockout was conducted to look for cardiac abnormalities.
","acknowledgements":"We thank the staff of Miami University Laboratory Animal Resources for animal care and Miami University Center for Bioinformatics and Functional Genomics for sequencing analysis. We thank Mason Posner for CRISPR methodology assistance, Joshua Waxman and Kendall Martin for productive discussion.
","authors":[{"affiliations":["Miami University"],"departments":["Department of Biology"],"credit":["formalAnalysis","conceptualization","dataCuration","methodology","writing_originalDraft","writing_reviewEditing","investigation","fundingAcquisition"],"email":"skylie28antle@gmail.com","firstName":"Skylie J","lastName":"Antle","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Miami University "],"departments":["Department of Biological Sciences "],"credit":["conceptualization","dataCuration","project","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing","methodology"],"email":"schumaj@miamioh.edu","firstName":"Jennifer A","lastName":"Schumacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"Undergraduate Summer Scholars","funderName":"Miami University (United States)","awardRecipient":"Skylie Antle"},{"awardId":"Start Up Funds","funderName":"Miami University (United States)","awardRecipient":"Jennifer Schumacher"}],"conflictsOfInterest":"The authors declare that Joshua Waxman as a conflict of interest.
","dataTable":null,"extendedData":[],"funding":"Miami University Undergraduate Summer Scholars, Miami University Start Up Funds
","image":{"url":"https://portal.micropublication.org/uploads/68f86f757368d9f799103ee8e7f6797c.png"},"imageCaption":"(A-E) shows in situ hybridization expression of lmod2b at multiple developmental stages. (A) 21 somites embryo (9/9). Arrowheads indicate adaxial cell expression. (B) 24 hours post fertilization embryo (12/12). Arrowhead indicates ventricle expression. (C) 26 hours post fertilization embryo (12/12). Arrowhead indicates ventricle expression. (D) 48 hours post fertilization embryo (10/10). Arrowheads indicate atrium and ventricle expression. (E) 72 hours post fertilization larva (11/11). Black arrowheads indicate ventricle expression. White arrowhead indicates craniofacial muscle expression. (F) Control larva at 5 days post fertilization. (G) lmod2b-KO crispant at 5 days post fertilization. (H) Heart rate quantification for control and crispant embryos at 4 days post fertilization. Crispants were injected at the 1-cell stage with 1 nl (n= 20 per condition) or 2 nl of gRNA mix (n=10 per condition). *** indicates p=0.0005. **** indicates p < 0.001.
","imageTitle":"Expression pattern and heart rate analysis data
","methods":"RNA probe synthesis: Total RNA was extracted and purified from 96 hpf wildtype zebrafish embryos. Reverse transcription using Superscript IV (Invitrogen) was then used to create cDNA. Forward and reverse primers were designed to amplify a 957 base pair (nucleotides 281-1237) section of the lmod2b coding sequence. PCR product was obtained for cloning with TOPO technology. Directionality of insertion was determined by Sanger sequencing. Plasmid linearization for probe synthesis was conducted using NotI restriction enzyme. SP6 RNA polymerase was used for in-vitro transcription. Digoxigenin labeled antisense RNA probe was precipitated and stored at -80°C.
In situ Hybridization: Zebrafish embryos were fixed at 21 somites, 24 hpf, 26 hpf, 48 hpf, and 72 hpf. Whole mount in situ hybridization was conducted at each developmental stage using lmod2b antisense RNA probe as previously described (Oxtoby & Jowett, 1993). Proteinase K treatment (10 mg/ml) was performed for 5 to 25 minutes at room temperature, depending on the stage examined. Samples were incubated in pre-hybridization solution for 2 hours at 65°C, followed by incubation with antisense RNA probes in hybridization solution at 65°C overnight. Pre-hyb/SSC wash series was completed at 65°C in 15 minute increments. Samples were placed in 5% sheep serum blocking solution for 1 hour at room temperature followed by Anti-Digoxigenin-AP Fab fragments antibody solution (1:5000) overnight at 4 °C. Staining was conducted with NBT/BCIP at room temperature until signal was visible. Samples were transferred to 80% glycerol for imaging with a Zeiss SteREO Discovery.V8 microscope equipped with a Zeiss Axiocam 506 color camera.
gRNA synthesis and CRISPR analysis: Oligonucleotide sequences were designed based on Wu et al. (2018) Genome-Scale Lookup Table for Four-Guide Sets. PCR products were obtained and purified. lmod2b gRNA was synthesized using T7 polymerase. A 1:2 ratio of purified gRNA to Cas9 protein was used to create the injection mix. The final concentration of Cas9 was 500 ng/ul and the final concentration of gRNA was 250 ng/ul. We injected 1 nl or 2 nl into 1-cell Tg(flk:nlsGFP) zebrafish embryos. Embryos were incubated at 28.6°C until heart analysis at 4 days post fertilization (dpf). Larvae were placed in 160 mg/mL tricaine solution for 1 minute before heart rate was quantified visually using a stereomicroscope.
Integrated DNA Technologies: Oligonucleotides
Invitrogen: Superscript IV Reverse Transcriptase Kit
Millipore Sigma: Anti-Digoxigenin-AP Fab fragments
New England Biolabs: PCR & DNA Cleanup Kit
New England Biolabs: HighScribe T7 kit
New England Biolabs: RNA clean up kit
New England Biolabs: Taq DNA polymerase
New England Biolabs: NotI restriction endonuclease
PNA Bio: Cas9 Protein
QIAGEN: QIAprep Spin Miniprep Kit
ThermoFisher Scientific: TOPO TA cloning kit
ThermoFisher Scientific: One Shot TOP10 chemically competent E. Coli
","patternDescription":"Dilated cardiomyopathy (DCM) affects about 0.00036% of individuals, and more than 50% of cases have underlying genetic factors (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). In the United States, DCM causes 10,000 deaths and 46,000 hospitalizations annually. However, these statistics may be underestimated due to some patients being asymptomatic. DCM causes weakened heart muscle due to abnormally large chambers of the heart, commonly starting in the left ventricle but can spread to the right ventricle then the atria in severe cases. The myocardium stretches thin causing it to be weakened (American Heart Association, 2024). Left ventricular dysfunction causes blood to remain in the heart after each contraction, so the heart must compensate to ensure blood flow to the rest of the body. This causes an overall higher heart rate (HR), known as tachycardia (Shoureshi et al., 2024). Patients often present with chest pain, dizziness or fainting, fatigue, heart palpitations, and dyspnea. These symptoms are manageable if detected early and properly treated (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). A vast number of studies relating to cardiomyopathy have been conducted, however the genetic basis of this condition is still unclear. LMOD2 is a causal gene of DCM but is less characterized than other DCM causal genes such as BAG3, DES, FLNC, LNMA, MYH7, PLN, RBM20, SCN5A, TNNC1, TNNT2, and TTN (Jordan et al., 2021). Mutations in LMOD2 that lead to impaired protein production can cause early-onset DCM that is fatal without proper medical intervention (Pappas et al., 2024).
Leiomodin gene family members are expressed in skeletal, smooth and cardiac muscle in adults, as well as during the fetal period (Conley et al., 2001). However, leiomodin 2 (Lmod2) is limited to cardiac and skeletal muscle (Tsukada et al., 2010). These striated muscles use sarcomeres to contract, which requires proper organization of actin and myosin filaments. Lmod2 is an actin nucleator, catalyzing the formation of new actin filaments. Lmod2 is necessary for regulating the length of thin filaments of cardiac muscle (Wu et al., 2017), which is crucial for maintaining the structure of sarcomeres, allowing for proper contractile function. When Lmod2 function is disrupted, abnormalities in thin filament structure can result in reduced cardiac muscle function (Wu et al., 2017).
In avian embryos, LMOD2 transcripts are expressed after the heart begins beating (Hamburger-Hamilton stage 14), indicating it is not the first actin nucleator involved in thin filament assembly (Tsukada et al., 2010). Overexpression of mCherry-Lmod2 in avian cardiomyocytes resulted in disorganized sarcomere structure and overextension of thin filaments, interfering with the typical striated patterns. In mouse embryos, Lmod2 transcripts are expressed in the heart at embryonic day 8.5, and in the somites at embryonic day 9.5 (Pappas et al., 2015). Lmod2 knockout (KO) mouse models were found to have abnormal cardiac contractility, shortened actin-thin filaments, and irregular calcium handling. Lmod2 knockout resulted in fatal neonatal DCM causing mice to die between 15 and 33 days after DCM onset. When Lmod2 was restored in Lmod2-KO mice at postnatal day 4, before heart defects were detected, thin filament length increased, nearly reaching normal levels (Pappas et al., 2015).
We use zebrafish as a model for cardiac development, as they lay large amounts of transparent embryos that allow for analysis of internal organs. Zebrafish have two-chambered hearts that begin beating at 24 hours post fertilization (hpf), shortly followed by blood flow. The simplicity of the two-chambered heart with rapid development of the cardiovascular system allows for quick data collection and analysis. Conserved signaling pathways and orthology to human disease makes zebrafish an excellent model for developmental processes. Zebrafish are a great model organism for cardiovascular development because they can survive up to five days post fertilization without a heartbeat. This resilience allows insight into the intricacies of the cardiovascular system, making them beneficial when compared to other model organisms. Zebrafish also serve as preclinical models, serving as a gateway to test the effectiveness of new therapeutic drugs that could potentially be used to treat symptoms of cardiomyopathy (Patton et al., 2022). Previous studies have shown that homozygous mutant lmod2a -/- zebrafish have irregular heart rhythms and impaired contractility, indicating that lmod2a plays an essential role in thin filament regulation (Ye et al., 2025). However, the role of lmod2b remains uncharacterized. lmod2b is predicted to be involved with actin filament organization, tropomyosin bind activity, muscle contraction, and myofibril assembly in zebrafish.
Using in situ hybridization with the lmod2b RNA probe, we saw cardiac expression at 24 hpf which aligns with this gene's predicted expression patterns. We also saw expression in the skeletal muscle structures which aligns with its predicted role in skeletal muscle contraction. Using CRISPR-Cas9 technology, we created a novel zebrafish model by knocking out the lmod2b gene to further our understanding of DCM. We found no significant pericardial edema or abnormalities in the craniofacial structure when comparing the control group to crispants. However, our findings are consistent with a potential role for lmod2b in DCM, as lmod2b crispants had higher heart rates compared to the control group.
In situ hybridization was conducted at multiple developmental stages to analyze expression patterns of lmod2b. At 21 somites, lmod2b was expressed in adaxial cells of the somites (Figure 1A). At 24 and 26 hpf, lmod2b was expressed in the myocardial tube (Figure 1B-C). First detection of lmod2b in the myocardial tube at 24 hpf when the heart begins to beat aligns with expression pattern data in avian embryos. At 48 hpf, lmod2b was expressed in both the ventricle and atrium (Figure 1D). At 72 hpf, lmod2b was expressed in the ventricle and craniofacial muscles (Figure 1E). As hypothesized, lmod2b was expressed in the cardiovascular system early stages of embryonic development, indicating potential importance for early cardiovascular function. Notable expression in the atrium at 48 hpf but not at 72 hpf aligns with changes in atrial morphology. The atrial wall thins by 72 hpf, likely resulting in weaker expression at 72 hpf that may not be detected by in situ hybridization. Expression in the craniofacial muscles indicates involvement in the skeletal muscle system, which supports its predicted roles in contractile function.
Tg(flk:nlsGFP) embryos were injected with a cocktail of four gRNAs and purified Cas9 protein to knock out lmod2b. Uninjected control and lmod2b crispant embryos were analyzed daily to check for abnormalities. The overall morphology of the embryo and the heart appeared normal in the crispants (Figure 1F-G), however heart rate analysis revealed abnormalities. Across multiple experiments, the lmod2b crispant zebrafish had higher heart rates than the controls (Figure 1H). Crispants injected with 1 nl gRNA mix had a heart rate average of 103.4 beats per minute compared to the control group which had an average of 91.78 beats per minute (n= 20 per condition). Crispants injected with 2 nl gRNA mix were found to have a heart rate average of 110.4 beats per minute compared to the control group which had an average of 95.2 beats per minute (n= 10 per condition). This indicates that lmod2b gene knockout resulted in tachycardia, which aligns with symptoms of DCM. We did not find notable abnormalities in blood flow or pericardial edema in lmod2b crispants (Figure 1F-G). Based on the heart rate results, we can infer that there may be subtle defects within the structure of the heart that could be revealed with higher resolution analysis.
Moving forward, we will continue investigating heart morphology of lmod2b KO crispants by conducting MF20 and S46 immunostaining, which mark myosin heavy chains in both chambers and only the atrium, respectively. This could highlight cardiac defects that are not visible under normal microscopy. Zebrafish knockouts of lmod2a and lmod2b both result in cardiac abnormalities, which suggests that these genes are not functionally redundant, and each plays a specific role in cardiac function. Based on this observation, we will further investigate the genetic networks by conducting a double knockdown of lmod2a/lmod2b. We will analyze the double knockdown crispants to continue understanding the molecular mechanisms of DCM. Creating a stable mutant line in the future will allow us to evaluate any defects that occur through adulthood and calculate survival rate.
","references":[{"reference":"American Heart Association. (2024). Dilated Cardiomyopathy (DCM). https://www.heart.org/en/health-topics/cardiomyopathy/what-is-cardiomyopathy-in-adults/dilated-cardiomyopathy-dcm
","pubmedId":"","doi":""},{"reference":"Cleveland Clinic. (2024). Dilated Cardiomyopathy: Symptoms and Treatment. https://my.clevelandclinic.org/health/diseases/16932-dilated-cardiomyopathy
","pubmedId":"","doi":""},{"reference":"Conley CA, Fritz-Six KL, Almenar-Queralt A, Fowler VM. 2001. Leiomodins: Larger Members of the Tropomodulin (Tmod) Gene Family. Genomics 73: 127-139.
","pubmedId":"","doi":"10.1006/geno.2000.6501"},{"reference":"Jordan E, Peterson L, Ai T, Asatryan B, Bronicki L, Brown E, et al., Hershberger. 2021. Evidence-Based Assessment of Genes in Dilated Cardiomyopathy. Circulation 144: 7-19.
","pubmedId":"","doi":"10.1161/CIRCULATIONAHA.120.053033"},{"reference":"Oxtoby E, Jowett T. 1993. Cloning of the zebrafishkrox-20gene (krx-20) and its expression during hindbrain development. Nucleic Acids Research 21: 1087-1095.
","pubmedId":"","doi":"10.1093/nar/21.5.1087"},{"reference":"Pappas CT, Mayfield RM, Dickerson AE, Mi-Mi L, Gregorio CC. 2024. Human disease-causing mutations result in loss of leiomodin 2 through nonsense-mediated mRNA decay. PLOS Genetics 20: e1011279.
","pubmedId":"","doi":"10.1371/journal.pgen.1011279"},{"reference":"Pappas CT, Mayfield RM, Henderson C, Jamilpour N, Cover C, Hernandez Z, et al., Gregorio. 2015. Knockout of Lmod2 results in shorter thin filaments followed by dilated cardiomyopathy and juvenile lethality. Proceedings of the National Academy of Sciences 112: 13573-13578.
","pubmedId":"","doi":"10.1073/pnas.1508273112"},{"reference":"Patton EE, Zon LI, Langenau DM. 2021. Zebrafish disease models in drug discovery: from preclinical modelling to clinical trials. Nature Reviews Drug Discovery 20: 611-628.
","pubmedId":"","doi":"10.1038/s41573-021-00210-8"},{"reference":"Shoureshi P, Tan AY, Koneru J, Ellenbogen KA, Kaszala K, Huizar JF. 2024. Arrhythmia-Induced Cardiomyopathy. Journal of the American College of Cardiology 83: 2214-2232.
","pubmedId":"","doi":"10.1016/j.jacc.2024.03.416"},{"reference":"Tsukada T, Pappas CT, Moroz N, Antin PB, Kostyukova AS, Gregorio CC. 2010. Leiomodin-2 is an antagonist of tropomodulin-1 at the pointed end of the thin filaments in cardiac muscle. Journal of Cell Science 123: 3136-3145.
","pubmedId":"","doi":"10.1242/jcs.071837"},{"reference":"Wu RS, Lam II, Clay H, Duong DN, Deo RC, Coughlin SR. 2018. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Developmental Cell 46: 112-125.e4.
","pubmedId":"","doi":"10.1016/j.devcel.2018.06.003"},{"reference":"Wu T, Mu Y, Bogomolovas J, Fang X, Veevers J, Nowak RB, et al., Chen. 2017. HSPB7 is indispensable for heart development by modulating actin filament assembly. Proceedings of the National Academy of Sciences 114: 11956-11961.
","pubmedId":"","doi":"10.1073/pnas.1713763114"},{"reference":"Ye X, Jia H, Zu Y. 2025. lmod2a mutations affect F-actin and SRF pathway leading to cardiac dysfunction in zebrafish. Developmental Biology 525: 306-316.
","pubmedId":"","doi":"10.1016/j.ydbio.2025.06.002"}],"title":"Novel leiomodin 2b knockout in zebrafish as model for dilated cardiomyopathy
","reviews":[{"reviewer":{"displayName":"Joshua Bloomekatz"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":null}]},{"id":"187ecace-3228-4d4e-8bbb-cd510711b16d","decision":"revise","abstract":"Congenital heart disease (CHD) is highly prevalent in live births and requires concise diagnoses and treatment plans. Although there is a vast amount of genetics research in the field of CHD, there are still knowledge gaps regarding the gene networks surrounding heart development. A literature review revealed that mutation in Leiomodin 2 is associated with dilated cardiomyopathy in humans. We selected lmod2b for further molecular analysis. In situ hybridization was conducted throughout zebrafish embryonic development to investigate the expression pattern of lmod2b. To further understand the function of lmod2b, CRISPR-Cas9 gene knockout was conducted to look for cardiac abnormalities.
","acknowledgements":"We thank the staff of Miami University Laboratory Animal Resources for animal care and Miami University Center for Bioinformatics and Functional Genomics for sequencing analysis. We thank Mason Posner for CRISPR methodology assistance, Joshua Waxman and Kendall Martin for productive discussion.
","authors":[{"affiliations":["Miami University"],"departments":["Department of Biology"],"credit":["formalAnalysis","conceptualization","dataCuration","methodology","writing_originalDraft","writing_reviewEditing","investigation","fundingAcquisition"],"email":"skylie28antle@gmail.com","firstName":"Skylie J","lastName":"Antle","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Miami University "],"departments":["Department of Biological Sciences "],"credit":["conceptualization","dataCuration","project","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing","methodology"],"email":"schumaj@miamioh.edu","firstName":"Jennifer A","lastName":"Schumacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"Undergraduate Summer Scholars","funderName":"Miami University (United States)","awardRecipient":"Skylie Antle"},{"awardId":"Start Up Funds","funderName":"Miami University (United States)","awardRecipient":"Jennifer Schumacher"}],"conflictsOfInterest":"The authors declare that Joshua Waxman as a conflict of interest.
","dataTable":{"url":null},"extendedData":[],"funding":"Miami University Undergraduate Summer Scholars, Miami University Start Up Funds
","image":{"url":"https://portal.micropublication.org/uploads/3babfdabd98a7eb8d5ccd9fa37247eb6.jpg"},"imageCaption":"(A-E) shows in situ hybridization expression of lmod2b at multiple developmental stages. (A) 21 somites embryo (9/9). Arrowheads indicate adaxial cell expression. (B) 24 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (C) 26 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (D) 48 hpf embryo (10/10). Arrowheads indicate atrium and ventricle expression. (E) 72 hpf larva (11/11). Black arrowheads indicate ventricle expression. White arrowhead indicates craniofacial muscle expression. (F) Control larva at 5 dpf. (G) lmod2b-KO crispant at 5 days post fertilization. (H) Gel electrophoresis for PCR amplification of itga4, and lmod2b in exon and 1 exon 2. Lanes 3 and 4 indicate itga4 controls for uncut genomic regions. Lanes 5 and 6 indicate exon 1 of the genomic region. Lanes 7 and 8 indicate exon 2 of the genomic region. As seen in lanes 6 and 8, crispants showed decreased intensity of bands, showing mosaic knockout. Arrowhead in lane 8 shows heteroduplex. (I) Heart rate quantification for control and crispant embryos at 4 days post fertilization. Crispants were injected at the 1-cell stage with 1 nl of gRNA cocktail (n= 30 per condition). **** indicates p < 0.0001.
","imageTitle":"Expression pattern of lmod2b, heart rate analysis in lmod2b crispants, and CRISPR conformation gel electrophoresis
","methods":"RNA probe synthesis: Total RNA was extracted and purified from 96 hpf wildtype zebrafish embryos. Reverse transcription using Superscript IV (Invitrogen) was then used to create cDNA. Forward and reverse primers were designed to amplify a 957 base pair (nucleotides 281-1237) section of the lmod2b coding sequence. PCR product was obtained for cloning with TOPO technology. Directionality of insertion was determined by Sanger sequencing. Plasmid linearization for probe synthesis was conducted using NotI restriction enzyme. SP6 RNA polymerase was used for in-vitro transcription. Digoxigenin labeled antisense RNA probe was precipitated and stored at -80°C.
In situ Hybridization: Zebrafish embryos were fixed at 21 somites, 24 hpf, 26 hpf, 48 hpf, and 72 hpf. Whole mount in situ hybridization was conducted at each developmental stage using lmod2b antisense RNA probe as previously described (Oxtoby & Jowett, 1993). Proteinase K treatment (10 mg/ml) was performed for 5 to 25 minutes at room temperature, depending on the stage examined. Samples were incubated in pre-hybridization solution for 2 hours at 65°C, followed by incubation with antisense RNA probes in hybridization solution at 65°C overnight. Pre-hyb/SSC wash series was completed at 65°C in 15 minute increments. Samples were placed in 5% sheep serum blocking solution for 1 hour at room temperature followed by Anti-Digoxigenin-AP Fab fragments antibody solution (1:5000) overnight at 4 °C. Staining was conducted with NBT/BCIP at room temperature until signal was visible. Samples were transferred to 80% glycerol for imaging with a Zeiss SteREO Discovery.V8 microscope equipped with a Zeiss Axiocam 506 color camera.
gRNA synthesis and CRISPR analysis: Oligonucleotide sequences were designed based on Wu et al. (2018) Genome-Scale Lookup Table for Four-Guide Sets. PCR products were obtained and purified. lmod2b gRNA was synthesized using T7 polymerase. A 1:2 ratio of purified gRNA to Cas9 protein was used to create the injection mix. The final concentration of Cas9 was 500 ng/ul and the final concentration of gRNA was 250 ng/ul. We injected 1 nl into 1-cell Tg(flk:nlsGFP) zebrafish embryos. Embryos were incubated at 28.6°C until heart analysis at 4 days post fertilization (dpf). For heart rate quantification, randomly selected larvae were individually transferred in a minimal amount of liquid into a depression slide containing 160 mg/mL tricaine stock solution. The larva was then incubated for 1 minute before measuring heart rate. Heart rate was quantified visually using a stereomicroscope by counting beats with a tally counter for 15 seconds and multiplying by 4 to be recorded in beats per minute. Each larva was incubated individually in fresh tricaine solution for 1 minute before HR was counted to ensure consistent anesthetic treatment across all samples. Based on experimental set up, the investigator was not blinded to experimental conditions. Analysis of control and crispant embryos was replicated 3 times with n=10 per condition for each trial.
CRISPR confirmation: To confirm knockout of lmod2b on the molecular level, genomic DNA was extracted from control and crispant embryos at 24 hpf. Zebrafish were anesthetized with tricaine and sorted into PCR tubes. To extract DNA, lysis buffer was prepared with 10 mM Tris HCl pH 7.5, 50 mM KCl, 0.3% Tween-20, 0.3% NP-40, and 1 mM EDTA pH 8. Lysis buffer was added and embryos were incubated for 10 minutes at 95° C. Proteinase K treatment (2 µg/ml) was performed at 55° C for 12 hours followed by enzyme inactivation at 95° C for 10 minutes. After lysate was obtained, genomic DNA was amplified using PCR. Primer pairs based on guide RNA sites were designed for PCR in CHOPCHOP. Primer pair 1 amplified across the genomic region spanning exon 1, where gRNAs 1 and 2 cut (nucleotides 185,713-186,255). Primer pair 2 amplified the genomic region spanning exon 2, where gRNAs 3 and 4 cut (nucleotides 184,171-184,821). Primers for itga4 gene were used as a control for an uncut region of the genome (Schumacher et al., 2020). itga4 is on chromosome 9 whereas lmod2b is on chromosome 4, ensuring there would be no CRISPR cleavage at this site. Gene knockout was confirmed using gel electrophoresis on a 1.5% agarose gel.
Integrated DNA Technologies: Oligonucleotides
Invitrogen: Superscript IV Reverse Transcriptase Kit
Millipore Sigma: Anti-Digoxigenin-AP Fab fragments
New England Biolabs: PCR & DNA Cleanup Kit
New England Biolabs: HighScribe T7 kit
New England Biolabs: RNA clean up kit
New England Biolabs: Taq DNA polymerase
New England Biolabs: NotI restriction endonuclease
PNA Bio: Cas9 Protein
QIAGEN: QIAprep Spin Miniprep Kit
ThermoFisher Scientific: TOPO TA cloning kit
ThermoFisher Scientific: One Shot TOP10 chemically competent E. Coli
","patternDescription":"Dilated cardiomyopathy (DCM) affects about 0.00036% of individuals, and more than 50% of cases have underlying genetic factors (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). In the United States, DCM causes 10,000 deaths and 46,000 hospitalizations annually. However, these statistics may be underestimated due to some patients being asymptomatic. DCM causes weakened heart muscle due to abnormally large chambers of the heart, commonly starting in the left ventricle but can spread to the right ventricle then the atria in severe cases. The myocardium stretches thin, causing it to be weakened (American Heart Association, 2024). Left ventricular dysfunction causes blood to remain in the heart after each contraction, so the heart must compensate to ensure blood flow to the rest of the body. This leads to an overall higher heart rate (HR), known as tachycardia (Shoureshi et al., 2024). Patients often present with chest pain, dizziness or fainting, fatigue, heart palpitations, and dyspnea. These symptoms are manageable if detected early and properly treated (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). A vast number of studies relating to cardiomyopathy have been conducted, however the genetic basis of this condition is still unclear. LMOD2 is a causal gene of DCM but is less characterized than other DCM causal genes such as BAG3, DES, FLNC, LNMA, MYH7, PLN, RBM20, SCN5A, TNNC1, TNNT2, and TTN (Jordan et al., 2021). Mutations in LMOD2 that lead to impaired protein production can cause early-onset DCM that is fatal without proper medical intervention (Pappas et al., 2024).
Leiomodin gene family members are expressed in skeletal, smooth and cardiac muscle in adults, as well as during the fetal period (Conley et al., 2001). However, leiomodin 2 (Lmod2) is limited to cardiac and skeletal muscle (Tsukada et al., 2010). These striated muscles use sarcomeres to contract, which requires proper organization of actin and myosin filaments. Lmod2 is an actin nucleator, catalyzing the formation of new actin filaments. Lmod2 is necessary for regulating the length of thin filaments of cardiac muscle (Wu et al., 2017), which is crucial for maintaining the structure of sarcomeres, allowing for proper contractile function. When Lmod2 function is disrupted, abnormalities in thin filament structure can result in reduced cardiac muscle function (Wu et al., 2017).
In avian embryos, LMOD2 transcripts are expressed after the heart begins beating (Hamburger-Hamilton stage 14), indicating it is not the first actin nucleator involved in thin filament assembly (Tsukada et al., 2010). Overexpression of mCherry-Lmod2 in avian cardiomyocytes resulted in disorganized sarcomere structure and overextension of thin filaments, interfering with the typical striated patterns. In mouse embryos, Lmod2 transcripts are expressed in the heart at embryonic day 8.5, and in the somites at embryonic day 9.5 (Pappas et al., 2015). Lmod2 knockout (KO) mouse models were found to have abnormal cardiac contractility, shortened actin-thin filaments, and irregular calcium handling. Lmod2 knockout resulted in fatal neonatal DCM causing mice to die between 15 and 33 days after DCM onset. When Lmod2 was restored in Lmod2-KO mice at postnatal day 4, before heart defects were detected, thin filament length increased, nearly reaching normal levels (Pappas et al., 2015).
We use zebrafish as a model for cardiac development, as they lay large amounts of transparent embryos that allow for analysis of internal organs. Zebrafish have two-chambered hearts that begin beating at 24 hours post fertilization (hpf), shortly followed by blood flow. The simplicity of the two-chambered heart with rapid development of the cardiovascular system allows for quick data collection and analysis. Conserved signaling pathways and orthology to human disease makes zebrafish an excellent model for developmental processes. Zebrafish are a great model organism for cardiovascular development because they can survive up to five days post fertilization without a heartbeat. This resilience allows insight into the intricacies of the cardiovascular system, making them beneficial when compared to other model organisms. Zebrafish are extremely useful as preclinical models, serving as a gateway to test the effectiveness of new therapeutic drugs that could potentially be used to treat symptoms of cardiomyopathy (Patton et al., 2022). Previous studies have shown that homozygous mutant lmod2a -/- zebrafish have irregular heart rhythms and impaired contractility, indicating that lmod2a plays an essential role in thin filament regulation (Ye et al., 2025). However, the role of lmod2b remains uncharacterized. lmod2b is predicted to be involved with actin filament organization, tropomyosin bind activity, muscle contraction, and myofibril assembly in zebrafish.
Using in situ hybridization with the lmod2b RNA probe, we saw cardiac expression at 24 hours post fertilization (hpf) which aligns with this gene's predicted expression patterns. We also saw expression in the skeletal muscle structures which aligns with its predicted role in skeletal muscle contraction. Using CRISPR-Cas9 technology, we created a novel zebrafish model by knocking out the lmod2b gene to further our understanding of DCM. We found no significant pericardial edema or abnormalities in the craniofacial structure when comparing the control group to crispants. However, our findings are consistent with a potential role for lmod2b in DCM, as lmod2b crispants had higher heart rates compared to the control group.
Discussion
In situ hybridization was conducted at multiple developmental stages to analyze expression patterns of lmod2b. At 21 somites, lmod2b was expressed in adaxial cells of the somites (Figure 1A). At 24 and 26 hpf, lmod2b was expressed in the myocardial tube (Figure 1B-C). First detection of lmod2b in the myocardial tube at 24 hpf when the heart begins to beat aligns with expression pattern data in avian embryos. At 48 hpf, lmod2b was expressed in both the ventricle and atrium (Figure 1D). At 72 hpf, lmod2b was expressed in the ventricle and craniofacial muscles (Figure 1E). As hypothesized, lmod2b was expressed in the cardiovascular system during early stages of embryonic development, indicating potential importance for early cardiovascular function. Notable expression in the atrium at 48 hpf but not at 72 hpf aligns with changes in atrial morphology. The atrial wall thins by 72 hpf, likely resulting in weaker expression at 72 hpf that may not be detected by in situ hybridization. Expression in the craniofacial muscles indicates involvement in the skeletal muscle system, which supports its predicted roles in contractile function.
Tg(flk:nlsGFP) embryos were injected with a cocktail of four gRNAs and purified Cas9 protein to knock out lmod2b. Alterations at the lmod2b locus were confirmed with PCR amplification of genomic DNA (Figure 1H). Uninjected control and lmod2b crispant embryos were analyzed daily to check for abnormalities. The overall morphology of the embryo and the heart appeared normal in the crispants (Figure 1F-G), however heart rate analysis revealed abnormalities. Across multiple experiments, the lmod2b crispant zebrafish had higher heart rates than the controls (Figure 1I). Crispants injected with 1 nl gRNA mix had a heart rate average of 108.4 beats per minute compared to the control group, which had an average of 92.8 beats per minute (n= 30 per condition). This indicates that lmod2b gene knockout resulted in tachycardia, which aligns with symptoms of DCM. We did not find notable abnormalities in blood flow or pericardial edema in lmod2b crispants (Figure 1F-G). Based on the heart rate results, we can infer that there may be subtle defects within the structure of the heart that could be revealed with higher resolution analysis.
Moving forward, we will continue investigating heart morphology of lmod2b KO crispants by conducting MF20 and S46 immunostaining, which mark myosin heavy chains in both chambers and only the atrium, respectively. This could highlight cardiac defects that are not visible under normal stereomicroscopy conditions. Zebrafish knockouts of lmod2a and lmod2b both result in cardiac abnormalities, which suggests that these genes are not functionally redundant, and each plays a specific role in cardiac function. Based on this observation, we will further investigate the genetic networks by conducting a double knockdown of lmod2a/lmod2b. We will analyze the double knockdown crispants to continue understanding the molecular mechanisms of DCM. Creating a stable mutant line in the future will allow us to evaluate any defects that occur through adulthood and calculate survival rate.
","references":[{"reference":"American Heart Association. (2024). Dilated Cardiomyopathy (DCM). https://www.heart.org/en/health-topics/cardiomyopathy/what-is-cardiomyopathy-in-adults/dilated-cardiomyopathy-dcm
","pubmedId":"","doi":""},{"reference":"Cleveland Clinic. (2024). Dilated Cardiomyopathy: Symptoms and Treatment. https://my.clevelandclinic.org/health/diseases/16932-dilated-cardiomyopathy
","pubmedId":"","doi":""},{"reference":"Conley CA, Fritz-Six KL, Almenar-Queralt A, Fowler VM. 2001. Leiomodins: Larger Members of the Tropomodulin (Tmod) Gene Family. Genomics 73: 127-139.
","pubmedId":"","doi":"10.1006/geno.2000.6501"},{"reference":"Jordan E, Peterson L, Ai T, Asatryan B, Bronicki L, Brown E, et al., Hershberger. 2021. Evidence-Based Assessment of Genes in Dilated Cardiomyopathy. Circulation 144: 7-19.
","pubmedId":"","doi":"10.1161/CIRCULATIONAHA.120.053033"},{"reference":"Oxtoby E, Jowett T. 1993. Cloning of the zebrafishkrox-20gene (krx-20) and its expression during hindbrain development. Nucleic Acids Research 21: 1087-1095.
","pubmedId":"","doi":"10.1093/nar/21.5.1087"},{"reference":"Pappas CT, Mayfield RM, Dickerson AE, Mi-Mi L, Gregorio CC. 2024. Human disease-causing mutations result in loss of leiomodin 2 through nonsense-mediated mRNA decay. PLOS Genetics 20: e1011279.
","pubmedId":"","doi":"10.1371/journal.pgen.1011279"},{"reference":"Pappas CT, Mayfield RM, Henderson C, Jamilpour N, Cover C, Hernandez Z, et al., Gregorio. 2015. Knockout of Lmod2 results in shorter thin filaments followed by dilated cardiomyopathy and juvenile lethality. Proceedings of the National Academy of Sciences 112: 13573-13578.
","pubmedId":"","doi":"10.1073/pnas.1508273112"},{"reference":"Patton EE, Zon LI, Langenau DM. 2021. Zebrafish disease models in drug discovery: from preclinical modelling to clinical trials. Nature Reviews Drug Discovery 20: 611-628.
","pubmedId":"","doi":"10.1038/s41573-021-00210-8"},{"reference":"Schumacher JA, Wright ZA, Owen ML, Bredemeier NO, Sumanas S. 2020. Integrin α5 and Integrin α4 cooperate to promote endocardial differentiation and heart morphogenesis. Developmental Biology 465: 46-57.
","pubmedId":"","doi":"10.1016/j.ydbio.2020.06.006"},{"reference":"Shoureshi P, Tan AY, Koneru J, Ellenbogen KA, Kaszala K, Huizar JF. 2024. Arrhythmia-Induced Cardiomyopathy. Journal of the American College of Cardiology 83: 2214-2232.
","pubmedId":"","doi":"10.1016/j.jacc.2024.03.416"},{"reference":"Tsukada T, Pappas CT, Moroz N, Antin PB, Kostyukova AS, Gregorio CC. 2010. Leiomodin-2 is an antagonist of tropomodulin-1 at the pointed end of the thin filaments in cardiac muscle. Journal of Cell Science 123: 3136-3145.
","pubmedId":"","doi":"10.1242/jcs.071837"},{"reference":"Wu RS, Lam II, Clay H, Duong DN, Deo RC, Coughlin SR. 2018. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Developmental Cell 46: 112-125.e4.
","pubmedId":"","doi":"10.1016/j.devcel.2018.06.003"},{"reference":"Wu T, Mu Y, Bogomolovas J, Fang X, Veevers J, Nowak RB, et al., Chen. 2017. HSPB7 is indispensable for heart development by modulating actin filament assembly. Proceedings of the National Academy of Sciences 114: 11956-11961.
","pubmedId":"","doi":"10.1073/pnas.1713763114"},{"reference":"Ye X, Jia H, Zu Y. 2025. lmod2a mutations affect F-actin and SRF pathway leading to cardiac dysfunction in zebrafish. Developmental Biology 525: 306-316.
","pubmedId":"","doi":"10.1016/j.ydbio.2025.06.002"}],"title":"Novel leiomodin 2b knockout in zebrafish as model for dilated cardiomyopathy
","reviews":[{"reviewer":{"displayName":"Joshua Bloomekatz"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":null}]},{"id":"c1e2248c-0b89-40d4-86bf-59ede111264d","decision":"revise","abstract":"Congenital heart disease (CHD) is highly prevalent in live births and requires concise diagnoses and treatment plans. Although there is a vast amount of genetics research in the field of CHD, there are still knowledge gaps regarding the gene networks surrounding heart development. A literature review revealed that mutation in Leiomodin 2 is associated with dilated cardiomyopathy in humans. We selected lmod2b for further molecular analysis. In situ hybridization was conducted throughout zebrafish embryonic development to investigate the expression pattern of lmod2b. To further understand the function of lmod2b, CRISPR-Cas9 gene editing was conducted to look for cardiac abnormalities.
","acknowledgements":"We thank the staff of Miami University Laboratory Animal Resources for animal care and Miami University Center for Bioinformatics and Functional Genomics for sequencing analysis. We thank Mason Posner for CRISPR methodology assistance, Joshua Waxman and Kendall Martin for productive discussion.
","authors":[{"affiliations":["Miami University"],"departments":["Department of Biology"],"credit":["formalAnalysis","conceptualization","dataCuration","methodology","writing_originalDraft","writing_reviewEditing","investigation","fundingAcquisition"],"email":"skylie28antle@gmail.com","firstName":"Skylie J","lastName":"Antle","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Miami University "],"departments":["Department of Biological Sciences "],"credit":["conceptualization","dataCuration","project","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing","methodology"],"email":"schumaj@miamioh.edu","firstName":"Jennifer A","lastName":"Schumacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"Undergraduate Summer Scholars","funderName":"Miami University (United States)","awardRecipient":"Skylie Antle"},{"awardId":"Start Up Funds","funderName":"Miami University (United States)","awardRecipient":"Jennifer Schumacher"}],"conflictsOfInterest":"The authors declare that Joshua Waxman as a conflict of interest.
","dataTable":{"url":null},"extendedData":[],"funding":"Miami University Undergraduate Summer Scholars, Miami University Start Up Funds
","image":{"url":"https://portal.micropublication.org/uploads/e1974e8adc4fd27e386c98566d5c8f2d.jpg"},"imageCaption":"(A-E) shows in situ hybridization expression of lmod2b at multiple developmental stages. (A) 21 somites embryo (9/9). Arrowheads indicate adaxial cell expression. (B) 24 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (C) 26 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (D) 48 hpf embryo (10/10). Arrowheads indicate atrium and ventricle expression. (E) 72 hpf larva (11/11). Black arrowheads indicate ventricle expression. White arrowhead indicates craniofacial muscle expression. (F) Control larva at 5 dpf. (G) lmod2b-KO crispant at 5 days post fertilization. (H) Gel electrophoresis for PCR amplification of itga4, and lmod2b in exon and 1 exon 2. Lanes 3 and 4 indicate itga4 controls for uncut genomic regions. Lanes 5 and 6 indicate exon 1 of the genomic region. Lanes 7 and 8 indicate exon 2 of the genomic region. As seen in lanes 6 and 8, crispants showed decreased intensity of bands, showing mosaic gene editing. Arrowhead in lane 8 shows heteroduplex. (I) Heart rate quantification for control and crispant embryos at 4 days post fertilization. Crispants were injected at the 1-cell stage with 1 nl of gRNA cocktail (n= 30 per condition). **** indicates p < 0.0001.
","imageTitle":"Expression pattern of lmod2b, heart rate analysis in lmod2b crispants, and CRISPR conformation gel electrophoresis
","methods":"RNA probe synthesis: Total RNA was extracted and purified from 96 hpf wildtype zebrafish embryos. Reverse transcription using Superscript IV (Invitrogen) was then used to create cDNA. Forward and reverse primers were designed to amplify a 957 base pair (nucleotides 281-1237) section of the lmod2b coding sequence. PCR product was obtained for cloning with TOPO technology. Directionality of insertion was determined by Sanger sequencing. Plasmid linearization for probe synthesis was conducted using NotI restriction enzyme. SP6 RNA polymerase was used for in-vitro transcription. Digoxigenin labeled antisense RNA probe was precipitated and stored at -80°C.
In situ Hybridization: Zebrafish embryos were fixed at 21 somites, 24 hpf, 26 hpf, 48 hpf, and 72 hpf. Whole mount in situ hybridization was conducted at each developmental stage using lmod2b antisense RNA probe as previously described (Oxtoby & Jowett, 1993). Proteinase K treatment (10 mg/ml) was performed for 5 to 25 minutes at room temperature, depending on the stage examined. Samples were incubated in pre-hybridization solution for 2 hours at 65°C, followed by incubation with antisense RNA probes in hybridization solution at 65°C overnight. Pre-hyb/SSC wash series was completed at 65°C in 15 minute increments. Samples were placed in 5% sheep serum blocking solution for 1 hour at room temperature followed by Anti-Digoxigenin-AP Fab fragments antibody solution (1:5000) overnight at 4 °C. Staining was conducted with NBT/BCIP at room temperature until signal was visible. Samples were transferred to 80% glycerol for imaging with a Zeiss SteREO Discovery.V8 microscope equipped with a Zeiss Axiocam 506 color camera.
gRNA synthesis and CRISPR analysis: Oligonucleotide sequences were designed based on Wu et al. (2018) Genome-Scale Lookup Table for Four-Guide Sets. PCR products were obtained and purified. lmod2b gRNA was synthesized using T7 polymerase. A 1:2 ratio of purified gRNA to Cas9 protein was used to create the injection mix. The final concentration of Cas9 was 500 ng/ul and the final concentration of gRNA was 250 ng/ul. We injected 1 nl into 1-cell Tg(flk:nlsGFP) zebrafish embryos. Embryos were incubated at 28.6°C until heart analysis at 4 days post fertilization (dpf). For heart rate quantification, randomly selected larvae were individually transferred in a minimal amount of liquid into a depression slide containing 160 mg/mL tricaine stock solution. The larva was then incubated for 1 minute before measuring heart rate. Heart rate was quantified visually using a stereomicroscope by counting beats with a tally counter for 15 seconds and multiplying by 4 to be recorded in beats per minute. Each larva was incubated individually in fresh tricaine solution for 1 minute before HR was counted to ensure consistent anesthetic treatment across all samples. Based on experimental set up, the investigator was not blinded to experimental conditions. Analysis of control and crispant embryos was replicated 3 times with n=10 per condition for each trial.
CRISPR confirmation: To confirm editing of the lmod2b locus on the molecular level, genomic DNA was extracted from control and crispant embryos at 24 hpf. Zebrafish were anesthetized with tricaine and sorted into PCR tubes. To extract DNA, lysis buffer was prepared with 10 mM Tris HCl pH 7.5, 50 mM KCl, 0.3% Tween-20, 0.3% NP-40, and 1 mM EDTA pH 8. Lysis buffer was added and embryos were incubated for 10 minutes at 95° C. Proteinase K treatment (2 µg/ml) was performed at 55° C for 12 hours followed by enzyme inactivation at 95° C for 10 minutes. After lysate was obtained, genomic DNA was amplified using PCR. Primer pairs based on guide RNA sites were designed for PCR in CHOPCHOP. Primer pair 1 amplified across the genomic region spanning exon 1, where gRNAs 1 and 2 cut (nucleotides 185,713-186,255). Primer pair 2 amplified the genomic region spanning exon 2, where gRNAs 3 and 4 cut (nucleotides 184,171-184,821). Primers for itga4 gene were used as a control for an uncut region of the genome (Schumacher et al., 2020). itga4 is on chromosome 9 whereas lmod2b is on chromosome 4, ensuring there would be no CRISPR cleavage at this site. Gene mutation was confirmed using gel electrophoresis on a 1.5% agarose gel.
Integrated DNA Technologies: Oligonucleotides
Invitrogen: Superscript IV Reverse Transcriptase Kit
Millipore Sigma: Anti-Digoxigenin-AP Fab fragments
New England Biolabs: PCR & DNA Cleanup Kit
New England Biolabs: HighScribe T7 kit
New England Biolabs: RNA clean up kit
New England Biolabs: Taq DNA polymerase
New England Biolabs: NotI restriction endonuclease
PNA Bio: Cas9 Protein
QIAGEN: QIAprep Spin Miniprep Kit
ThermoFisher Scientific: TOPO TA cloning kit
ThermoFisher Scientific: One Shot TOP10 chemically competent E. Coli
","patternDescription":"Dilated cardiomyopathy (DCM) affects about 0.00036% of individuals, and more than 50% of cases have underlying genetic factors (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). In the United States, DCM causes 10,000 deaths and 46,000 hospitalizations annually. However, these statistics may be underestimated due to some patients being asymptomatic. DCM causes weakened heart muscle due to abnormally large chambers of the heart, commonly starting in the left ventricle but can spread to the right ventricle then the atria in severe cases. The myocardium stretches thin, causing it to be weakened (American Heart Association, 2024). Left ventricular dysfunction causes blood to remain in the heart after each contraction, so the heart must compensate to ensure blood flow to the rest of the body. This leads to an overall higher heart rate (HR), known as tachycardia (Shoureshi et al., 2024). Patients often present with chest pain, dizziness or fainting, fatigue, heart palpitations, and dyspnea. These symptoms are manageable if detected early and properly treated (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). A vast number of studies relating to cardiomyopathy have been conducted, however the genetic basis of this condition is still unclear. LMOD2 is a causal gene of DCM but is less characterized than other DCM causal genes such as BAG3, DES, FLNC, LNMA, MYH7, PLN, RBM20, SCN5A, TNNC1, TNNT2, and TTN (Jordan et al., 2021). Mutations in LMOD2 that lead to impaired protein production can cause early-onset DCM that is fatal without proper medical intervention (Pappas et al., 2024).
Leiomodin gene family members are expressed in skeletal, smooth and cardiac muscle in adults, as well as during the fetal period (Conley et al., 2001). However, leiomodin 2 (Lmod2) is limited to cardiac and skeletal muscle (Tsukada et al., 2010). These striated muscles use sarcomeres to contract, which requires proper organization of actin and myosin filaments. Lmod2 is an actin nucleator, catalyzing the formation of new actin filaments. Lmod2 is necessary for regulating the length of thin filaments of cardiac muscle (Wu et al., 2017), which is crucial for maintaining the structure of sarcomeres, allowing for proper contractile function. When Lmod2 function is disrupted, abnormalities in thin filament structure can result in reduced cardiac muscle function (Wu et al., 2017).
In avian embryos, LMOD2 transcripts are expressed after the heart begins beating (Hamburger-Hamilton stage 14), indicating it is not the first actin nucleator involved in thin filament assembly (Tsukada et al., 2010). Overexpression of mCherry-Lmod2 in avian cardiomyocytes resulted in disorganized sarcomere structure and overextension of thin filaments, interfering with the typical striated patterns. In mouse embryos, Lmod2 transcripts are expressed in the heart at embryonic day 8.5, and in the somites at embryonic day 9.5 (Pappas et al., 2015). Lmod2 knockout (KO) mouse models were found to have abnormal cardiac contractility, shortened actin-thin filaments, and irregular calcium handling. Lmod2 knockout resulted in fatal neonatal DCM causing mice to die between 15 and 33 days after DCM onset. When Lmod2 was restored in Lmod2-KO mice at postnatal day 4, before heart defects were detected, thin filament length increased, nearly reaching normal levels (Pappas et al., 2015).
We use zebrafish as a model for cardiac development, as they lay large amounts of transparent embryos that allow for analysis of internal organs. Zebrafish have two-chambered hearts that begin beating at 24 hours post fertilization (hpf), shortly followed by blood flow. The simplicity of the two-chambered heart with rapid development of the cardiovascular system allows for quick data collection and analysis. Conserved signaling pathways and orthology to human disease makes zebrafish an excellent model for developmental processes. Zebrafish are a great model organism for cardiovascular development because they can survive up to five days post fertilization without a heartbeat. This resilience allows insight into the intricacies of the cardiovascular system, making them beneficial when compared to other model organisms. Zebrafish are extremely useful as preclinical models, serving as a gateway to test the effectiveness of new therapeutic drugs that could potentially be used to treat symptoms of cardiomyopathy (Patton et al., 2022). Previous studies have shown that homozygous mutant lmod2a -/- zebrafish have irregular heart rhythms and impaired contractility, indicating that lmod2a plays an essential role in thin filament regulation (Ye et al., 2025). However, the role of lmod2b remains uncharacterized. lmod2b is predicted to be involved with actin filament organization, tropomyosin bind activity, muscle contraction, and myofibril assembly in zebrafish.
Using in situ hybridization with the lmod2b RNA probe, we saw cardiac expression at 24 hours post fertilization (hpf) which aligns with this gene's predicted expression patterns. We also saw expression in the skeletal muscle structures which aligns with its predicted role in skeletal muscle contraction. Using CRISPR-Cas9 technology, we created a novel zebrafish model by mutating the lmod2b gene to further our understanding of DCM. We found no significant pericardial edema or abnormalities in the craniofacial structure when comparing the control group to crispants. However, our findings are consistent with a potential role for lmod2b in DCM, as lmod2b crispants had higher heart rates compared to the control group.
Discussion
In situ hybridization was conducted at multiple developmental stages to analyze expression patterns of lmod2b. At 21 somites, lmod2b was expressed in adaxial cells of the somites (Figure 1A). At 24 and 26 hpf, lmod2b was expressed in the myocardial tube (Figure 1B-C). First detection of lmod2b in the myocardial tube at 24 hpf when the heart begins to beat aligns with expression pattern data in avian embryos. At 48 hpf, lmod2b was expressed in both the ventricle and atrium (Figure 1D). At 72 hpf, lmod2b was expressed in the ventricle and craniofacial muscles (Figure 1E). As hypothesized, lmod2b was expressed in the cardiovascular system during early stages of embryonic development, indicating potential importance for early cardiovascular function. Notable expression in the atrium at 48 hpf but not at 72 hpf aligns with changes in atrial morphology. The atrial wall thins by 72 hpf, likely resulting in weaker expression at 72 hpf that may not be detected by in situ hybridization. Expression in the craniofacial muscles indicates involvement in the skeletal muscle system, which supports its predicted roles in contractile function.
Tg(flk:nlsGFP) embryos were injected with a cocktail of four gRNAs and purified Cas9 protein to mutate lmod2b. Alterations at the lmod2b locus were confirmed with PCR amplification of genomic DNA (Figure 1H). We found that there was decreased amplification of the lmod2b gene in crispant DNA, however, there was still some wild-type DNA present, indicating mosaicism. Uninjected control and lmod2b crispant embryos were analyzed daily to check for abnormalities. The overall morphology of the embryo and the heart appeared normal in the crispants (Figure 1F-G), however heart rate analysis revealed abnormalities. Across multiple experiments, the lmod2b crispant zebrafish had higher heart rates than the controls (Figure 1I). Crispants injected with 1 nl gRNA mix had a heart rate average of 108.4 beats per minute compared to the control group, which had an average of 92.8 beats per minute (n= 30 per condition). This indicates that lmod2b gene mutation resulted in tachycardia, which aligns with symptoms of DCM. We did not find notable abnormalities in blood flow or pericardial edema in lmod2b crispants (Figure 1F-G). This mild crispant phenotype aligns the unmutated DNA still present at the molecular level. Based on the heart rate results, we can infer that there may be subtle defects within the structure of the heart that could be revealed with higher resolution analysis.
Moving forward, we will continue investigating heart morphology of lmod2b crispants by conducting MF20 and S46 immunostaining, which mark myosin heavy chains in both chambers and only the atrium, respectively. This could highlight cardiac defects that are not visible under normal stereomicroscopy conditions. Mutation of lmod2a and lmod2b in zebrafish both result in cardiac abnormalities, which suggests that these genes are not functionally redundant, and each plays a specific role in cardiac function. Based on this observation, we will further investigate the genetic networks by conducting a double knockdown of lmod2a/lmod2b. We will analyze the double knockdown crispants to continue understanding the molecular mechanisms of DCM. Creating a stable mutant line in the future will allow us to evaluate any defects that occur through adulthood and calculate survival rate.
","references":[{"reference":"American Heart Association. (2024). Dilated Cardiomyopathy (DCM). https://www.heart.org/en/health-topics/cardiomyopathy/what-is-cardiomyopathy-in-adults/dilated-cardiomyopathy-dcm
","pubmedId":"","doi":""},{"reference":"Cleveland Clinic. (2024). Dilated Cardiomyopathy: Symptoms and Treatment. https://my.clevelandclinic.org/health/diseases/16932-dilated-cardiomyopathy
","pubmedId":"","doi":""},{"reference":"Conley CA, Fritz-Six KL, Almenar-Queralt A, Fowler VM. 2001. Leiomodins: Larger Members of the Tropomodulin (Tmod) Gene Family. Genomics 73: 127-139.
","pubmedId":"","doi":"10.1006/geno.2000.6501"},{"reference":"Jordan E, Peterson L, Ai T, Asatryan B, Bronicki L, Brown E, et al., Hershberger. 2021. Evidence-Based Assessment of Genes in Dilated Cardiomyopathy. Circulation 144: 7-19.
","pubmedId":"","doi":"10.1161/CIRCULATIONAHA.120.053033"},{"reference":"Oxtoby E, Jowett T. 1993. Cloning of the zebrafishkrox-20gene (krx-20) and its expression during hindbrain development. Nucleic Acids Research 21: 1087-1095.
","pubmedId":"","doi":"10.1093/nar/21.5.1087"},{"reference":"Pappas CT, Mayfield RM, Dickerson AE, Mi-Mi L, Gregorio CC. 2024. Human disease-causing mutations result in loss of leiomodin 2 through nonsense-mediated mRNA decay. PLOS Genetics 20: e1011279.
","pubmedId":"","doi":"10.1371/journal.pgen.1011279"},{"reference":"Pappas CT, Mayfield RM, Henderson C, Jamilpour N, Cover C, Hernandez Z, et al., Gregorio. 2015. Knockout of Lmod2 results in shorter thin filaments followed by dilated cardiomyopathy and juvenile lethality. Proceedings of the National Academy of Sciences 112: 13573-13578.
","pubmedId":"","doi":"10.1073/pnas.1508273112"},{"reference":"Patton EE, Zon LI, Langenau DM. 2021. Zebrafish disease models in drug discovery: from preclinical modelling to clinical trials. Nature Reviews Drug Discovery 20: 611-628.
","pubmedId":"","doi":"10.1038/s41573-021-00210-8"},{"reference":"Schumacher JA, Wright ZA, Owen ML, Bredemeier NO, Sumanas S. 2020. Integrin α5 and Integrin α4 cooperate to promote endocardial differentiation and heart morphogenesis. Developmental Biology 465: 46-57.
","pubmedId":"","doi":"10.1016/j.ydbio.2020.06.006"},{"reference":"Shoureshi P, Tan AY, Koneru J, Ellenbogen KA, Kaszala K, Huizar JF. 2024. Arrhythmia-Induced Cardiomyopathy. Journal of the American College of Cardiology 83: 2214-2232.
","pubmedId":"","doi":"10.1016/j.jacc.2024.03.416"},{"reference":"Tsukada T, Pappas CT, Moroz N, Antin PB, Kostyukova AS, Gregorio CC. 2010. Leiomodin-2 is an antagonist of tropomodulin-1 at the pointed end of the thin filaments in cardiac muscle. Journal of Cell Science 123: 3136-3145.
","pubmedId":"","doi":"10.1242/jcs.071837"},{"reference":"Wu RS, Lam II, Clay H, Duong DN, Deo RC, Coughlin SR. 2018. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Developmental Cell 46: 112-125.e4.
","pubmedId":"","doi":"10.1016/j.devcel.2018.06.003"},{"reference":"Wu T, Mu Y, Bogomolovas J, Fang X, Veevers J, Nowak RB, et al., Chen. 2017. HSPB7 is indispensable for heart development by modulating actin filament assembly. Proceedings of the National Academy of Sciences 114: 11956-11961.
","pubmedId":"","doi":"10.1073/pnas.1713763114"},{"reference":"Ye X, Jia H, Zu Y. 2025. lmod2a mutations affect F-actin and SRF pathway leading to cardiac dysfunction in zebrafish. Developmental Biology 525: 306-316.
","pubmedId":"","doi":"10.1016/j.ydbio.2025.06.002"}],"title":"Novel leiomodin 2b crispant zebrafish as a model for dilated cardiomyopathy
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":"1780958792689"}]},{"id":"6ec4ae53-7985-4214-b58c-029bc2a3b85e","decision":"revise","abstract":"Congenital heart disease (CHD) is highly prevalent in live births and requires concise diagnoses and treatment plans. Although there is a vast amount of genetics research in the field of CHD, there are still knowledge gaps regarding the gene networks surrounding heart development. A literature review revealed that mutation in Leiomodin 2 is associated with dilated cardiomyopathy in humans. We selected lmod2b for further molecular analysis. In situ hybridization was conducted throughout zebrafish embryonic development to investigate the expression pattern of lmod2b. To further understand the function of lmod2b, CRISPR-Cas9 gene editing was conducted to look for cardiac abnormalities.
","acknowledgements":"We thank the staff of Miami University Laboratory Animal Resources for animal care and Miami University Center for Bioinformatics and Functional Genomics for sequencing analysis. We thank Mason Posner for CRISPR methodology assistance, Joshua Waxman and Kendall Martin for productive discussion.
","authors":[{"affiliations":["Miami University"],"departments":["Department of Biology"],"credit":["formalAnalysis","conceptualization","dataCuration","methodology","writing_originalDraft","writing_reviewEditing","investigation","fundingAcquisition"],"email":"skylie28antle@gmail.com","firstName":"Skylie J","lastName":"Antle","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Miami University "],"departments":["Department of Biological Sciences "],"credit":["conceptualization","dataCuration","project","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing","methodology"],"email":"schumaj@miamioh.edu","firstName":"Jennifer A","lastName":"Schumacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"Undergraduate Summer Scholars","funderName":"Miami University (United States)","awardRecipient":"Skylie Antle"},{"awardId":"Start Up Funds","funderName":"Miami University (United States)","awardRecipient":"Jennifer Schumacher"}],"conflictsOfInterest":"The authors declare that Joshua Waxman as a conflict of interest.
","dataTable":{"url":null},"extendedData":[],"funding":"Miami University Undergraduate Summer Scholars, Miami University Start Up Funds
","image":{"url":"https://portal.micropublication.org/uploads/e1974e8adc4fd27e386c98566d5c8f2d.jpg"},"imageCaption":"(A-E) shows in situ hybridization expression of lmod2b at multiple developmental stages. (A) 21 somites embryo (9/9). Arrowheads indicate adaxial cell expression. (B) 24 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (C) 26 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (D) 48 hpf embryo (10/10). Arrowheads indicate atrium and ventricle expression. (E) 72 hpf larva (11/11). Black arrowheads indicate ventricle expression. White arrowhead indicates craniofacial muscle expression. (F) Control larva at 5 dpf. (G) lmod2b-KO crispant at 5 days post fertilization. (H) Gel electrophoresis for PCR amplification of itga4, and lmod2b in exon and 1 exon 2. Lanes 3 and 4 indicate itga4 controls for uncut genomic regions. Lanes 5 and 6 indicate exon 1 of the genomic region. Lanes 7 and 8 indicate exon 2 of the genomic region. As seen in lanes 6 and 8, crispants showed decreased intensity of bands, showing mosaic gene editing. Arrowhead in lane 8 shows heteroduplex. (I) Heart rate quantification for control and crispant embryos at 4 days post fertilization. Crispants were injected at the 1-cell stage with 1 nl of gRNA cocktail (n= 30 per condition). **** indicates p < 0.0001.
","imageTitle":"Expression pattern of lmod2b, heart rate analysis in lmod2b crispants, and CRISPR conformation gel electrophoresis
","methods":"RNA probe synthesis: Total RNA was extracted and purified from 96 hpf wildtype zebrafish embryos. Reverse transcription using Superscript IV (Invitrogen) was then used to create cDNA. Forward and reverse primers were designed to amplify a 957 base pair (nucleotides 281-1237) section of the lmod2b coding sequence. PCR product was obtained for cloning with TOPO technology. Directionality of insertion was determined by Sanger sequencing. Plasmid linearization for probe synthesis was conducted using NotI restriction enzyme. SP6 RNA polymerase was used for in-vitro transcription. Digoxigenin labeled antisense RNA probe was precipitated and stored at -80°C.
In situ Hybridization: Zebrafish embryos were fixed at 21 somites, 24 hpf, 26 hpf, 48 hpf, and 72 hpf. Whole mount in situ hybridization was conducted at each developmental stage using lmod2b antisense RNA probe as previously described (Oxtoby & Jowett, 1993). Proteinase K treatment (10 mg/ml) was performed for 5 to 25 minutes at room temperature, depending on the stage examined. Samples were incubated in pre-hybridization solution for 2 hours at 65°C, followed by incubation with antisense RNA probes in hybridization solution at 65°C overnight. Pre-hyb/SSC wash series was completed at 65°C in 15 minute increments. Samples were placed in 5% sheep serum blocking solution for 1 hour at room temperature followed by Anti-Digoxigenin-AP Fab fragments antibody solution (1:5000) overnight at 4 °C. Staining was conducted with NBT/BCIP at room temperature until signal was visible. Samples were transferred to 80% glycerol for imaging with a Zeiss SteREO Discovery.V8 microscope equipped with a Zeiss Axiocam 506 color camera.
gRNA synthesis and CRISPR analysis: Oligonucleotide sequences were designed based on Wu et al. (2018) Genome-Scale Lookup Table for Four-Guide Sets. CRISPR sequences selected from this article include: GCGTTCTGGGATCCTTCGAG (PAM site TGG), AGGATTGGATCTACAAGCCC (PAM site AGG), GTACCTCATCAGCCACCGTG (PAM site GGG), and GGGTTGTCATGCTTATACGT (PAM site GGG). PCR products were obtained and purified. lmod2b gRNA was synthesized using T7 polymerase. A 1:2 ratio of purified gRNA to Cas9 protein was used to create the injection mix. The final concentration of Cas9 was 500 ng/ul and the final concentration of gRNA was 250 ng/ul. We injected 1 nl into 1-cell Tg(kdrl:NLS-EGFP)zf109 zebrafish embryos. Embryos were incubated at 28.6°C until heart analysis at 4 days post fertilization (dpf). For heart rate quantification, randomly selected larvae were individually transferred in a minimal amount of liquid into a depression slide containing 160 mg/mL tricaine stock solution. The larva was then incubated for 1 minute before measuring heart rate. Heart rate was quantified visually using a stereomicroscope by counting beats with a tally counter for 15 seconds and multiplying by 4 to be recorded in beats per minute. Each larva was incubated individually in fresh tricaine solution for 1 minute before HR was counted to ensure consistent anesthetic treatment across all samples. Based on experimental set up, the investigator was not blinded to experimental conditions. Analysis of control and crispant embryos was replicated 3 times with n=10 per condition for each trial.
CRISPR confirmation: To confirm editing of the lmod2b locus on the molecular level, genomic DNA was extracted from control and crispant embryos at 24 hpf. Zebrafish were anesthetized with tricaine and sorted into PCR tubes. To extract DNA, lysis buffer was prepared with 10 mM Tris HCl pH 7.5, 50 mM KCl, 0.3% Tween-20, 0.3% NP-40, and 1 mM EDTA pH 8. Lysis buffer was added and embryos were incubated for 10 minutes at 95° C. Proteinase K treatment (2 µg/ml) was performed at 55° C for 12 hours followed by enzyme inactivation at 95° C for 10 minutes. After lysate was obtained, genomic DNA was amplified using PCR. Primer pairs based on guide RNA sites were designed for PCR in CHOPCHOP. Primer pair 1 amplified across the genomic region spanning exon 1, where gRNAs 1 and 2 cut (nucleotides 185,713-186,255). Primer pair 2 amplified the genomic region spanning exon 2, where gRNAs 3 and 4 cut (nucleotides 184,171-184,821). Primers for itga4 gene were used as a control for an uncut region of the genome (Schumacher et al., 2020). itga4 is on chromosome 9 whereas lmod2b is on chromosome 4, ensuring there would be no CRISPR cleavage at this site. Gene mutation was confirmed using gel electrophoresis on a 1.5% agarose gel.
","reagents":"Integrated DNA Technologies: Oligonucleotides
Invitrogen: Superscript IV Reverse Transcriptase Kit
Millipore Sigma: Anti-Digoxigenin-AP Fab fragments
New England Biolabs: PCR & DNA Cleanup Kit
New England Biolabs: HighScribe T7 kit
New England Biolabs: RNA clean up kit
New England Biolabs: Taq DNA polymerase
New England Biolabs: NotI restriction endonuclease
PNA Bio: Cas9 Protein
QIAGEN: QIAprep Spin Miniprep Kit
ThermoFisher Scientific: TOPO TA cloning kit
ThermoFisher Scientific: One Shot TOP10 chemically competent E. Coli
","patternDescription":"Dilated cardiomyopathy (DCM) affects about 0.00036% of individuals, and more than 50% of cases have underlying genetic factors (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). In the United States, DCM causes 10,000 deaths and 46,000 hospitalizations annually. However, these statistics may be underestimated due to some patients being asymptomatic. DCM causes weakened heart muscle due to abnormally large chambers of the heart, commonly starting in the left ventricle but can spread to the right ventricle then the atria in severe cases. The myocardium stretches thin, causing it to be weakened (American Heart Association, 2024). Left ventricular dysfunction causes blood to remain in the heart after each contraction, so the heart must compensate to ensure blood flow to the rest of the body. This leads to an overall higher heart rate (HR), known as tachycardia (Shoureshi et al., 2024). Patients often present with chest pain, dizziness or fainting, fatigue, heart palpitations, and dyspnea. These symptoms are manageable if detected early and properly treated (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). A vast number of studies relating to cardiomyopathy have been conducted, however the genetic basis of this condition is still unclear. LMOD2 is a causal gene of DCM but is less characterized than other DCM causal genes such as BAG3, DES, FLNC, LNMA, MYH7, PLN, RBM20, SCN5A, TNNC1, TNNT2, and TTN (Jordan et al., 2021). Mutations in LMOD2 that lead to impaired protein production can cause early-onset DCM that is fatal without proper medical intervention (Pappas et al., 2024).
Leiomodin gene family members are expressed in skeletal, smooth and cardiac muscle in adults, as well as during the fetal period (Conley et al., 2001). However, leiomodin 2 (Lmod2) is limited to cardiac and skeletal muscle (Tsukada et al., 2010). These striated muscles use sarcomeres to contract, which requires proper organization of actin and myosin filaments. Lmod2 is an actin nucleator, catalyzing the formation of new actin filaments. Lmod2 is necessary for regulating the length of thin filaments of cardiac muscle (Wu et al., 2017), which is crucial for maintaining the structure of sarcomeres, allowing for proper contractile function. When Lmod2 function is disrupted, abnormalities in thin filament structure can result in reduced cardiac muscle function (Wu et al., 2017).
In avian embryos, LMOD2 transcripts are expressed after the heart begins beating (Hamburger-Hamilton stage 14), indicating it is not the first actin nucleator involved in thin filament assembly (Tsukada et al., 2010). Overexpression of mCherry-Lmod2 in avian cardiomyocytes resulted in disorganized sarcomere structure and overextension of thin filaments, interfering with the typical striated patterns. In mouse embryos, Lmod2 transcripts are expressed in the heart at embryonic day 8.5, and in the somites at embryonic day 9.5 (Pappas et al., 2015). Lmod2 knockout (KO) mouse models were found to have abnormal cardiac contractility, shortened actin-thin filaments, and irregular calcium handling. Lmod2 knockout resulted in fatal neonatal DCM causing mice to die between 15 and 33 days after DCM onset. When Lmod2 was restored in Lmod2-KO mice at postnatal day 4, before heart defects were detected, thin filament length increased, nearly reaching normal levels (Pappas et al., 2015).
We use zebrafish as a model for cardiac development, as they lay large amounts of transparent embryos that allow for analysis of internal organs. Zebrafish have two-chambered hearts that begin beating at 24 hours post fertilization (hpf), shortly followed by blood flow. The simplicity of the two-chambered heart with rapid development of the cardiovascular system allows for quick data collection and analysis. Conserved signaling pathways and orthology to human disease makes zebrafish an excellent model for developmental processes. Zebrafish are a great model organism for cardiovascular development because they can survive up to five days post fertilization without a heartbeat. This resilience allows insight into the intricacies of the cardiovascular system, making them beneficial when compared to other model organisms. Zebrafish are extremely useful as preclinical models, serving as a gateway to test the effectiveness of new therapeutic drugs that could potentially be used to treat symptoms of cardiomyopathy (Patton et al., 2022). Previous studies have shown that homozygous mutant lmod2a -/- zebrafish have irregular heart rhythms and impaired contractility, indicating that lmod2a plays an essential role in thin filament regulation (Ye et al., 2025). However, the role of lmod2b remains uncharacterized. lmod2b is predicted to be involved with actin filament organization, tropomyosin bind activity, muscle contraction, and myofibril assembly in zebrafish.
Using in situ hybridization with the lmod2b RNA probe, we saw cardiac expression at 24 hours post fertilization (hpf) which aligns with this gene's predicted expression patterns. We also saw expression in the skeletal muscle structures which aligns with its predicted role in skeletal muscle contraction. Using CRISPR-Cas9 technology, we created a novel zebrafish model by mutating the lmod2b gene to further our understanding of DCM. We found no significant pericardial edema or abnormalities in the craniofacial structure when comparing the control group to crispants. However, our findings are consistent with a potential role for lmod2b in DCM, as lmod2b crispants had higher heart rates compared to the control group.
Discussion
In situ hybridization was conducted at multiple developmental stages to analyze expression patterns of lmod2b. At 21 somites, lmod2b was expressed in adaxial cells of the somites (Figure 1A). At 24 and 26 hpf, lmod2b was expressed in the myocardial tube (Figure 1B-C). First detection of lmod2b in the myocardial tube at 24 hpf when the heart begins to beat aligns with expression pattern data in avian embryos. At 48 hpf, lmod2b was expressed in both the ventricle and atrium (Figure 1D). At 72 hpf, lmod2b was expressed in the ventricle and craniofacial muscles (Figure 1E). As hypothesized, lmod2b was expressed in the cardiovascular system during early stages of embryonic development, indicating potential importance for early cardiovascular function. Notable expression in the atrium at 48 hpf but not at 72 hpf aligns with changes in atrial morphology. The atrial wall thins by 72 hpf, likely resulting in weaker expression at 72 hpf that may not be detected by in situ hybridization. Expression in the craniofacial muscles indicates involvement in the skeletal muscle system, which supports its predicted roles in contractile function.
Tg(kdrl:NLS-EGFP)zf109 embryos were injected with a cocktail of four gRNAs and purified Cas9 protein to mutate lmod2b (Blum et al., 2008). Alterations at the lmod2b locus were confirmed with PCR amplification of genomic DNA (Figure 1H). We found that there was decreased amplification of the lmod2b gene in crispant DNA, however, there was still some wild-type DNA present, indicating mosaicism. Uninjected control and lmod2b crispant embryos were analyzed daily to check for abnormalities. The overall morphology of the embryo and the heart appeared normal in the crispants (Figure 1F-G), however heart rate analysis revealed abnormalities. Across multiple experiments, the lmod2b crispant zebrafish had higher heart rates than the controls (Figure 1I). Crispants injected with 1 nl gRNA mix had a heart rate average of 108.4 beats per minute compared to the control group, which had an average of 92.8 beats per minute (n= 30 per condition). This indicates that lmod2b gene mutation resulted in tachycardia, which aligns with symptoms of DCM. We did not find notable abnormalities in blood flow or pericardial edema in lmod2b crispants (Figure 1F-G). This mild crispant phenotype aligns the unmutated DNA still present at the molecular level. Based on the heart rate results, we can infer that there may be subtle defects within the structure of the heart that could be revealed with higher resolution analysis.
\tMoving forward, we will continue investigating heart morphology of lmod2b crispants by conducting MF20 and S46 immunostaining, which mark myosin heavy chains in both chambers and only the atrium, respectively. This could highlight cardiac defects that are not visible under normal stereomicroscopy conditions. Mutation of lmod2a and lmod2b in zebrafish both result in cardiac abnormalities, which suggests that these genes are not functionally redundant, and each plays a specific role in cardiac function. Based on this observation, we will further investigate the genetic networks by conducting a double knockdown of lmod2a/lmod2b. We will analyze the double knockdown crispants to continue understanding the molecular mechanisms of DCM. Creating a stable mutant line in the future will allow us to evaluate any defects that occur through adulthood and calculate survival rate.
","references":[{"reference":"American Heart Association. (2024). Dilated Cardiomyopathy (DCM). https://www.heart.org/en/health-topics/cardiomyopathy/what-is-cardiomyopathy-in-adults/dilated-cardiomyopathy-dcm
","pubmedId":"","doi":""},{"reference":"Blum Y, Belting HG, Ellertsdottir E, Herwig L, Lüders F, Affolter M. 2008. Complex cell rearrangements during intersegmental vessel sprouting and vessel fusion in the zebrafish embryo. Developmental Biology 316: 312-322.
","pubmedId":"","doi":"doi.org/10.1016/j.ydbio.2008.01.038"},{"reference":"Cleveland Clinic. (2024). Dilated Cardiomyopathy: Symptoms and Treatment. https://my.clevelandclinic.org/health/diseases/16932-dilated-cardiomyopathy
","pubmedId":"","doi":""},{"reference":"Conley CA, Fritz-Six KL, Almenar-Queralt A, Fowler VM. 2001. Leiomodins: Larger Members of the Tropomodulin (Tmod) Gene Family. Genomics 73: 127-139.
","pubmedId":"","doi":"10.1006/geno.2000.6501"},{"reference":"Jordan E, Peterson L, Ai T, Asatryan B, Bronicki L, Brown E, et al., Hershberger. 2021. Evidence-Based Assessment of Genes in Dilated Cardiomyopathy. Circulation 144: 7-19.
","pubmedId":"","doi":"10.1161/CIRCULATIONAHA.120.053033"},{"reference":"Oxtoby E, Jowett T. 1993. Cloning of the zebrafishkrox-20gene (krx-20) and its expression during hindbrain development. Nucleic Acids Research 21: 1087-1095.
","pubmedId":"","doi":"10.1093/nar/21.5.1087"},{"reference":"Pappas CT, Mayfield RM, Dickerson AE, Mi-Mi L, Gregorio CC. 2024. Human disease-causing mutations result in loss of leiomodin 2 through nonsense-mediated mRNA decay. PLOS Genetics 20: e1011279.
","pubmedId":"","doi":"10.1371/journal.pgen.1011279"},{"reference":"Pappas CT, Mayfield RM, Henderson C, Jamilpour N, Cover C, Hernandez Z, et al., Gregorio. 2015. Knockout of Lmod2 results in shorter thin filaments followed by dilated cardiomyopathy and juvenile lethality. Proceedings of the National Academy of Sciences 112: 13573-13578.
","pubmedId":"","doi":"10.1073/pnas.1508273112"},{"reference":"Patton EE, Zon LI, Langenau DM. 2021. Zebrafish disease models in drug discovery: from preclinical modelling to clinical trials. Nature Reviews Drug Discovery 20: 611-628.
","pubmedId":"","doi":"10.1038/s41573-021-00210-8"},{"reference":"Schumacher JA, Wright ZA, Owen ML, Bredemeier NO, Sumanas S. 2020. Integrin α5 and Integrin α4 cooperate to promote endocardial differentiation and heart morphogenesis. Developmental Biology 465: 46-57.
","pubmedId":"","doi":"10.1016/j.ydbio.2020.06.006"},{"reference":"Shoureshi P, Tan AY, Koneru J, Ellenbogen KA, Kaszala K, Huizar JF. 2024. Arrhythmia-Induced Cardiomyopathy. Journal of the American College of Cardiology 83: 2214-2232.
","pubmedId":"","doi":"10.1016/j.jacc.2024.03.416"},{"reference":"Tsukada T, Pappas CT, Moroz N, Antin PB, Kostyukova AS, Gregorio CC. 2010. Leiomodin-2 is an antagonist of tropomodulin-1 at the pointed end of the thin filaments in cardiac muscle. Journal of Cell Science 123: 3136-3145.
","pubmedId":"","doi":"10.1242/jcs.071837"},{"reference":"Wu RS, Lam II, Clay H, Duong DN, Deo RC, Coughlin SR. 2018. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Developmental Cell 46: 112-125.e4.
","pubmedId":"","doi":"10.1016/j.devcel.2018.06.003"},{"reference":"Wu T, Mu Y, Bogomolovas J, Fang X, Veevers J, Nowak RB, et al., Chen. 2017. HSPB7 is indispensable for heart development by modulating actin filament assembly. Proceedings of the National Academy of Sciences 114: 11956-11961.
","pubmedId":"","doi":"10.1073/pnas.1713763114"},{"reference":"Ye X, Jia H, Zu Y. 2025. lmod2a mutations affect F-actin and SRF pathway leading to cardiac dysfunction in zebrafish. Developmental Biology 525: 306-316.
","pubmedId":"","doi":"10.1016/j.ydbio.2025.06.002"}],"title":"Novel leiomodin 2b crispant zebrafish as a model for dilated cardiomyopathy
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":"1781191877840"}]},{"id":"39e60cbf-9bd1-412f-a80e-c1922a36eb92","decision":"edit","abstract":"Congenital heart disease (CHD) is highly prevalent in live births and requires concise diagnoses and treatment plans. Although there is a vast amount of genetics research in the field of CHD, there are still knowledge gaps regarding the gene networks surrounding heart development. A literature review revealed that mutation in Leiomodin 2 is associated with dilated cardiomyopathy in humans. We selected lmod2b for further molecular analysis. In situ hybridization was conducted throughout zebrafish embryonic development to investigate the expression pattern of lmod2b. To further understand the function of lmod2b, CRISPR-Cas9 gene editing was conducted to look for cardiac abnormalities.
","acknowledgements":"We thank the staff of Miami University Laboratory Animal Resources for animal care and Miami University Center for Bioinformatics and Functional Genomics for sequencing analysis. We thank Mason Posner for CRISPR methodology assistance, Joshua Waxman and Kendall Martin for productive discussion.
","authors":[{"affiliations":["Miami University"],"departments":["Department of Biology"],"credit":["formalAnalysis","conceptualization","dataCuration","methodology","writing_originalDraft","writing_reviewEditing","investigation","fundingAcquisition"],"email":"skylie28antle@gmail.com","firstName":"Skylie J","lastName":"Antle","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Miami University "],"departments":["Department of Biological Sciences "],"credit":["conceptualization","dataCuration","project","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing","methodology"],"email":"schumaj@miamioh.edu","firstName":"Jennifer A","lastName":"Schumacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"Undergraduate Summer Scholars","funderName":"Miami University (United States)","awardRecipient":"Skylie Antle"},{"awardId":"Start Up Funds","funderName":"Miami University (United States)","awardRecipient":"Jennifer Schumacher"}],"conflictsOfInterest":"The authors declare that Joshua Waxman as a conflict of interest.
","dataTable":{"url":null},"extendedData":[],"funding":"Miami University Undergraduate Summer Scholars, Miami University Start Up Funds
","image":{"url":"https://portal.micropublication.org/uploads/e1974e8adc4fd27e386c98566d5c8f2d.jpg"},"imageCaption":"(A-E) shows in situ hybridization expression of lmod2b at multiple developmental stages. (A) 21 somites embryo (9/9). Arrowheads indicate adaxial cell expression. (B) 24 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (C) 26 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (D) 48 hpf embryo (10/10). Arrowheads indicate atrium and ventricle expression. (E) 72 hpf larva (11/11). Black arrowheads indicate ventricle expression. White arrowhead indicates craniofacial muscle expression. (F) Control larva at 5 dpf. (G) lmod2b-KO crispant at 5 days post fertilization. (H) Gel electrophoresis for PCR amplification of itga4, and lmod2b in exon and 1 exon 2. Lanes 3 and 4 indicate itga4 controls for uncut genomic regions. Lanes 5 and 6 indicate exon 1 of the genomic region. Lanes 7 and 8 indicate exon 2 of the genomic region. As seen in lanes 6 and 8, crispants showed decreased intensity of bands, showing mosaic gene editing. Arrowhead in lane 8 shows heteroduplex. (I) Heart rate quantification for control and crispant embryos at 4 days post fertilization. Crispants were injected at the 1-cell stage with 1 nl of gRNA cocktail (n= 30 per condition). **** indicates p < 0.0001.
","imageTitle":"Expression pattern of lmod2b, heart rate analysis in lmod2b crispants, and CRISPR conformation gel electrophoresis
","methods":"RNA probe synthesis: Total RNA was extracted and purified from 96 hpf wildtype zebrafish embryos. Reverse transcription using Superscript IV (Invitrogen) was then used to create cDNA. Forward and reverse primers were designed to amplify a 957 base pair (nucleotides 281-1237) section of the lmod2b coding sequence. Primer pair used is as follows: forward primer sequence 5’-CTCCACCGGTACATTCAGT-3’ and reverse primer sequence 5’-CTTGATTGCGGGTGAGAAGG-3’. PCR product was obtained for cloning with TOPO technology. Directionality of insertion was determined by Sanger sequencing. Plasmid linearization for probe synthesis was conducted using NotI restriction enzyme. SP6 RNA polymerase was used for in-vitro transcription. Digoxigenin labeled antisense RNA probe was precipitated and stored at -80°C.
In situ Hybridization: Zebrafish embryos were fixed at 21 somites, 24 hpf, 26 hpf, 48 hpf, and 72 hpf. Whole mount in situ hybridization was conducted at each developmental stage using lmod2b antisense RNA probe as previously described (Oxtoby & Jowett, 1993). Proteinase K treatment (10 mg/ml) was performed for 5 to 25 minutes at room temperature, depending on the stage examined. Samples were incubated in pre-hybridization solution for 2 hours at 65°C, followed by incubation with antisense RNA probes in hybridization solution at 65°C overnight. Pre-hyb/SSC wash series was completed at 65°C in 15 minute increments. Samples were placed in 5% sheep serum blocking solution for 1 hour at room temperature followed by Anti-Digoxigenin-AP Fab fragments antibody solution (1:5000) overnight at 4 °C. Staining was conducted with NBT/BCIP at room temperature until signal was visible. Samples were transferred to 80% glycerol for imaging with a Zeiss SteREO Discovery.V8 microscope equipped with a Zeiss Axiocam 506 color camera.
gRNA synthesis and CRISPR analysis: Oligonucleotide sequences were designed based on Wu et al. (2018) Genome-Scale Lookup Table for Four-Guide Sets. CRISPR sequences selected from this article include: GCGTTCTGGGATCCTTCGAG (PAM site TGG), AGGATTGGATCTACAAGCCC (PAM site AGG), GTACCTCATCAGCCACCGTG (PAM site GGG), and GGGTTGTCATGCTTATACGT (PAM site GGG). PCR products were obtained and purified. lmod2b gRNA was synthesized using T7 polymerase. A 1:2 ratio of purified gRNA to Cas9 protein was used to create the injection mix. The final concentration of Cas9 was 500 ng/ul and the final concentration of gRNA was 250 ng/ul. We injected 1 nl into 1-cell Tg(kdrl:NLS-EGFP)ubs1Tg zebrafish embryos. Embryos were incubated at 28.6°C until heart analysis at 4 days post fertilization (dpf). For heart rate quantification, randomly selected larvae were individually transferred in a minimal amount of liquid into a depression slide containing 160 mg/mL tricaine stock solution. The larva was then incubated for 1 minute before measuring heart rate. Heart rate was quantified visually using a stereomicroscope by counting beats with a tally counter for 15 seconds and multiplying by 4 to be recorded in beats per minute. Each larva was incubated individually in fresh tricaine solution for 1 minute before HR was counted to ensure consistent anesthetic treatment across all samples. Based on experimental set up, the investigator was not blinded to experimental conditions. Analysis of control and crispant embryos was replicated 3 times with n=10 per condition for each trial.
CRISPR confirmation: To confirm editing of the lmod2b locus on the molecular level, genomic DNA was extracted from control and crispant embryos at 24 hpf. Zebrafish were anesthetized with tricaine and sorted into PCR tubes. To extract DNA, lysis buffer was prepared with 10 mM Tris HCl pH 7.5, 50 mM KCl, 0.3% Tween-20, 0.3% NP-40, and 1 mM EDTA pH 8. Lysis buffer was added and embryos were incubated for 10 minutes at 95° C. Proteinase K treatment (2 µg/ml) was performed at 55° C for 12 hours followed by enzyme inactivation at 95° C for 10 minutes. After lysate was obtained, genomic DNA was amplified using PCR. Primer pairs based on guide RNA sites were designed for PCR in CHOPCHOP. Primer pair one included forward primer sequence 5’-TTTTGCAGCTCTTTCTGATTGA-3’ and reverse primer sequence 5’-TTTTCTGACACCATTGGAAGTG-3’. Primer pair 1 amplified across the genomic region spanning exon 1, where gRNAs 1 and 2 cut (nucleotides 185,713-186,255). Primer pair two included forward primer sequence 5’-AAAGGCAGATAGGTGAACCAAA-3’ and reverse primer sequence 5’-AGCTGTGAGGAGAAGAAGTGCT-3’. Primer pair 2 amplified the genomic region spanning exon 2, where gRNAs 3 and 4 cut (nucleotides 184,171-184,821). Primers for itga4 gene were used as a control for an uncut region of the genome (Schumacher et al., 2020). itga4 is on chromosome 9 whereas lmod2b is on chromosome 4, ensuring there would be no CRISPR cleavage at this site. Gene mutation was confirmed using gel electrophoresis on a 1.5% agarose gel.
","reagents":"Integrated DNA Technologies: Oligonucleotides
Invitrogen: Superscript IV Reverse Transcriptase Kit
Millipore Sigma: Anti-Digoxigenin-AP Fab fragments
New England Biolabs: PCR & DNA Cleanup Kit
New England Biolabs: HighScribe T7 kit
New England Biolabs: RNA clean up kit
New England Biolabs: Taq DNA polymerase
New England Biolabs: NotI restriction endonuclease
PNA Bio: Cas9 Protein
QIAGEN: QIAprep Spin Miniprep Kit
ThermoFisher Scientific: TOPO TA cloning kit
ThermoFisher Scientific: One Shot TOP10 chemically competent E. Coli
","patternDescription":"Dilated cardiomyopathy (DCM) affects about 0.00036% of individuals, and more than 50% of cases have underlying genetic factors (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). In the United States, DCM causes 10,000 deaths and 46,000 hospitalizations annually. However, these statistics may be underestimated due to some patients being asymptomatic. DCM causes weakened heart muscle due to abnormally large chambers of the heart, commonly starting in the left ventricle but can spread to the right ventricle then the atria in severe cases. The myocardium stretches thin, causing it to be weakened (American Heart Association, 2024). Left ventricular dysfunction causes blood to remain in the heart after each contraction, so the heart must compensate to ensure blood flow to the rest of the body. This leads to an overall higher heart rate (HR), known as tachycardia (Shoureshi et al., 2024). Patients often present with chest pain, dizziness or fainting, fatigue, heart palpitations, and dyspnea. These symptoms are manageable if detected early and properly treated (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). A vast number of studies relating to cardiomyopathy have been conducted, however the genetic basis of this condition is still unclear. LMOD2 is a causal gene of DCM but is less characterized than other DCM causal genes such as BAG3, DES, FLNC, LNMA, MYH7, PLN, RBM20, SCN5A, TNNC1, TNNT2, and TTN (Jordan et al., 2021). Mutations in LMOD2 that lead to impaired protein production can cause early-onset DCM that is fatal without proper medical intervention (Pappas et al., 2024).
Leiomodin gene family members are expressed in skeletal, smooth and cardiac muscle in adults, as well as during the fetal period (Conley et al., 2001). However, leiomodin 2 (Lmod2) is limited to cardiac and skeletal muscle (Tsukada et al., 2010). These striated muscles use sarcomeres to contract, which requires proper organization of actin and myosin filaments. Lmod2 is an actin nucleator, catalyzing the formation of new actin filaments. Lmod2 is necessary for regulating the length of thin filaments of cardiac muscle (Wu et al., 2017), which is crucial for maintaining the structure of sarcomeres, allowing for proper contractile function. When Lmod2 function is disrupted, abnormalities in thin filament structure can result in reduced cardiac muscle function (Wu et al., 2017).
In avian embryos, LMOD2 transcripts are expressed after the heart begins beating (Hamburger-Hamilton stage 14), indicating it is not the first actin nucleator involved in thin filament assembly (Tsukada et al., 2010). Overexpression of mCherry-Lmod2 in avian cardiomyocytes resulted in disorganized sarcomere structure and overextension of thin filaments, interfering with the typical striated patterns. In mouse embryos, Lmod2 transcripts are expressed in the heart at embryonic day 8.5, and in the somites at embryonic day 9.5 (Pappas et al., 2015). Lmod2 knockout (KO) mouse models were found to have abnormal cardiac contractility, shortened actin-thin filaments, and irregular calcium handling. Lmod2 knockout resulted in fatal neonatal DCM causing mice to die between 15 and 33 days after DCM onset. When Lmod2 was restored in Lmod2-KO mice at postnatal day 4, before heart defects were detected, thin filament length increased, nearly reaching normal levels (Pappas et al., 2015).
We use zebrafish as a model for cardiac development, as they lay large amounts of transparent embryos that allow for analysis of internal organs. Zebrafish have two-chambered hearts that begin beating at 24 hours post fertilization (hpf), shortly followed by blood flow. The simplicity of the two-chambered heart with rapid development of the cardiovascular system allows for quick data collection and analysis. Conserved signaling pathways and orthology to human disease makes zebrafish an excellent model for developmental processes. Zebrafish are a great model organism for cardiovascular development because they can survive up to five days post fertilization without a heartbeat. This resilience allows insight into the intricacies of the cardiovascular system, making them beneficial when compared to other model organisms. Zebrafish are extremely useful as preclinical models, serving as a gateway to test the effectiveness of new therapeutic drugs that could potentially be used to treat symptoms of cardiomyopathy (Patton et al., 2022). Previous studies have shown that homozygous mutant lmod2a -/- zebrafish have irregular heart rhythms and impaired contractility, indicating that lmod2a plays an essential role in thin filament regulation (Ye et al., 2025). However, the role of lmod2b remains uncharacterized. lmod2b is predicted to be involved with actin filament organization, tropomyosin bind activity, muscle contraction, and myofibril assembly in zebrafish.
Using in situ hybridization with the lmod2b RNA probe, we saw cardiac expression at 24 hours post fertilization (hpf) which aligns with this gene's predicted expression patterns. We also saw expression in the skeletal muscle structures which aligns with its predicted role in skeletal muscle contraction. Using CRISPR-Cas9 technology, we created a novel zebrafish model by mutating the lmod2b gene to further our understanding of DCM. We found no significant pericardial edema or abnormalities in the craniofacial structure when comparing the control group to crispants. However, our findings are consistent with a potential role for lmod2b in DCM, as lmod2b crispants had higher heart rates compared to the control group.
Discussion
In situ hybridization was conducted at multiple developmental stages to analyze expression patterns of lmod2b. At 21 somites, lmod2b was expressed in adaxial cells of the somites (Figure 1A). At 24 and 26 hpf, lmod2b was expressed in the myocardial tube (Figure 1B-C). First detection of lmod2b in the myocardial tube at 24 hpf when the heart begins to beat aligns with expression pattern data in avian embryos. At 48 hpf, lmod2b was expressed in both the ventricle and atrium (Figure 1D). At 72 hpf, lmod2b was expressed in the ventricle and craniofacial muscles (Figure 1E). As hypothesized, lmod2b was expressed in the cardiovascular system during early stages of embryonic development, indicating potential importance for early cardiovascular function. Notable expression in the atrium at 48 hpf but not at 72 hpf aligns with changes in atrial morphology. The atrial wall thins by 72 hpf, likely resulting in weaker expression at 72 hpf that may not be detected by in situ hybridization. Expression in the craniofacial muscles indicates involvement in the skeletal muscle system, which supports its predicted roles in contractile function.
Tg(kdrl:NLS-EGFP)ubs1Tg embryos were injected with a cocktail of four gRNAs and purified Cas9 protein to mutate lmod2b (Blum et al., 2008). Alterations at the lmod2b locus were confirmed with PCR amplification of genomic DNA (Figure 1H). We found that there was decreased amplification of the lmod2b gene in crispant DNA, however, there was still some wild-type DNA present, indicating mosaicism. Uninjected control and lmod2b crispant embryos were analyzed daily to check for abnormalities. The overall morphology of the embryo and the heart appeared normal in the crispants (Figure 1F-G), however heart rate analysis revealed abnormalities. Across multiple experiments, the lmod2b crispant zebrafish had higher heart rates than the controls (Figure 1I). Crispants injected with 1 nl gRNA mix had a heart rate average of 108.4 beats per minute compared to the control group, which had an average of 92.8 beats per minute (n= 30 per condition). This indicates that lmod2b gene mutation resulted in tachycardia, which aligns with symptoms of DCM. We did not find notable abnormalities in blood flow or pericardial edema in lmod2b crispants (Figure 1F-G). This mild crispant phenotype aligns the unmutated DNA still present at the molecular level. Based on the heart rate results, we can infer that there may be subtle defects within the structure of the heart that could be revealed with higher resolution analysis.
\tMoving forward, we will continue investigating heart morphology of lmod2b crispants by conducting MF20 and S46 immunostaining, which mark myosin heavy chains in both chambers and only the atrium, respectively. This could highlight cardiac defects that are not visible under normal stereomicroscopy conditions. Mutation of lmod2a and lmod2b in zebrafish both result in cardiac abnormalities, which suggests that these genes are not functionally redundant, and each plays a specific role in cardiac function. Based on this observation, we will further investigate the genetic networks by conducting a double knockdown of lmod2a/lmod2b. We will analyze the double knockdown crispants to continue understanding the molecular mechanisms of DCM. Creating a stable mutant line in the future will allow us to evaluate any defects that occur through adulthood and calculate survival rate.
","references":[{"reference":"American Heart Association. (2024). Dilated Cardiomyopathy (DCM). https://www.heart.org/en/health-topics/cardiomyopathy/what-is-cardiomyopathy-in-adults/dilated-cardiomyopathy-dcm
","pubmedId":"","doi":""},{"reference":"Blum Y, Belting HG, Ellertsdottir E, Herwig L, Lüders F, Affolter M. 2008. Complex cell rearrangements during intersegmental vessel sprouting and vessel fusion in the zebrafish embryo. Developmental Biology 316: 312-322.
","pubmedId":"","doi":"doi.org/10.1016/j.ydbio.2008.01.038"},{"reference":"Cleveland Clinic. (2024). Dilated Cardiomyopathy: Symptoms and Treatment. https://my.clevelandclinic.org/health/diseases/16932-dilated-cardiomyopathy
","pubmedId":"","doi":""},{"reference":"Conley CA, Fritz-Six KL, Almenar-Queralt A, Fowler VM. 2001. Leiomodins: Larger Members of the Tropomodulin (Tmod) Gene Family. Genomics 73: 127-139.
","pubmedId":"","doi":"10.1006/geno.2000.6501"},{"reference":"Jordan E, Peterson L, Ai T, Asatryan B, Bronicki L, Brown E, et al., Hershberger. 2021. Evidence-Based Assessment of Genes in Dilated Cardiomyopathy. Circulation 144: 7-19.
","pubmedId":"","doi":"10.1161/CIRCULATIONAHA.120.053033"},{"reference":"Oxtoby E, Jowett T. 1993. Cloning of the zebrafishkrox-20gene (krx-20) and its expression during hindbrain development. Nucleic Acids Research 21: 1087-1095.
","pubmedId":"","doi":"10.1093/nar/21.5.1087"},{"reference":"Pappas CT, Mayfield RM, Dickerson AE, Mi-Mi L, Gregorio CC. 2024. Human disease-causing mutations result in loss of leiomodin 2 through nonsense-mediated mRNA decay. PLOS Genetics 20: e1011279.
","pubmedId":"","doi":"10.1371/journal.pgen.1011279"},{"reference":"Pappas CT, Mayfield RM, Henderson C, Jamilpour N, Cover C, Hernandez Z, et al., Gregorio. 2015. Knockout of Lmod2 results in shorter thin filaments followed by dilated cardiomyopathy and juvenile lethality. Proceedings of the National Academy of Sciences 112: 13573-13578.
","pubmedId":"","doi":"10.1073/pnas.1508273112"},{"reference":"Patton EE, Zon LI, Langenau DM. 2021. Zebrafish disease models in drug discovery: from preclinical modelling to clinical trials. Nature Reviews Drug Discovery 20: 611-628.
","pubmedId":"","doi":"10.1038/s41573-021-00210-8"},{"reference":"Schumacher JA, Wright ZA, Owen ML, Bredemeier NO, Sumanas S. 2020. Integrin α5 and Integrin α4 cooperate to promote endocardial differentiation and heart morphogenesis. Developmental Biology 465: 46-57.
","pubmedId":"","doi":"10.1016/j.ydbio.2020.06.006"},{"reference":"Shoureshi P, Tan AY, Koneru J, Ellenbogen KA, Kaszala K, Huizar JF. 2024. Arrhythmia-Induced Cardiomyopathy. Journal of the American College of Cardiology 83: 2214-2232.
","pubmedId":"","doi":"10.1016/j.jacc.2024.03.416"},{"reference":"Tsukada T, Pappas CT, Moroz N, Antin PB, Kostyukova AS, Gregorio CC. 2010. Leiomodin-2 is an antagonist of tropomodulin-1 at the pointed end of the thin filaments in cardiac muscle. Journal of Cell Science 123: 3136-3145.
","pubmedId":"","doi":"10.1242/jcs.071837"},{"reference":"Wu RS, Lam II, Clay H, Duong DN, Deo RC, Coughlin SR. 2018. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Developmental Cell 46: 112-125.e4.
","pubmedId":"","doi":"10.1016/j.devcel.2018.06.003"},{"reference":"Wu T, Mu Y, Bogomolovas J, Fang X, Veevers J, Nowak RB, et al., Chen. 2017. HSPB7 is indispensable for heart development by modulating actin filament assembly. Proceedings of the National Academy of Sciences 114: 11956-11961.
","pubmedId":"","doi":"10.1073/pnas.1713763114"},{"reference":"Ye X, Jia H, Zu Y. 2025. lmod2a mutations affect F-actin and SRF pathway leading to cardiac dysfunction in zebrafish. Developmental Biology 525: 306-316.
","pubmedId":"","doi":"10.1016/j.ydbio.2025.06.002"}],"title":"Novel leiomodin 2b crispant zebrafish as a model for dilated cardiomyopathy
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":"1782328696795"}]},{"id":"5340df91-119b-49a6-bbee-a6167e45deb0","decision":"accept","abstract":"Congenital heart disease (CHD) is highly prevalent in live births and requires concise diagnoses and treatment plans. Although there is a vast amount of genetics research in the field of CHD, there are still knowledge gaps regarding the gene networks surrounding heart development. A literature review revealed that mutation in Leiomodin 2 is associated with dilated cardiomyopathy in humans. We selected lmod2b for further molecular analysis. In situ hybridization was conducted throughout zebrafish embryonic development to investigate the expression pattern of lmod2b. To further understand the function of lmod2b, CRISPR-Cas9 gene editing was conducted to look for cardiac abnormalities.
","acknowledgements":"We thank the staff of Miami University Laboratory Animal Resources for animal care and Miami University Center for Bioinformatics and Functional Genomics for sequencing analysis. We thank Mason Posner for CRISPR methodology assistance, Joshua Waxman and Kendall Martin for productive discussion.
","authors":[{"affiliations":["Miami University, Oxford, OH, United States"],"departments":["Department of Biological Sciences"],"credit":["formalAnalysis","conceptualization","dataCuration","methodology","writing_originalDraft","writing_reviewEditing","investigation","fundingAcquisition"],"email":"skylie28antle@gmail.com","firstName":"Skylie J","lastName":"Antle","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Miami University, Oxford, OH, United States"],"departments":["Department of Biological Sciences"],"credit":["conceptualization","dataCuration","project","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing","methodology"],"email":"schumaj@miamioh.edu","firstName":"Jennifer A","lastName":"Schumacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"Undergraduate Summer Scholars","funderName":"Miami University (United States)","awardRecipient":"Skylie Antle"},{"awardId":"Start Up Funds","funderName":"Miami University (United States)","awardRecipient":"Jennifer Schumacher"}],"conflictsOfInterest":"The authors declare that Joshua Waxman as a conflict of interest.
","dataTable":{"url":null},"extendedData":[],"funding":"Miami University Undergraduate Summer Scholars, Miami University Start Up Funds
","image":{"url":"https://portal.micropublication.org/uploads/e1974e8adc4fd27e386c98566d5c8f2d.jpg"},"imageCaption":"(A-E) shows in situ hybridization expression of lmod2b at multiple developmental stages. (A) 21 somites embryo (9/9). Arrowheads indicate adaxial cell expression. (B) 24 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (C) 26 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (D) 48 hpf embryo (10/10). Arrowheads indicate atrium and ventricle expression. (E) 72 hpf larva (11/11). Black arrowheads indicate ventricle expression. White arrowhead indicates craniofacial muscle expression. (F) Control larva at 5 dpf. (G) lmod2b-KO crispant at 5 days post fertilization. (H) Gel electrophoresis for PCR amplification of itga4, and lmod2b in exon and 1 exon 2. Lanes 3 and 4 indicate itga4 controls for uncut genomic regions. Lanes 5 and 6 indicate exon 1 of the genomic region. Lanes 7 and 8 indicate exon 2 of the genomic region. As seen in lanes 6 and 8, crispants showed decreased intensity of bands, showing mosaic gene editing. Arrowhead in lane 8 shows heteroduplex. (I) Heart rate quantification for control and crispant embryos at 4 days post fertilization. Crispants were injected at the 1-cell stage with 1 nl of gRNA cocktail (n= 30 per condition). **** indicates p < 0.0001.
","imageTitle":"Expression pattern of lmod2b, heart rate analysis in lmod2b crispants, and CRISPR conformation gel electrophoresis
","methods":"RNA probe synthesis: Total RNA was extracted and purified from 96 hpf wildtype zebrafish embryos. Reverse transcription using Superscript IV (Invitrogen) was then used to create cDNA. Forward and reverse primers were designed to amplify a 957 base pair (nucleotides 281-1237) section of the lmod2b coding sequence. Primer pair used is as follows: forward primer sequence 5’-CTCCACCGGTACATTCAGT-3’ and reverse primer sequence 5’-CTTGATTGCGGGTGAGAAGG-3’. PCR product was obtained for cloning with TOPO technology. Directionality of insertion was determined by Sanger sequencing. Plasmid linearization for probe synthesis was conducted using NotI restriction enzyme. SP6 RNA polymerase was used for in-vitro transcription. Digoxigenin labeled antisense RNA probe was precipitated and stored at -80°C.
In situ Hybridization: Zebrafish embryos were fixed at 21 somites, 24 hpf, 26 hpf, 48 hpf, and 72 hpf. Whole mount in situ hybridization was conducted at each developmental stage using lmod2b antisense RNA probe as previously described (Oxtoby & Jowett, 1993). Proteinase K treatment (10 mg/ml) was performed for 5 to 25 minutes at room temperature, depending on the stage examined. Samples were incubated in pre-hybridization solution for 2 hours at 65°C, followed by incubation with antisense RNA probes in hybridization solution at 65°C overnight. Pre-hyb/SSC wash series was completed at 65°C in 15 minute increments. Samples were placed in 5% sheep serum blocking solution for 1 hour at room temperature followed by Anti-Digoxigenin-AP Fab fragments antibody solution (1:5000) overnight at 4 °C. Staining was conducted with NBT/BCIP at room temperature until signal was visible. Samples were transferred to 80% glycerol for imaging with a Zeiss SteREO Discovery.V8 microscope equipped with a Zeiss Axiocam 506 color camera.
gRNA synthesis and CRISPR analysis: Oligonucleotide sequences were designed based on Wu et al. (2018) Genome-Scale Lookup Table for Four-Guide Sets. CRISPR sequences selected from this article include: GCGTTCTGGGATCCTTCGAG (PAM site TGG), AGGATTGGATCTACAAGCCC (PAM site AGG), GTACCTCATCAGCCACCGTG (PAM site GGG), and GGGTTGTCATGCTTATACGT (PAM site GGG). PCR products were obtained and purified. lmod2b gRNA was synthesized using T7 polymerase. A 1:2 ratio of purified gRNA to Cas9 protein was used to create the injection mix. The final concentration of Cas9 was 500 ng/ul and the final concentration of gRNA was 250 ng/ul. We injected 1 nl into 1-cell Tg(kdrl:NLS-EGFP)ubs1Tg zebrafish embryos. Embryos were incubated at 28.6°C until heart analysis at 4 days post fertilization (dpf). For heart rate quantification, randomly selected larvae were individually transferred in a minimal amount of liquid into a depression slide containing 160 mg/mL tricaine stock solution. The larva was then incubated for 1 minute before measuring heart rate. Heart rate was quantified visually using a stereomicroscope by counting beats with a tally counter for 15 seconds and multiplying by 4 to be recorded in beats per minute. Each larva was incubated individually in fresh tricaine solution for 1 minute before HR was counted to ensure consistent anesthetic treatment across all samples. Based on experimental set up, the investigator was not blinded to experimental conditions. Analysis of control and crispant embryos was replicated 3 times with n=10 per condition for each trial.
CRISPR confirmation: To confirm editing of the lmod2b locus on the molecular level, genomic DNA was extracted from control and crispant embryos at 24 hpf. Zebrafish were anesthetized with tricaine and sorted into PCR tubes. To extract DNA, lysis buffer was prepared with 10 mM Tris HCl pH 7.5, 50 mM KCl, 0.3% Tween-20, 0.3% NP-40, and 1 mM EDTA pH 8. Lysis buffer was added and embryos were incubated for 10 minutes at 95° C. Proteinase K treatment (2 µg/ml) was performed at 55° C for 12 hours followed by enzyme inactivation at 95° C for 10 minutes. After lysate was obtained, genomic DNA was amplified using PCR. Primer pairs based on guide RNA sites were designed for PCR in CHOPCHOP. Primer pair one included forward primer sequence 5’-TTTTGCAGCTCTTTCTGATTGA-3’ and reverse primer sequence 5’-TTTTCTGACACCATTGGAAGTG-3’. Primer pair 1 amplified across the genomic region spanning exon 1, where gRNAs 1 and 2 cut (nucleotides 185,713-186,255). Primer pair two included forward primer sequence 5’-AAAGGCAGATAGGTGAACCAAA-3’ and reverse primer sequence 5’-AGCTGTGAGGAGAAGAAGTGCT-3’. Primer pair 2 amplified the genomic region spanning exon 2, where gRNAs 3 and 4 cut (nucleotides 184,171-184,821). Primers for itga4 gene were used as a control for an uncut region of the genome (Schumacher et al., 2020). itga4 is on chromosome 9 whereas lmod2b is on chromosome 4, ensuring there would be no CRISPR cleavage at this site. Gene mutation was confirmed using gel electrophoresis on a 1.5% agarose gel.
","reagents":"Integrated DNA Technologies: Oligonucleotides
Invitrogen: Superscript IV Reverse Transcriptase Kit
Millipore Sigma: Anti-Digoxigenin-AP Fab fragments
New England Biolabs: PCR & DNA Cleanup Kit
New England Biolabs: HighScribe T7 kit
New England Biolabs: RNA clean up kit
New England Biolabs: Taq DNA polymerase
New England Biolabs: NotI restriction endonuclease
PNA Bio: Cas9 Protein
QIAGEN: QIAprep Spin Miniprep Kit
ThermoFisher Scientific: TOPO TA cloning kit
ThermoFisher Scientific: One Shot TOP10 chemically competent E. Coli
","patternDescription":"Dilated cardiomyopathy (DCM) affects about 0.00036% of individuals, and more than 50% of cases have underlying genetic factors (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). In the United States, DCM causes 10,000 deaths and 46,000 hospitalizations annually. However, these statistics may be underestimated due to some patients being asymptomatic. DCM causes weakened heart muscle due to abnormally large chambers of the heart, commonly starting in the left ventricle but can spread to the right ventricle then the atria in severe cases. The myocardium stretches thin, causing it to be weakened (American Heart Association, 2024). Left ventricular dysfunction causes blood to remain in the heart after each contraction, so the heart must compensate to ensure blood flow to the rest of the body. This leads to an overall higher heart rate (HR), known as tachycardia (Shoureshi et al., 2024). Patients often present with chest pain, dizziness or fainting, fatigue, heart palpitations, and dyspnea. These symptoms are manageable if detected early and properly treated (Dilated Cardiomyopathy: Symptoms and Treatment, 2024). A vast number of studies relating to cardiomyopathy have been conducted, however the genetic basis of this condition is still unclear. LMOD2 is a causal gene of DCM but is less characterized than other DCM causal genes such as BAG3, DES, FLNC, LNMA, MYH7, PLN, RBM20, SCN5A, TNNC1, TNNT2, and TTN (Jordan et al., 2021). Mutations in LMOD2 that lead to impaired protein production can cause early-onset DCM that is fatal without proper medical intervention (Pappas et al., 2024).
Leiomodin gene family members are expressed in skeletal, smooth and cardiac muscle in adults, as well as during the fetal period (Conley et al., 2001). However, leiomodin 2 (Lmod2) is limited to cardiac and skeletal muscle (Tsukada et al., 2010). These striated muscles use sarcomeres to contract, which requires proper organization of actin and myosin filaments. Lmod2 is an actin nucleator, catalyzing the formation of new actin filaments. Lmod2 is necessary for regulating the length of thin filaments of cardiac muscle (Wu et al., 2017), which is crucial for maintaining the structure of sarcomeres, allowing for proper contractile function. When Lmod2 function is disrupted, abnormalities in thin filament structure can result in reduced cardiac muscle function (Wu et al., 2017).
In avian embryos, LMOD2 transcripts are expressed after the heart begins beating (Hamburger-Hamilton stage 14), indicating it is not the first actin nucleator involved in thin filament assembly (Tsukada et al., 2010). Overexpression of mCherry-Lmod2 in avian cardiomyocytes resulted in disorganized sarcomere structure and overextension of thin filaments, interfering with the typical striated patterns. In mouse embryos, Lmod2 transcripts are expressed in the heart at embryonic day 8.5, and in the somites at embryonic day 9.5 (Pappas et al., 2015). Lmod2 knockout (KO) mouse models were found to have abnormal cardiac contractility, shortened actin-thin filaments, and irregular calcium handling. Lmod2 knockout resulted in fatal neonatal DCM causing mice to die between 15 and 33 days after DCM onset. When Lmod2 was restored in Lmod2-KO mice at postnatal day 4, before heart defects were detected, thin filament length increased, nearly reaching normal levels (Pappas et al., 2015).
We use zebrafish as a model for cardiac development, as they lay large amounts of transparent embryos that allow for analysis of internal organs. Zebrafish have two-chambered hearts that begin beating at 24 hours post fertilization (hpf), shortly followed by blood flow. The simplicity of the two-chambered heart with rapid development of the cardiovascular system allows for quick data collection and analysis. Conserved signaling pathways and orthology to human disease makes zebrafish an excellent model for developmental processes. Zebrafish are a great model organism for cardiovascular development because they can survive up to five days post fertilization without a heartbeat. This resilience allows insight into the intricacies of the cardiovascular system, making them beneficial when compared to other model organisms. Zebrafish are extremely useful as preclinical models, serving as a gateway to test the effectiveness of new therapeutic drugs that could potentially be used to treat symptoms of cardiomyopathy (Patton et al., 2022). Previous studies have shown that homozygous mutant lmod2a -/- zebrafish have irregular heart rhythms and impaired contractility, indicating that lmod2a plays an essential role in thin filament regulation (Ye et al., 2025). However, the role of lmod2b remains uncharacterized. lmod2b is predicted to be involved with actin filament organization, tropomyosin bind activity, muscle contraction, and myofibril assembly in zebrafish.
Using in situ hybridization with the lmod2b RNA probe, we saw cardiac expression at 24 hours post fertilization (hpf) which aligns with this gene's predicted expression patterns. We also saw expression in the skeletal muscle structures which aligns with its predicted role in skeletal muscle contraction. Using CRISPR-Cas9 technology, we created a novel zebrafish model by mutating the lmod2b gene to further our understanding of DCM. We found no significant pericardial edema or abnormalities in the craniofacial structure when comparing the control group to crispants. However, our findings are consistent with a potential role for lmod2b in DCM, as lmod2b crispants had higher heart rates compared to the control group.
Discussion
In situ hybridization was conducted at multiple developmental stages to analyze expression patterns of lmod2b. At 21 somites, lmod2b was expressed in adaxial cells of the somites (Figure 1A). At 24 and 26 hpf, lmod2b was expressed in the myocardial tube (Figure 1B-C). First detection of lmod2b in the myocardial tube at 24 hpf when the heart begins to beat aligns with expression pattern data in avian embryos. At 48 hpf, lmod2b was expressed in both the ventricle and atrium (Figure 1D). At 72 hpf, lmod2b was expressed in the ventricle and craniofacial muscles (Figure 1E). As hypothesized, lmod2b was expressed in the cardiovascular system during early stages of embryonic development, indicating potential importance for early cardiovascular function. Notable expression in the atrium at 48 hpf but not at 72 hpf aligns with changes in atrial morphology. The atrial wall thins by 72 hpf, likely resulting in weaker expression at 72 hpf that may not be detected by in situ hybridization. Expression in the craniofacial muscles indicates involvement in the skeletal muscle system, which supports its predicted roles in contractile function.
Tg(kdrl:NLS-EGFP)ubs1Tg embryos were injected with a cocktail of four gRNAs and purified Cas9 protein to mutate lmod2b (Blum et al., 2008). Alterations at the lmod2b locus were confirmed with PCR amplification of genomic DNA (Figure 1H). We found that there was decreased amplification of the lmod2b gene in crispant DNA, however, there was still some wild-type DNA present, indicating mosaicism. Uninjected control and lmod2b crispant embryos were analyzed daily to check for abnormalities. The overall morphology of the embryo and the heart appeared normal in the crispants (Figure 1F-G), however heart rate analysis revealed abnormalities. Across multiple experiments, the lmod2b crispant zebrafish had higher heart rates than the controls (Figure 1I). Crispants injected with 1 nl gRNA mix had a heart rate average of 108.4 beats per minute compared to the control group, which had an average of 92.8 beats per minute (n= 30 per condition). This indicates that lmod2b gene mutation resulted in tachycardia, which aligns with symptoms of DCM. We did not find notable abnormalities in blood flow or pericardial edema in lmod2b crispants (Figure 1F-G). This mild crispant phenotype aligns the unmutated DNA still present at the molecular level. Based on the heart rate results, we can infer that there may be subtle defects within the structure of the heart that could be revealed with higher resolution analysis.
\tMoving forward, we will continue investigating heart morphology of lmod2b crispants by conducting MF20 and S46 immunostaining, which mark myosin heavy chains in both chambers and only the atrium, respectively. This could highlight cardiac defects that are not visible under normal stereomicroscopy conditions. Mutation of lmod2a and lmod2b in zebrafish both result in cardiac abnormalities, which suggests that these genes are not functionally redundant, and each plays a specific role in cardiac function. Based on this observation, we will further investigate the genetic networks by conducting a double knockdown of lmod2a/lmod2b. We will analyze the double knockdown crispants to continue understanding the molecular mechanisms of DCM. Creating a stable mutant line in the future will allow us to evaluate any defects that occur through adulthood and calculate survival rate.
","references":[{"reference":"American Heart Association. (2024). Dilated Cardiomyopathy (DCM). https://www.heart.org/en/health-topics/cardiomyopathy/what-is-cardiomyopathy-in-adults/dilated-cardiomyopathy-dcm
","pubmedId":"","doi":""},{"reference":"Blum Y, Belting HG, Ellertsdottir E, Herwig L, Lüders F, Affolter M. 2008. Complex cell rearrangements during intersegmental vessel sprouting and vessel fusion in the zebrafish embryo. Developmental Biology 316: 312-322.
","pubmedId":"","doi":"10.1016/j.ydbio.2008.01.038"},{"reference":"Cleveland Clinic. (2024). Dilated Cardiomyopathy: Symptoms and Treatment. https://my.clevelandclinic.org/health/diseases/16932-dilated-cardiomyopathy
","pubmedId":"","doi":""},{"reference":"Conley CA, Fritz-Six KL, Almenar-Queralt A, Fowler VM. 2001. Leiomodins: Larger Members of the Tropomodulin (Tmod) Gene Family. Genomics 73: 127-139.
","pubmedId":"","doi":"10.1006/geno.2000.6501"},{"reference":"Jordan E, Peterson L, Ai T, Asatryan B, Bronicki L, Brown E, et al., Hershberger. 2021. Evidence-Based Assessment of Genes in Dilated Cardiomyopathy. Circulation 144: 7-19.
","pubmedId":"","doi":"10.1161/CIRCULATIONAHA.120.053033"},{"reference":"Oxtoby E, Jowett T. 1993. Cloning of the zebrafishkrox-20gene (krx-20) and its expression during hindbrain development. Nucleic Acids Research 21: 1087-1095.
","pubmedId":"","doi":"10.1093/nar/21.5.1087"},{"reference":"Pappas CT, Mayfield RM, Dickerson AE, Mi-Mi L, Gregorio CC. 2024. Human disease-causing mutations result in loss of leiomodin 2 through nonsense-mediated mRNA decay. PLOS Genetics 20: e1011279.
","pubmedId":"","doi":"10.1371/journal.pgen.1011279"},{"reference":"Pappas CT, Mayfield RM, Henderson C, Jamilpour N, Cover C, Hernandez Z, et al., Gregorio. 2015. Knockout of Lmod2 results in shorter thin filaments followed by dilated cardiomyopathy and juvenile lethality. Proceedings of the National Academy of Sciences 112: 13573-13578.
","pubmedId":"","doi":"10.1073/pnas.1508273112"},{"reference":"Patton EE, Zon LI, Langenau DM. 2021. Zebrafish disease models in drug discovery: from preclinical modelling to clinical trials. Nature Reviews Drug Discovery 20: 611-628.
","pubmedId":"","doi":"10.1038/s41573-021-00210-8"},{"reference":"Schumacher JA, Wright ZA, Owen ML, Bredemeier NO, Sumanas S. 2020. Integrin α5 and Integrin α4 cooperate to promote endocardial differentiation and heart morphogenesis. Developmental Biology 465: 46-57.
","pubmedId":"","doi":"10.1016/j.ydbio.2020.06.006"},{"reference":"Shoureshi P, Tan AY, Koneru J, Ellenbogen KA, Kaszala K, Huizar JF. 2024. Arrhythmia-Induced Cardiomyopathy. Journal of the American College of Cardiology 83: 2214-2232.
","pubmedId":"","doi":"10.1016/j.jacc.2024.03.416"},{"reference":"Tsukada T, Pappas CT, Moroz N, Antin PB, Kostyukova AS, Gregorio CC. 2010. Leiomodin-2 is an antagonist of tropomodulin-1 at the pointed end of the thin filaments in cardiac muscle. Journal of Cell Science 123: 3136-3145.
","pubmedId":"","doi":"10.1242/jcs.071837"},{"reference":"Wu RS, Lam II, Clay H, Duong DN, Deo RC, Coughlin SR. 2018. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Developmental Cell 46: 112-125.e4.
","pubmedId":"","doi":"10.1016/j.devcel.2018.06.003"},{"reference":"Wu T, Mu Y, Bogomolovas J, Fang X, Veevers J, Nowak RB, et al., Chen. 2017. HSPB7 is indispensable for heart development by modulating actin filament assembly. Proceedings of the National Academy of Sciences 114: 11956-11961.
","pubmedId":"","doi":"10.1073/pnas.1713763114"},{"reference":"Ye X, Jia H, Zu Y. 2025. lmod2a mutations affect F-actin and SRF pathway leading to cardiac dysfunction in zebrafish. Developmental Biology 525: 306-316.
","pubmedId":"","doi":"10.1016/j.ydbio.2025.06.002"}],"title":"Novel leiomodin 2b crispant zebrafish as a model for dilated cardiomyopathy
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":null}]},{"id":"9f370266-ad15-44f3-9762-6ace69465bd8","decision":"publish","abstract":"Congenital heart disease (CHD) is highly prevalent in live births and requires concise diagnoses and treatment plans. Although there is a vast amount of genetics research in the field of CHD, there are still knowledge gaps regarding the gene networks surrounding heart development. A literature review revealed that mutation in Leiomodin 2 is associated with dilated cardiomyopathy in humans. We selected lmod2b for further molecular analysis. In situ hybridization was conducted throughout zebrafish embryonic development to investigate the expression pattern of lmod2b. To further understand the function of lmod2b, CRISPR-Cas9 gene editing was conducted to look for cardiac abnormalities.
","acknowledgements":"We thank the staff of Miami University Laboratory Animal Resources for animal care and Miami University Center for Bioinformatics and Functional Genomics for sequencing analysis. We thank Mason Posner for CRISPR methodology assistance, Joshua Waxman and Kendall Martin for productive discussion.
","authors":[{"affiliations":["Miami University, Oxford, OH, United States"],"departments":["Department of Biology"],"credit":["formalAnalysis","conceptualization","dataCuration","methodology","writing_originalDraft","writing_reviewEditing","investigation","fundingAcquisition"],"email":"skylie28antle@gmail.com","firstName":"Skylie J","lastName":"Antle","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Miami University Regionals, Hamilton, OH, United States"],"departments":["Department of Biological Sciences"],"credit":["conceptualization","dataCuration","project","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing","methodology"],"email":"schumaj@miamioh.edu","firstName":"Jennifer A","lastName":"Schumacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"Undergraduate Summer Scholars","funderName":"Miami University (United States)","awardRecipient":"Skylie Antle"},{"awardId":"Start Up Funds","funderName":"Miami University (United States)","awardRecipient":"Jennifer Schumacher"}],"conflictsOfInterest":"The authors declare that Joshua Waxman as a conflict of interest.
","dataTable":{"url":null},"extendedData":[],"funding":"Miami University Undergraduate Summer Scholars, Miami University Start Up Funds
","image":{"url":"https://portal.micropublication.org/uploads/e1974e8adc4fd27e386c98566d5c8f2d.jpg"},"imageCaption":"(A-E) shows in situ hybridization expression of lmod2b at multiple developmental stages. (A) 21 somites embryo (9/9). Arrowheads indicate adaxial cell expression. (B) 24 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (C) 26 hpf embryo (12/12). Arrowhead indicates myocardial tube expression. (D) 48 hpf embryo (10/10). Arrowheads indicate atrium and ventricle expression. (E) 72 hpf larva (11/11). Black arrowheads indicate ventricle expression. White arrowhead indicates craniofacial muscle expression. (F) Control larva at 5 dpf. (G) lmod2b crispant at 5 dpf. (H) Gel electrophoresis for PCR amplification of itga4, and lmod2b in exon and 1 exon 2. Lanes 3 and 4 indicate itga4 controls for uncut genomic regions. Lanes 5 and 6 indicate exon 1 of the genomic region. Lanes 7 and 8 indicate exon 2 of the genomic region. As seen in lanes 6 and 8, crispants showed decreased intensity of bands, showing mosaic gene editing. Arrowhead in lane 8 shows heteroduplex. (I) Heart rate quantification for control and crispant embryos at 4 days post fertilization. Crispants were injected at the 1-cell stage with 1 nl of gRNA cocktail (n= 30 per condition). **** indicates p < 0.0001.
","imageTitle":"Expression pattern of lmod2b, heart rate analysis in lmod2b crispants, and CRISPR confirmation gel electrophoresis
","methods":"RNA probe synthesis: Total RNA was extracted and purified from 96 hpf wildtype zebrafish embryos. Reverse transcription using Superscript IV (Invitrogen) was then used to create cDNA. Forward and reverse primers were designed to amplify a 957 base pair (nucleotides 281-1237) section of the lmod2b coding sequence. Primer pair used is as follows: forward primer sequence 5’-CTCCACCGGTACATTCAGT-3’ and reverse primer sequence 5’-CTTGATTGCGGGTGAGAAGG-3’. PCR product was obtained for cloning with TOPO technology. Directionality of insertion was determined by Sanger sequencing. Plasmid linearization for probe synthesis was conducted using NotI restriction enzyme. SP6 RNA polymerase was used for in-vitro transcription. Digoxigenin labeled antisense RNA probe was precipitated and stored at -80°C.
In situ Hybridization: Zebrafish embryos were fixed at 21 somites, 24 hpf, 26 hpf, 48 hpf, and 72 hpf. Whole mount in situ hybridization was conducted at each developmental stage using lmod2b antisense RNA probe as previously described (Oxtoby & Jowett, 1993). Proteinase K treatment (10 mg/ml) was performed for 5 to 25 minutes at room temperature, depending on the stage examined. Samples were incubated in pre-hybridization solution for 2 hours at 65°C, followed by incubation with antisense RNA probes in hybridization solution at 65°C overnight. Pre-hyb/SSC wash series was completed at 65°C in 15 minute increments. Samples were placed in 5% sheep serum blocking solution for 1 hour at room temperature followed by Anti-Digoxigenin-AP Fab fragments antibody solution (1:5000) overnight at 4 °C. Staining was conducted with NBT/BCIP at room temperature until signal was visible. Samples were transferred to 80% glycerol for imaging with a Zeiss SteREO Discovery.V8 microscope equipped with a Zeiss Axiocam 506 color camera.
gRNA synthesis and CRISPR analysis: Oligonucleotide sequences were designed based on Wu et al. (2018) Genome-Scale Lookup Table for Four-Guide Sets. CRISPR sequences selected from this article include: GCGTTCTGGGATCCTTCGAG (PAM site TGG), AGGATTGGATCTACAAGCCC (PAM site AGG), GTACCTCATCAGCCACCGTG (PAM site GGG), and GGGTTGTCATGCTTATACGT (PAM site GGG). PCR products were obtained and purified. lmod2b gRNA was synthesized using T7 polymerase. A 1:2 ratio of purified gRNA to Cas9 protein was used to create the injection mix. The final concentration of Cas9 was 500 ng/ul and the final concentration of gRNA was 250 ng/ul. We injected 1 nl into 1-cell Tg(kdrl:NLS-EGFP)ubs1Tg zebrafish embryos. Embryos were incubated at 28.6°C until heart analysis at 4 days post fertilization (dpf). For heart rate quantification, randomly selected larvae were individually transferred in a minimal amount of liquid into a depression slide containing 160 mg/mL tricaine stock solution. The larva was then incubated for 1 minute before measuring heart rate. Heart rate was quantified visually using a stereomicroscope by counting beats with a tally counter for 15 seconds and multiplying by 4 to be recorded in beats per minute. Each larva was incubated individually in fresh tricaine solution for 1 minute before HR was counted to ensure consistent anesthetic treatment across all samples. Based on experimental set up, the investigator was not blinded to experimental conditions. Analysis of control and crispant embryos was replicated 3 times with n=10 per condition for each trial.
CRISPR confirmation: To confirm editing of the lmod2b locus on the molecular level, genomic DNA was extracted from control and crispant embryos at 24 hpf. Zebrafish were anesthetized with tricaine and sorted into PCR tubes. To extract DNA, lysis buffer was prepared with 10 mM Tris HCl pH 7.5, 50 mM KCl, 0.3% Tween-20, 0.3% NP-40, and 1 mM EDTA pH 8. Lysis buffer was added and embryos were incubated for 10 minutes at 95° C. Proteinase K treatment (2 µg/ml) was performed at 55° C for 12 hours followed by enzyme inactivation at 95° C for 10 minutes. After lysate was obtained, genomic DNA was amplified using PCR. Primer pairs based on guide RNA sites were designed for PCR in CHOPCHOP. Primer pair 1 included forward primer sequence 5’-TTTTGCAGCTCTTTCTGATTGA-3’ and reverse primer sequence 5’-TTTTCTGACACCATTGGAAGTG-3’. Primer pair 1 amplified across the genomic region spanning exon 1, where gRNAs 1 and 2 cut (nucleotides 185,713-186,255). Primer pair 2 included forward primer sequence 5’-AAAGGCAGATAGGTGAACCAAA-3’ and reverse primer sequence 5’-AGCTGTGAGGAGAAGAAGTGCT-3’. Primer pair 2 amplified the genomic region spanning exon 2, where gRNAs 3 and 4 cut (nucleotides 184,171-184,821). Primers for itga4 gene were used as a control for an uncut region of the genome (Schumacher et al., 2020). itga4 is on chromosome 9 whereas lmod2b is on chromosome 4, ensuring there would be no CRISPR cleavage at this site. Gene mutation was confirmed using gel electrophoresis on a 1.5% agarose gel.
","reagents":"Integrated DNA Technologies: Oligonucleotides
Invitrogen: Superscript IV Reverse Transcriptase Kit
Millipore Sigma: Anti-Digoxigenin-AP Fab fragments
New England Biolabs: PCR & DNA Cleanup Kit
New England Biolabs: HighScribe T7 kit
New England Biolabs: RNA clean up kit
New England Biolabs: Taq DNA polymerase
New England Biolabs: NotI restriction endonuclease
PNA Bio: Cas9 Protein
QIAGEN: QIAprep Spin Miniprep Kit
ThermoFisher Scientific: TOPO TA cloning kit
ThermoFisher Scientific: One Shot TOP10 chemically competent E. Coli
","patternDescription":"Dilated cardiomyopathy (DCM) affects about 0.00036% of individuals, and more than 50% of cases have underlying genetic factors (Cleveland Clinic, 2024, https://my.clevelandclinic.org/health/diseases/16932-dilated-cardiomyopathy). In the United States, DCM causes 10,000 deaths and 46,000 hospitalizations annually. However, these statistics may be underestimated due to some patients being asymptomatic. DCM causes weakened heart muscle due to abnormally large chambers of the heart, commonly starting in the left ventricle but can spread to the right ventricle then the atria in severe cases. The myocardium stretches thin, causing it to be weakened (American Heart Association, 2024, https://www.heart.org/en/health-topics/cardiomyopathy/what-is-cardiomyopathy-in-adults/dilated-cardiomyopathy-dcm). Left ventricular dysfunction causes blood to remain in the heart after each contraction, so the heart must compensate to ensure blood flow to the rest of the body. This leads to an overall higher heart rate (HR), known as tachycardia (Shoureshi et al., 2024). Patients often present with chest pain, dizziness or fainting, fatigue, heart palpitations, and dyspnea. These symptoms are manageable if detected early and properly treated (Cleveland Clinic, 2024, https://my.clevelandclinic.org/health/diseases/16932-dilated-cardiomyopathy). A vast number of studies relating to cardiomyopathy have been conducted, however the genetic basis of this condition is still unclear. LMOD2 is a causal gene of DCM but is less characterized than other DCM causal genes such as BAG3, DES, FLNC, LNMA, MYH7, PLN, RBM20, SCN5A, TNNC1, TNNT2, and TTN (Jordan et al., 2021). Mutations in LMOD2 that lead to impaired protein production can cause early-onset DCM that is fatal without proper medical intervention (Pappas et al., 2024).
Leiomodin gene family members are expressed in skeletal, smooth and cardiac muscle in adults, as well as during the fetal period (Conley et al., 2001). However, leiomodin 2 (Lmod2) is limited to cardiac and skeletal muscle (Tsukada et al., 2010). These striated muscles use sarcomeres to contract, which requires proper organization of actin and myosin filaments. Lmod2 is an actin nucleator, catalyzing the formation of new actin filaments. Lmod2 is necessary for regulating the length of thin filaments of cardiac muscle (Wu et al., 2017), which is crucial for maintaining the structure of sarcomeres, allowing for proper contractile function. When Lmod2 function is disrupted, abnormalities in thin filament structure can result in reduced cardiac muscle function (Wu et al., 2017).
In avian embryos, LMOD2 transcripts are expressed after the heart begins beating (Hamburger-Hamilton stage 14), indicating it is not the first actin nucleator involved in thin filament assembly (Tsukada et al., 2010). Overexpression of mCherry-Lmod2 in avian cardiomyocytes resulted in disorganized sarcomere structure and overextension of thin filaments, interfering with the typical striated patterns. In mouse embryos, Lmod2 transcripts are expressed in the heart at embryonic day 8.5, and in the somites at embryonic day 9.5 (Pappas et al., 2015). Lmod2 knockout (KO) mouse models were found to have abnormal cardiac contractility, shortened actin-thin filaments, and irregular calcium handling. Lmod2 KO resulted in fatal neonatal DCM causing mice to die between 15 and 33 days after DCM onset. When Lmod2 was restored in Lmod2-KO mice at postnatal day 4, before heart defects were detected, thin filament length increased, nearly reaching normal levels (Pappas et al., 2015).
We use zebrafish as a model for cardiac development, as they lay large amounts of transparent embryos that allow for analysis of internal organs. Zebrafish have two-chambered hearts that begin beating at 24 hours post fertilization (hpf), shortly followed by blood flow. The simplicity of the two-chambered heart with rapid development of the cardiovascular system allows for quick data collection and analysis. Conserved signaling pathways and orthology to human disease makes zebrafish an excellent model for developmental processes. Zebrafish are a great model organism for cardiovascular development because they can survive up to five days post fertilization without a heartbeat. This resilience allows insight into the intricacies of the cardiovascular system, making them beneficial when compared to other model organisms. Zebrafish are extremely useful as preclinical models, serving as a gateway to test the effectiveness of new therapeutic drugs that could potentially be used to treat symptoms of cardiomyopathy (Patton et al., 2022). Previous studies have shown that homozygous mutant lmod2a -/- zebrafish have irregular heart rhythms and impaired contractility, indicating that lmod2a plays an essential role in thin filament regulation (Ye et al., 2025). However, the role of lmod2b remains uncharacterized. lmod2b is predicted to be involved with actin filament organization, tropomyosin bind activity, muscle contraction, and myofibril assembly in zebrafish.
Using in situ hybridization with the lmod2b RNA probe, we saw cardiac expression at 24 hours post fertilization (hpf) which aligns with this gene's predicted expression patterns. We also saw expression in the skeletal muscle structures which aligns with its predicted role in skeletal muscle contraction. Using CRISPR-Cas9 technology, we created a novel zebrafish model by mutating the lmod2b gene to further our understanding of DCM. We found no significant pericardial edema or abnormalities in the craniofacial structure when comparing the control group to crispants. However, our findings are consistent with a potential role for lmod2b in DCM, as lmod2b crispants had higher heart rates compared to the control group.
Discussion
In situ hybridization was conducted at multiple developmental stages to analyze expression patterns of lmod2b. At 21 somites, lmod2b was expressed in adaxial cells of the somites (Figure 1A). At 24 and 26 hpf, lmod2b was expressed in the myocardial tube (Figure 1B-C). First detection of lmod2b in the myocardial tube at 24 hpf when the heart begins to beat aligns with expression pattern data in avian embryos. At 48 hpf, lmod2b was expressed in both the ventricle and atrium (Figure 1D). At 72 hpf, lmod2b was expressed in the ventricle and craniofacial muscles (Figure 1E). As hypothesized, lmod2b was expressed in the cardiovascular system during early stages of embryonic development, indicating potential importance for early cardiovascular function. Notable expression in the atrium at 48 hpf but not at 72 hpf aligns with changes in atrial morphology. The atrial wall thins by 72 hpf, likely resulting in weaker expression at 72 hpf that may not be detected by in situ hybridization. Expression in the craniofacial muscles indicates involvement in the skeletal muscle system, which supports its predicted roles in contractile function.
Tg(kdrl:NLS-EGFP)ubs1Tg embryos were injected with a cocktail of four gRNAs and purified Cas9 protein to mutate lmod2b (Blum et al., 2008). Alterations at the lmod2b locus were confirmed with PCR amplification of genomic DNA (Figure 1H). We found that there was decreased amplification of the lmod2b gene in crispant DNA, however, there was still some wild-type DNA present, indicating mosaicism. Uninjected control and lmod2b crispant embryos were analyzed daily to check for abnormalities. The overall morphology of the embryo and the heart appeared normal in the crispants (Figure 1F-G), however heart rate analysis revealed abnormalities. Across multiple experiments, the lmod2b crispant zebrafish had higher heart rates than the controls (Figure 1I). Crispants injected with 1 nl gRNA mix had a heart rate average of 108.4 beats per minute compared to the control group, which had an average of 92.8 beats per minute (n= 30 per condition). This indicates that lmod2b gene mutation resulted in tachycardia, which aligns with symptoms of DCM. We did not find notable abnormalities in blood flow or pericardial edema in lmod2b crispants (Figure 1F-G). This mild crispant phenotype aligns the unmutated DNA still present at the molecular level. Based on the heart rate results, we can infer that there may be subtle defects within the structure of the heart that could be revealed with higher resolution analysis.
Moving forward, we will continue investigating heart morphology of lmod2b crispants by conducting MF20 and S46 immunostaining, which mark myosin heavy chains in both chambers and only the atrium, respectively. This could highlight cardiac defects that are not visible under normal stereomicroscopy conditions. Mutation of lmod2a and lmod2b in zebrafish both result in cardiac abnormalities, which suggests that these genes are not functionally redundant, and each plays a specific role in cardiac function. Based on this observation, we will further investigate the genetic networks by conducting a double knockdown of lmod2a/lmod2b. We will analyze the double knockdown crispants to continue understanding the molecular mechanisms of DCM. Creating a stable mutant line in the future will allow us to evaluate any defects that occur through adulthood and calculate survival rate.
","references":[{"reference":"Blum Y, Belting HG, Ellertsdottir E, Herwig L, Lüders F, Affolter M. 2008. Complex cell rearrangements during intersegmental vessel sprouting and vessel fusion in the zebrafish embryo. Developmental Biology 316: 312-322.
","pubmedId":"","doi":"10.1016/j.ydbio.2008.01.038"},{"reference":"Conley CA, Fritz-Six KL, Almenar-Queralt A, Fowler VM. 2001. Leiomodins: Larger Members of the Tropomodulin (Tmod) Gene Family. Genomics 73: 127-139.
","pubmedId":"","doi":"10.1006/geno.2000.6501"},{"reference":"Jordan E, Peterson L, Ai T, Asatryan B, Bronicki L, Brown E, et al., Hershberger. 2021. Evidence-Based Assessment of Genes in Dilated Cardiomyopathy. Circulation 144: 7-19.
","pubmedId":"","doi":"10.1161/CIRCULATIONAHA.120.053033"},{"reference":"Oxtoby E, Jowett T. 1993. Cloning of the zebrafishkrox-20gene (krx-20) and its expression during hindbrain development. Nucleic Acids Research 21: 1087-1095.
","pubmedId":"","doi":"10.1093/nar/21.5.1087"},{"reference":"Pappas CT, Mayfield RM, Dickerson AE, Mi-Mi L, Gregorio CC. 2024. Human disease-causing mutations result in loss of leiomodin 2 through nonsense-mediated mRNA decay. PLOS Genetics 20: e1011279.
","pubmedId":"","doi":"10.1371/journal.pgen.1011279"},{"reference":"Pappas CT, Mayfield RM, Henderson C, Jamilpour N, Cover C, Hernandez Z, et al., Gregorio. 2015. Knockout of Lmod2 results in shorter thin filaments followed by dilated cardiomyopathy and juvenile lethality. Proceedings of the National Academy of Sciences 112: 13573-13578.
","pubmedId":"","doi":"10.1073/pnas.1508273112"},{"reference":"Patton EE, Zon LI, Langenau DM. 2021. Zebrafish disease models in drug discovery: from preclinical modelling to clinical trials. Nature Reviews Drug Discovery 20: 611-628.
","pubmedId":"","doi":"10.1038/s41573-021-00210-8"},{"reference":"Schumacher JA, Wright ZA, Owen ML, Bredemeier NO, Sumanas S. 2020. Integrin α5 and Integrin α4 cooperate to promote endocardial differentiation and heart morphogenesis. Developmental Biology 465: 46-57.
","pubmedId":"","doi":"10.1016/j.ydbio.2020.06.006"},{"reference":"Shoureshi P, Tan AY, Koneru J, Ellenbogen KA, Kaszala K, Huizar JF. 2024. Arrhythmia-Induced Cardiomyopathy. Journal of the American College of Cardiology 83: 2214-2232.
","pubmedId":"","doi":"10.1016/j.jacc.2024.03.416"},{"reference":"Tsukada T, Pappas CT, Moroz N, Antin PB, Kostyukova AS, Gregorio CC. 2010. Leiomodin-2 is an antagonist of tropomodulin-1 at the pointed end of the thin filaments in cardiac muscle. Journal of Cell Science 123: 3136-3145.
","pubmedId":"","doi":"10.1242/jcs.071837"},{"reference":"Wu RS, Lam II, Clay H, Duong DN, Deo RC, Coughlin SR. 2018. A Rapid Method for Directed Gene Knockout for Screening in G0 Zebrafish. Developmental Cell 46: 112-125.e4.
","pubmedId":"","doi":"10.1016/j.devcel.2018.06.003"},{"reference":"Wu T, Mu Y, Bogomolovas J, Fang X, Veevers J, Nowak RB, et al., Chen. 2017. HSPB7 is indispensable for heart development by modulating actin filament assembly. Proceedings of the National Academy of Sciences 114: 11956-11961.
","pubmedId":"","doi":"10.1073/pnas.1713763114"},{"reference":"Ye X, Jia H, Zu Y. 2025. lmod2a mutations affect F-actin and SRF pathway leading to cardiac dysfunction in zebrafish. Developmental Biology 525: 306-316.
","pubmedId":"","doi":"10.1016/j.ydbio.2025.06.002"}],"title":"Novel leiomodin 2b crispant zebrafish as a model for dilated cardiomyopathy
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"f314910d-c7fa-4d99-af78-230d3004c88d","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}