According to FlyBase, The Drosophila melanogaster (fruit fly) Neprilysin-like 15 (Nepl15) gene has only one annotated transcript and a 686-amino acid-long protein. However, Nepl15 transcripts exhibit organ- and sex-specific differential expression, and Nepl15 knock-out mutation results in sex-dependent contrasting phenotypes. Thus, we investigated whether unreported sex-specific Nepl15 transcripts exist. Our sequencing results of Nepl15 cDNA synthesized from the Oregon-R adult male and female RNA samples show a few changes in the codons, which alter the amino acid sequences in our samples. However, the changes do not impact the subcellular localization or overall Nepl15 protein structure as determined by bioinformatics analyses.
","acknowledgements":"We would like to thank the Texas Tech University (TTU) TrUE Scholars Undergraduate Research Program for supporting Chase Drucker with funding for reagents. American Heart Association (AHA) SURE (Supporting Undergraduate Research Experiences) scholars' program coordinated by Dr. Peter Keyel, Associate Professor of Biological Sciences at TTU, for supporting Chase with a Summer Research Internship and a travel award for presenting this work at the Scientific Sessions Conference 2025 organized by AHA. We also thank Dr. Surya Banerjee’s research lab members, Shahira Arzoo and Rubaia Tasmin, for their insights and help during this project.
","authors":[{"affiliations":["Texas Tech University System, Lubbock, TX, US"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","methodology","software","writing_originalDraft"],"email":"cdrucker@ttu.edu","firstName":"Chase ","lastName":"Drucker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-6444-5259"},{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","investigation","methodology","formalAnalysis","validation","writing_reviewEditing","fundingAcquisition","supervision"],"email":"surya.banerjee@ttu.edu","firstName":"Surya Jyoti","lastName":"Banerjee","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7196-4315 "}],"awards":[{"awardId":"24SURE1331544","funderName":"American Heart Association (United States)","awardRecipient":"Chase Drucker"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":null,"extendedData":[],"funding":"Financial support for this project was provided by the American Heart Association (24SURE1331544), and Texas Tech University TrUE Scholars. This project is mainly funded by the Texas Tech University faculty start-up funds provided to Dr. Surya Jyoti Banerjee.
","image":{"url":"https://portal.micropublication.org/uploads/b70e1377dfda9e42e8d8ee28471ca7ea.png"},"imageCaption":"(A) Multiple protein sequence alignment of Nep1 (typical Nep in fruit fly), FlyBase (FB) Nepl15, and Oregon-R Nepl15 protein sequences shows FBNepl15 and Oregon-R Nepl15 proteins lack the (684) HEXXH and (746) EXXH catalytic motifs that are present in Neprilysin1 (Nep1). Additionally, 5 amino acids are different in the Oregon-R Nepl15 protein (at 15, 18, 199, 239, and 567 positions) from the FB Nepl15 protein sequence (see Table 2). Colored boxes indicate altered amino acid residues in Oregon-R Nepl15 protein relative to FB Nepl15 protein: (blue) indicating the original residue, (green) designating no change at the amino acid residue even though nucleotide sequence was altered, and (red) representing altered amino acid residues. The numbers underneath each colored residue correspond to the amino acid position on the Nepl15 protein sequence. (B) Predicted 3D protein model of FB Nepl15. The box plot shows a predicted aligned errors (PAE) plot, mapping the expected positional error (Å) between pairs of residues, generated by AlphaFold 3. 3D model residues and PAE plot are colored and indicated in the provided key, in which lower values (blue) indicate higher levels of confidence. (C1-3) Predicted 3D model of Oregon-R Nepl15 protein overlapped with the predicted 3D FB Nepl15 protein structure. Three images display different angles of these two overlapping proteins, without indicating any major change in the Oregon-R Nepl15 protein structure despite the 5 amino acid changes. Three different angles of these two overlapping proteins, without indicating any major change in the Oregon-R Nepl15 protein structure, despite the 5 amino acid changes.
","imageTitle":"(A) Multiple protein sequence alignment by Clustal Omega. FBNep1 (the Drosophila melanogaster typical Neprilysin1 protein sequence from FlyBase), FBNepl15 (FlyBase Nepl15 protein sequence), ORNepl15F or ORNepl15M (newly sequenced Oregon-R Nepl15 protein sequences from Female or Male adult flies). (B) Predicted 3D protein structure of Oregon-R Nepl15 protein made by AlphaFold. (C1, C2, C3) 3D protein structure alignment of Oregon-R Nepl15 protein to FBNepl15 protein.
","methods":"Drosophila melanogaster husbandry
Drosophila melanogaster Oregon-R (OR) strain was maintained on Bloomington's fly food formulation (Genesee Sc Nutri-Fly_66-116) at 25 °C. 5 to 7 days old male and virgin female adult flies were used for RNA extraction.
RNA isolation and cDNA synthesis
Total RNA was extracted from 5 to 7 days old, 25 male and 25 virgin female Oregon-R adult flies using TRI reagent (Sigma T9424) (Banerjee et al., 2021). The RNA sample purity was validated by measuring 260/280 and 230/280 ratios, and the RNA integrity was tested by gel electrophoresis. The cDNA synthesis was then performed using 5x iScript Reaction Mix (Bio-Rad 1708889) following the manufacturer's protocol.
PCR and Purification
Specific forward (FP) and reverse primer (RP) pairs (Table 3) were designed using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021)to amplify Nepl15 CDS and Transcript using the OR male and female cDNA templates separately. The primer sequences were designed based on the FlyBase Nepl15 CDS and Transcript sequences. PCR was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs M0492S) following the manufacturer's protocol. The PCR products were purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel 740609) following the manufacturer's instructions.
DNA Sequencing Analysis
We designed several primers (listed in Table 4) to cover the entire length of the Nepl15 CDS or transcript. Sanger sequencing of the purified PCR samples was performed by Azenta Life Sciences (genewiz.com). The high-quality sequence contigs were aligned to the corresponding FlyBase sequence using Serial Cloner (v2.6.1) (Branco & Choupina, 2021).
Protein sequence analysis and other bioinformatics analysis
Changes in the Oregon-R Nepl15 CDS sequences compared to the FlyBase sequence were identified using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021). Variations in the Nepl15 codon sequences between Oregon-R CDS and FlyBase CDS sequences were analyzed using Serial Cloner's built-in BLASTn and BLASTp alignment tools. Next, Clustal Omega (Madeira et al., 2024) was used to align the FlyBase Neprilysin 1 (DmNep1, a typical fly neprilysin, orthologous to human neprilysin), Oregon-R male and female Nepl15, and FlyBase Nepl15 protein sequences to identify changes in Oregon-R Nepl15 protein sequences. The newly sequenced Oregon-R Nepl15 protein sequence was analyzed for any change in its subcellular localization, signal sequence site, and 3D structure compared to those of the FlyBase-reported Nepl15 protein sequence using different bioinformatics tools like DeepLoc2.1 (Ødum et al., 2024), SignalP – 6.0 (Teufel et al., 2022), and DeepTMHMM – 1.0 (Hallgren et al., 2022), respectively.
Table 3. List of primers used for PCR.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP | ATGGCCTCTCAACCGCTTG |
Nepl15_CDS_RP | TCAGTAGAGAGTGCACTTAAAGCG |
Nepl15_T.SCRPT_FP | CCCGCTCAGTTTCGTTTC |
Nepl15_T.SCRPT_RP | ATGACAAGTGCAACAAATGCTTTT |
Table 4. List of primers used for sequencing.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP1 | TGAAACGCAAGCTTGGCGTG |
Nepl15_CDS_FP2 | GCTTTGGAAGCGTTGGATAT |
Nepl15_CDS_FP3 | TGGAATACAAGGGTAAGCCG |
Nepl15_CDS_RP1 | TATTCAGGGCGGATCGCGTG |
Nepl15_T.SCRPT_FP1 | GGTTGGCCGGAGATTCGTGT |
Nepl15_T.SCRPT_FP2 | CATGTCAAATCTGGTGGATG |
Nepl15_T.SCRPT_FP3 | TGGGATCACACCTCGGAGAG |
Nepl15_T.SCRPT_RP1 | GGCACTGTTCTCAGCTCCTC |
","reagents":"
All reagents' names, with the company names and catalog numbers, are mentioned in the methods.
","patternDescription":"Neprilysins (neutral endopeptidases; Neps) belong to the M13 family of Zinc (II) dependent metallopeptidases and were first discovered in mammals (Turner et al., 2001). Typical mammalian Neps, including human Neprilysin (HsNep) encoded by the MME (Membrane Metalloendopeptidase) gene, have a short cytoplasmic N-terminal domain, a shorter hydrophobic transmembrane domain, and a long extracellular C-terminal domain that houses highly conserved motifs. Two of these motifs, HEXXH and EXXAD, are responsible for Zn (II) binding and the subsequent proteolytic cleavage of substrate peptides, typically occurring at the N-terminal side of a hydrophobic residue with a strong preference for Phe or Leu toward the C-terminus (Nalivaeva & Turner, 2013; Sitnik et al., 2014; Turner et al., 2000).
Typical mammalian Neps are normally expressed in a variety of cell types, including brush border cells of the kidneys, brain, neutrophils, lungs, synapses, along with adipocytes and smooth muscle cells present throughout gut tissue, to name a few. Neprilysin cleaves an array of peptides and controls cellular signals that impact the nervous, cardiovascular, inflammatory, immune systems, and nutrient homeostasis (Schling & Schäfer, 2002; Turner et al., 2001).
Phylogenetic studies have identified the presence of Nep orthologs in invertebrate organisms, including Drosophila melanogaster (Bland et al., 2008; Sitnik et al., 2014). Drosophila melanogaster contains 28 identified neprilysin and neprilysin-like genes (Meyer et al., 2021). Among them, Neprilysin-like 15 (Nepl15), a predicted secreted, catalytically inactive Nep, regulates glycogen and lipid storage in a sex-dependent manner. Previous work with Nepl15ko (knock-out) flies revealed that glycogen and triacylglyceride (TAG) storage were significantly reduced in adult male mutant flies, while significantly more glycogen storage was observed in adult female mutants, albeit the mutants consume the same amount of food as the controls (Banerjee et al., 2021). Interestingly, Banerjee et at., (2021) and transcriptomics data from FlyAtlas2 (Leader et al., 2018) showed that the Nepl15 transcript is differentially expressed in both larval and adult fly organs, with higher expression in larval fat body and adult head, heart, and fat body. Overall, FlyAtlas shows that the whole adult male body expresses 4.2 times more Nepl15 than the whole adult female body. Additionally, overexpression of Nepl15 in the fat body increased triglyceride levels only, whereas its overexpression in the gut increased glycogen levels only in adult male flies, suggesting Nepl15 has tissue-specific variable effects (Banerjee et al., 2021). Interestingly, the fly database (FlyBase.org) reports that the Nepl15 gene in D. melanogaster ISO1 MT (dm6) (y1; cn1; bw1; sp1) strain has no intron and produces only one transcript. However, 10 other fly Neprilysin and Neprilysin-like genes encode more than one transcript (Table 1).
Table 1. List of Neprilysins and the corresponding number of transcripts and unique polypeptides they produce.
Symbol | Name | Number of Transcripts | Number of Polypeptides |
Nep1 | Neprilysin 1 | 4 | 4 |
Nep2 | Neprilysin 2 | 3 | 3 |
Nep3 | Neprilysin 3 | 3 | 3 |
Nep4 | Neprilysin 4 | 3 | 3 |
Nep5 | Neprilysin 5 | 4 | 4 |
Nep6 | Neprilysin 6 | 2 | 2 |
Nep7 | Neprilysin 7 | 1 | 1 |
frma | fra mauro | 2 | 2 |
goe | gone early | 3 | 3 |
Nepl3 | Neprilysin-like 3 | 1 | 1 |
Nepl4 | Neprilysin-like 4 | 1 | 1 |
Nepl5 | Neprilysin-like 5 | 1 | 1 |
Nepl6 | Neprilysin-like 6 | 1 | 1 |
Nepl7 | Neprilysin-like 7 | 2 | 2 |
Nepl8 | Neprilysin-like 8 | 1 | 1 |
Nepl9 | Neprilysin-like 9 | 1 | 1 |
Nepl10 | Neprilysin-like 10 | 1 | 1 |
Nepl11 | Neprilysin-like 11 | 2 | 2 |
Nepl12 | Neprilysin-like 12 | 1 | 1 |
Nepl13 | Neprilysin-like 13 | 1 | 1 |
Nepl14 | Neprilysin-like 14 | 1 | 1 |
Nepl15 | Neprilysin-like 15 | 1 | 1 |
Nepl16 | Neprilysin-like 16 | 1 | 1 |
Nepl17 | Neprilysin-like 17 | 1 | 1 |
Nepl18 | Neprilysin-like 18 | 1 | 1 |
Nepl19 | Neprilysin-like 19 | 1 | 1 |
Nepl20 | Neprilysin-like 20 | 1 | 1 |
Nepl21 | Neprilysin-like 21 | 1 | 1 |
Therefore, we asked the following questions: Are there any unreported Nepl15 transcript variants present in wild-type (Oregon-R) adult male and female flies that produce different Nepl15 protein isoforms in the two sexes? Are there any differences in the 5′and 3′untranslated regions (UTRs) in the Nepl15 transcript which may contribute to its post-transcriptional regulation? To answer these questions, we isolated total RNA from the whole-body of adult male and virgin female Oregon-R flies (FBsn0000276) and synthesized cDNA. Next, we took PCR based approach to amplify the Nepl15 CDS (coding sequence, 2061 bps) and its transcript (2213 bps including the 5′and 3′UTRs), followed by sequencing them and aligning the sequences with the corresponding sequences in FlyBase.
Our sequencing results show that the Oregon-R Nepl15 CDS from male and female flies contains the exact 7-nucleotide sequence changes compared to the FlyBase sequence. These changes translate into only 5 amino acid changes (Table 2), among which 3 changes include amino acids with different properties. However, we did not find any nucleotide sequence difference at the 5′and 3′UTRs of the Oregon-R and FlyBase Nepl15 transcript sequences. Further bioinformatics analysis of the Oregon-R Nepl15 protein reveals that the amino acid changes did not impact the Nepl15 predicted cleavage site (between amino acid 22 & 23) (SignalIP and DeepTMHMM) (Hallgren et al., 2022; Teufel et al., 2022), and extracellular localization (DeepLoc) (Ødum et al., 2024). Additional analysis of the 3D model of the Oregon-R Nepl15 protein utilizing AlphaFold 3 (Abramson et al., 2024) shows no significant change in its structure compared to the FlyBase Nepl15 protein structure.
Table 2. Nucleotide and amino acid sequencing alterations in Oregon-R Nepl15 CDS and protein compared to the corresponding FlyBase data.
Genomic Position | Nucleotide Change | Amino Acid Variant | Character Alterations |
3R:22766060 | T → C | F15L | - |
3R:22766049 | C → G | C18W | polar – hydrophobic; aromatic |
3R:22765507 | A → T | Q199L | negatively charged - hydrophobic |
3R:22765387 | G → C | R239T | Positively charged - polar |
3R:22764404 | G → T | V567L | - |
Collectively, these results reveal that a slightly different amino acid sequence in the Nepl15 protein is present in our lab-grown wild-type Oregon-R flies as compared to the FlyBase Nepl15 protein, indicative of a strain-specific amino acid sequence variation in the same protein. Bioinformatic analyses do not indicate any major structural or functional shift in the Oregon-R Nepl15 protein due to these changes. Thus, our study confirms the presence of only one Nepl15 transcript version in D. melanogaster Oregon R adult male and female flies. Although, the changes in the nucleotide sequences within the Oregon-R Nepl15 codons and corresponding amino acid changes in the Nepl15 protein may not impact the protein's localization, structure, and function, still our research outcome can contribute to future investigations in two significant ways: (a) this report will help to perform primer design, PCR, qPCR, gene cloning, guide DNA design for CRISPR, and site specific mutation accurately for Nepl15 gene in Oregon R fly strain; and (ii) if researchers use a Drosophila species or strain other than the one used in a database or previously published work, our result recommends that it is important to verify the DNA sequence before designing the components of molecular biology based experiments.
","references":[{"reference":"Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al., Jumper JM. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 630: 493-500. 1503.","pubmedId":"38718835","doi":"10.1038/s41586-024-07487-w"},{"reference":"Banerjee S, Woods C, Burnett M, Park SJ, Ja WW, Curtiss J. 2021. The Drosophila melanogaster Neprilysin Nepl15 is involved in lipid and carbohydrate storage. Sci Rep. 11: 2099. 1497.","pubmedId":"33483521","doi":"10.1038/s41598-021-81165-z"},{"reference":"Bland ND, Pinney JW, Thomas JE, Turner AJ, Isaac RE. 2008. Bioinformatic analysis of the neprilysin (M13) family of peptidases reveals complex evolutionary and functional relationships. BMC Evol Biol. 8: 16. 1494.","pubmedId":"18215274","doi":"10.1186/1471-2148-8-16"},{"reference":"Branco I, Choupina A. 2021. Bioinformatics: new tools and applications in life science and personalized medicine. Appl Microbiol Biotechnol. 105: 937-951. 1011.","pubmedId":"33404829","doi":"10.1007/s00253-020-11056-2"},{"reference":"Hallgren J, Tsirigos KD, Pedersen MD, Almagro Armenteros JJ, Marcatili P, Nielsen H, Krogh A, Winther O. 2022. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. biorxiv: 2022.04. 08.487609. 1512.","pubmedId":"","doi":""},{"reference":"Leader DP, Krause SA, Pandit A, Davies SA, Dow JAT. 2018. FlyAtlas 2: a new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46: D809-D815. 1498.","pubmedId":"29069479","doi":"10.1093/nar/gkx976"},{"reference":"Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. 2024. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 52: W521-W525. 1507.","pubmedId":"38597606","doi":"10.1093/nar/gkae241"},{"reference":"Meyer H, Buhr A, Callaerts P, Schiemann R, Wolfner MF, Marygold SJ. 2021. Identification and bioinformatic analysis of neprilysin and neprilysin-like metalloendopeptidases in. MicroPubl Biol. 2021 1496.","pubmedId":"34189422","doi":"10.17912/micropub.biology.000410"},{"reference":"Nalivaeva NN, Turner AJ. 2013. Neprilysin (Chapter 127), Handbook of Proteolytic Enzymes. 1491.","pubmedId":"","doi":""},{"reference":"Schling P, Schafer T. 2002. Human adipose tissue cells keep tight control on the angiotensin II levels in their vicinity. J Biol Chem. 277: 48066-75. 1492.","pubmedId":"12196514","doi":"10.1074/jbc.M204058200"},{"reference":"Sitnik JL, Francis C, Hens K, Huybrechts R, Wolfner MF, Callaerts P. 2014. Neprilysins: an evolutionarily conserved family of metalloproteases that play important roles in reproduction in Drosophila. Genetics. 196: 781-97. 1489.","pubmedId":"24395329","doi":"10.1534/genetics.113.160945"},{"reference":"Teufel F, Almagro Armenteros JJ, Johansen AR, Gislason MH, Pihl SI, Tsirigos KD, et al., Nielsen H. 2022. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol. 40: 1023-1025. 1501.","pubmedId":"34980915","doi":"10.1038/s41587-021-01156-3"},{"reference":"Turner AJ, Brown CD, Carson JA, Barnes K. 2000. The neprilysin family in health and disease. Adv Exp Med Biol. 477: 229-40. 1490.","pubmedId":"10849750","doi":"10.1007/0-306-46826-3_25"},{"reference":"Turner AJ, Isaac RE, Coates D. 2001. The neprilysin (NEP) family of zinc metalloendopeptidases: genomics and function. Bioessays. 23: 261-9. 1488.","pubmedId":"11223883","doi":"10.1002/1521-1878(200103)23:3<261::AID-BIES1036>3.0.CO;2-K"},{"reference":"Odum MT, Teufel F, Thumuluri V, Almagro Armenteros JJ, Johansen AR, Winther O, Nielsen H. 2024. DeepLoc 2.1: multi-label membrane protein type prediction using protein language models. Nucleic Acids Res. 52: W215-W220. 1511.","pubmedId":"38587188","doi":"10.1093/nar/gkae237"}],"title":"Identification of Drosophila melanogaster Strain-Specific Sequence Variations in the Nepl15 Transcript of Oregon-R relative to FlyBase Data
","reviews":[{"reviewer":{"displayName":"Mardelle Atkins"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":"1777271047347"}]},{"id":"4be3b53e-65f7-4e20-9286-5e062b8b5e8b","decision":"accept","abstract":"According to FlyBase, The Drosophila melanogaster (fruit fly) Neprilysin-like 15 (Nepl15) gene has only one annotated transcript and a 686-amino acid-long protein. However, Nepl15 transcripts exhibit organ- and sex-specific differential expression, and Nepl15 knock-out mutation results in sex-dependent contrasting phenotypes. Thus, we investigated whether unreported sex-specific Nepl15 transcripts exist. Our sequencing results of Nepl15 cDNA synthesized from the Oregon-R adult male and female RNA samples show a few changes in the codons, which alter the amino acid sequences in our samples. However, the changes do not impact the subcellular localization or overall Nepl15 protein structure as determined by bioinformatics analyses.
","acknowledgements":"We would like to thank the Texas Tech University (TTU) TrUE Scholars Undergraduate Research Program for supporting Chase Drucker with funding for reagents. American Heart Association (AHA) SURE (Supporting Undergraduate Research Experiences) scholars' program coordinated by Dr. Peter Keyel, Associate Professor of Biological Sciences at TTU, for supporting Chase with a Summer Research Internship and a travel award for presenting this work at the Scientific Sessions Conference 2025 organized by AHA. We also thank Dr. Surya Banerjee’s research lab members, Shahira Arzoo and Rubaia Tasmin, for their insights and help during this project.
","authors":[{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","methodology","software","writing_originalDraft"],"email":"cdrucker@ttu.edu","firstName":"Chase ","lastName":"Drucker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-6444-5259"},{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","investigation","methodology","formalAnalysis","validation","writing_reviewEditing","fundingAcquisition","supervision"],"email":"surya.banerjee@ttu.edu","firstName":"Surya Jyoti","lastName":"Banerjee","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7196-4315 "}],"awards":[{"awardId":"24SURE1331544","funderName":"American Heart Association (United States)","awardRecipient":"Chase Drucker"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Financial support for this project was provided by the American Heart Association (24SURE1331544), and Texas Tech University TrUE Scholars. This project is mainly funded by the Texas Tech University faculty start-up funds provided to Dr. Surya Jyoti Banerjee.
","image":{"url":"https://portal.micropublication.org/uploads/d97da44e9e50756bdb1b232a19e644ea.jpg"},"imageCaption":"Figure 1A. Multiple protein sequence alignment by ClustalW. FBNep1 (the Drosophila melanogaster typical Neprilysin1 protein sequence from FlyBase), FBNepl15 (FlyBase Nepl15 protein sequence), ORNepl15F or ORNepl15M (newly sequenced Oregon-R Nepl15 protein sequences from Female or Male adult flies). Multiple protein sequence alignment of Nep1 (typical Nep in fruit fly), FlyBase (FB) Nepl15, and Oregon-R Nepl15 protein sequences show FBNepl15 and Oregon-R Nepl15 proteins lack the (684) HEXXH and (746) EXXH catalytic motifs that are present in Neprilysin1 (Nep1). Additionally, 5 amino acids are different in the Oregon-R Nepl15 protein (at 15, 18, 199, 239, and 567 positions) from the FB Nepl15 protein sequence (see Table 2). Colored boxes indicate altered amino acid residues in Oregon-R Nepl15 protein relative to FB Nepl15 protein: (blue) indicating the original residue, (green) designating no change at the amino acid residue even though nucleotide sequence was altered, and (red) representing altered amino acid residues. The numbers underneath each colored residue correspond to the amino acid position on the Nepl15 protein sequence. Figure 1B. Predicted 3D protein structure of FB Nepl15 protein made by AlphaFold 3. The box plot shows a predicted aligned errors (PAE) plot, mapping the expected positional error (Å) between pairs of residues, generated by AlphaFold 3. 3D model residues and PAE plot are colored and indicated in the provided key, in which lower values (blue) indicate higher levels of confidence. Figures C1, C2, and C3. Overlay of the 3D models of FBNepl15 (blue) and Oregon-R Nepl15 (purple) proteins from three different angles, as generated by AlphaFold 3. Three images display different angles of these two overlapping proteins, without indicating any major change in the Oregon-R Nepl15 protein structure despite the 5 amino acid changes.
","imageTitle":"Alignment of FlyBase Nep1, Nepl15 and Oregon-R Nepl15 protein sequences, and predicted 3D structures of FlyBase and Oregon-R Nepl15 proteins
","methods":"Drosophila melanogaster husbandry
Drosophila melanogaster Oregon-R (OR) strain was maintained on Bloomington's fly food formulation (Genesee Sc Nutri-Fly_66-116) at 25 °C. 5 to 7 days old male and virgin female adult flies were used for RNA extraction.
FlyBase Data:
The FlyBase website, http://flybase.org, was used to retrieve the Nepl15 transcript and CDS sequences. The genome release number is FB2026_01 (March 12, 2026).
RNA isolation and cDNA synthesis
Total RNA was extracted from 5 to 7 days old, 25 male and 25 virgin female Oregon-R adult flies using TRI reagent (Sigma T9424) (Banerjee et al., 2021). The RNA sample purity was validated by measuring 260/280 and 230/280 ratios, and the RNA integrity was tested by gel electrophoresis. The cDNA synthesis was then performed using 5x iScript Reaction Mix (Bio-Rad 1708889) following the manufacturer's protocol.
PCR and Purification
Specific forward (FP) and reverse primer (RP) pairs (Table 3) were designed using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021)to amplify Nepl15 CDS and Transcript using the OR male and female cDNA templates separately. The primer sequences were designed based on the FlyBase Nepl15 CDS and Transcript sequences. PCR was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs M0492S) following the manufacturer's protocol. The PCR products were purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel 740609) following the manufacturer's instructions.
DNA Sequencing Analysis
We designed several primers (listed in Table 4) to cover the entire length of the Nepl15 CDS or transcript. Sanger sequencing of the purified PCR samples was performed by Azenta Life Sciences (genewiz.com). The high-quality sequence contigs were aligned to the corresponding FlyBase sequence using Serial Cloner (v2.6.1) (Branco & Choupina, 2021).
Protein sequence analysis and other bioinformatics analysis
Changes in the Oregon-R Nepl15 CDS sequences compared to the FlyBase sequence were identified using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021). Variations in the Nepl15 codon sequences between Oregon-R CDS and FlyBase CDS sequences were analyzed using Serial Cloner's built-in BLASTn and BLASTp alignment tools. Next, Clustal Omega (Madeira et al., 2024) was used to align the FlyBase Neprilysin 1 (DmNep1, a typical fly neprilysin, orthologous to human neprilysin), Oregon-R male and female Nepl15, and FlyBase Nepl15 protein sequences to identify changes in Oregon-R Nepl15 protein sequences. The newly sequenced Oregon-R Nepl15 protein sequence was analyzed for any change in its subcellular localization, signal sequence site, and 3D structure compared to those of the FlyBase-reported Nepl15 protein sequence using different bioinformatics tools like DeepLoc2.1 (Ødum et al., 2024), SignalP – 6.0 (Teufel et al., 2022), and DeepTMHMM – 1.0 (Hallgren et al., 2022), respectively.
Table 3. List of primers used for PCR.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP | ATGGCCTCTCAACCGCTTG |
Nepl15_CDS_RP | TCAGTAGAGAGTGCACTTAAAGCG |
Nepl15_T.SCRPT_FP | CCCGCTCAGTTTCGTTTC |
Nepl15_T.SCRPT_RP | ATGACAAGTGCAACAAATGCTTTT |
Table 4. List of primers used for sequencing.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP1 | TGAAACGCAAGCTTGGCGTG |
Nepl15_CDS_FP2 | GCTTTGGAAGCGTTGGATAT |
Nepl15_CDS_FP3 | TGGAATACAAGGGTAAGCCG |
Nepl15_CDS_RP1 | TATTCAGGGCGGATCGCGTG |
Nepl15_T.SCRPT_FP1 | GGTTGGCCGGAGATTCGTGT |
Nepl15_T.SCRPT_FP2 | CATGTCAAATCTGGTGGATG |
Nepl15_T.SCRPT_FP3 | TGGGATCACACCTCGGAGAG |
Nepl15_T.SCRPT_RP1 | GGCACTGTTCTCAGCTCCTC |
","reagents":"
All reagents' names, with the company names and catalog numbers, are mentioned in the methods.
","patternDescription":"Neprilysins (neutral endopeptidases; Neps) belong to the M13 family of Zinc (II) dependent metallopeptidases and were first discovered in mammals (Turner et al., 2001). Typical mammalian Neps, including human Neprilysin (HsNep) encoded by the MME (Membrane Metalloendopeptidase) gene, have a short cytoplasmic N-terminal domain, a shorter hydrophobic transmembrane domain, and a long extracellular C-terminal domain that houses highly conserved motifs. Two of these motifs, HEXXH and EXXAD, are responsible for Zn (II) binding and the subsequent proteolytic cleavage of substrate peptides, typically occurring at the N-terminal side of a hydrophobic residue with a strong preference for Phe or Leu toward the C-terminus (Nalivaeva & Turner, 2013; Sitnik et al., 2014; Turner et al., 2000).
Typical mammalian Neps are normally expressed in a variety of cell types, including brush border cells of the kidneys, brain, neutrophils, lungs, synapses, along with adipocytes and smooth muscle cells present throughout gut tissue, to name a few. Neprilysin cleaves an array of peptides and controls cellular signals that impact the nervous, cardiovascular, inflammatory, immune systems, and nutrient homeostasis (Schling & Schäfer, 2002; Turner et al., 2001).
Phylogenetic studies have identified the presence of Nep orthologs in invertebrate organisms, including Drosophila melanogaster (Bland et al., 2008; Sitnik et al., 2014). Drosophila melanogaster contains 28 identified neprilysin and neprilysin-like genes (Meyer et al., 2021). Among them, Neprilysin-like 15 (Nepl15), a predicted secreted, catalytically inactive Nep, regulates glycogen and lipid storage in a sex-dependent manner. Previous work with Nepl15ko (knock-out) flies revealed that glycogen and triacylglyceride (TAG) storage were significantly reduced in adult male mutant flies, while significantly more glycogen storage was observed in adult female mutants, albeit the mutants consume the same amount of food as the controls (Banerjee et al., 2021). Interestingly, Banerjee et at., (2021) and transcriptomics data from FlyAtlas2 (Leader et al., 2018) showed that the Nepl15 transcript is differentially expressed in both larval and adult fly organs, with higher expression in larval fat body and adult head, heart, and fat body. Overall, FlyAtlas shows that the whole adult male body expresses 4.2 times more Nepl15 than the whole adult female body. Additionally, overexpression of Nepl15 in the fat body increased triglyceride levels only, whereas its overexpression in the gut increased glycogen levels only in adult male flies, suggesting Nepl15 has tissue-specific variable effects (Banerjee et al., 2021). Interestingly, the fly database (FlyBase.org) reports that the Nepl15 gene in D. melanogaster ISO1 MT (dm6) (y1; cn1; bw1; sp1) strain has no intron and produces only one transcript. However, 10 other fly Neprilysin and Neprilysin-like genes encode more than one transcript (Table 1) (FlyBase.org).
Table 1. List of Neprilysins and the corresponding number of transcripts and unique polypeptides they produce.
Symbol | Name | Number of Transcripts | Number of Polypeptides |
Nep1 | Neprilysin 1 | 4 | 4 |
Nep2 | Neprilysin 2 | 3 | 3 |
Nep3 | Neprilysin 3 | 3 | 3 |
Nep4 | Neprilysin 4 | 3 | 3 |
Nep5 | Neprilysin 5 | 4 | 4 |
Nep6 | Neprilysin 6 | 2 | 2 |
Nep7 | Neprilysin 7 | 1 | 1 |
frma | fra mauro | 2 | 2 |
goe | gone early | 3 | 3 |
Nepl3 | Neprilysin-like 3 | 1 | 1 |
Nepl4 | Neprilysin-like 4 | 1 | 1 |
Nepl5 | Neprilysin-like 5 | 1 | 1 |
Nepl6 | Neprilysin-like 6 | 1 | 1 |
Nepl7 | Neprilysin-like 7 | 2 | 2 |
Nepl8 | Neprilysin-like 8 | 1 | 1 |
Nepl9 | Neprilysin-like 9 | 1 | 1 |
Nepl10 | Neprilysin-like 10 | 1 | 1 |
Nepl11 | Neprilysin-like 11 | 2 | 2 |
Nepl12 | Neprilysin-like 12 | 1 | 1 |
Nepl13 | Neprilysin-like 13 | 1 | 1 |
Nepl14 | Neprilysin-like 14 | 1 | 1 |
Nepl15 | Neprilysin-like 15 | 1 | 1 |
Nepl16 | Neprilysin-like 16 | 1 | 1 |
Nepl17 | Neprilysin-like 17 | 1 | 1 |
Nepl18 | Neprilysin-like 18 | 1 | 1 |
Nepl19 | Neprilysin-like 19 | 1 | 1 |
Nepl20 | Neprilysin-like 20 | 1 | 1 |
Nepl21 | Neprilysin-like 21 | 1 | 1 |
Therefore, we asked the following questions: Are there any unreported Nepl15 transcript variants present in wild-type (Oregon-R) adult male and female flies that produce different Nepl15 protein isoforms in the two sexes? Are there any differences in the 5′and 3′untranslated regions (UTRs) in the Nepl15 transcript which may contribute to its post-transcriptional regulation? To answer these questions, we isolated total RNA from the whole-body of adult male and virgin female Oregon-R flies (FBsn0000276) and synthesized cDNA. Next, we took PCR based approach to amplify the Nepl15 CDS (coding sequence, 2061 bps) and its transcript (2213 bps including the 5′and 3′UTRs), followed by sequencing them and aligning the sequences with the corresponding sequences in FlyBase.
We did not find any nucleotide sequence difference at the 5′ and 3′UTRs of the Oregon-R and FlyBase Nepl15 transcript sequences. However, sequencing results show that the Oregon-R Nepl15 CDS from male and female flies contains the exact 7-nucleotide sequence changes compared to the FlyBase sequence. These changes translate into only 5 amino acid changes, among which 3 changes include amino acids with different properties (Table 2) (Figure 1A). The Oregon-R adult male and female Nepl15 (ORNepl15M and ORNepl15F) protein sequences were aligned with the FlyBase Neprilysin1 (FBNep1) and Nepl15 (FBNepl15) protein sequences using ClustalW to show the changed 5 amino acid residues (Table 2) (Figure 1A). Further bioinformatics analysis of the Oregon-R Nepl15 protein reveals that the amino acid changes did not impact the Nepl15 predicted cleavage site (between amino acid 22 & 23) (SignalIP and DeepTMHMM) (Hallgren et al., 2022; Teufel et al., 2022), and extracellular localization (DeepLoc) (Ødum et al., 2024). Additional analysis of 3D models of the FlyBase Nepl15 (Figure 1B, blue ribbon diagram) and Oregon-R Nepl15 proteins utilizing AlphaFold 3 (Abramson et al., 2024) shows no significant change in their structures in their overlays (blue and purple ribbon depicts the Nepl15 3D protein models in FlyBase strain and Oregon-R, respectively) (Figures 1 C1 – C3).
Table 2. Nucleotide and amino acid sequencing alterations in Oregon-R Nepl15 CDS and protein compared to the corresponding FlyBase data.
Genomic Position | Nucleotide Change | Amino Acid Variant | Character Alterations |
3R:22766060 | T → C | F15L | - |
3R:22766049 | C → G | C18W | polar – hydrophobic; aromatic |
3R:22765507 | A → T | Q199L | negatively charged - hydrophobic |
3R:22765387 | G → C | R239T | Positively charged - polar |
3R:22764404 | G → T | V567L | - |
Collectively, these results reveal that a slightly different amino acid sequence in the Nepl15 protein is present in our lab-grown wild-type Oregon-R flies as compared to the FlyBase Nepl15 protein, indicative of a strain-specific amino acid sequence variation in the same protein. Bioinformatic analyses do not indicate any major structural or functional shift in the Oregon-R Nepl15 protein due to these changes. Thus, our study confirms the presence of only one Nepl15 transcript version in D. melanogaster Oregon R adult male and female flies. Although, the changes in the nucleotide sequences within the Oregon-R Nepl15 codons and corresponding amino acid changes in the Nepl15 protein may not impact the protein's localization, structure, and function, still our research outcome can contribute to future investigations in two significant ways: (a) this report will help to perform primer design, PCR, qPCR, gene cloning, guide DNA design for CRISPR, and site specific mutation accurately for Nepl15 gene in Oregon R fly strain; and (ii) if researchers use a Drosophila species or strain other than the one used in a database or previously published work, our result recommends that it is important to verify the DNA sequence before designing the components of molecular biology based experiments.
","references":[{"reference":"Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al., Jumper JM. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 630: 493-500. 1503.","pubmedId":"38718835","doi":"10.1038/s41586-024-07487-w"},{"reference":"Banerjee S, Woods C, Burnett M, Park SJ, Ja WW, Curtiss J. 2021. The Drosophila melanogaster Neprilysin Nepl15 is involved in lipid and carbohydrate storage. Sci Rep. 11: 2099. 1497.","pubmedId":"33483521","doi":"10.1038/s41598-021-81165-z"},{"reference":"Bland ND, Pinney JW, Thomas JE, Turner AJ, Isaac RE. 2008. Bioinformatic analysis of the neprilysin (M13) family of peptidases reveals complex evolutionary and functional relationships. BMC Evol Biol. 8: 16. 1494.","pubmedId":"18215274","doi":"10.1186/1471-2148-8-16"},{"reference":"Branco I, Choupina A. 2021. Bioinformatics: new tools and applications in life science and personalized medicine. Appl Microbiol Biotechnol. 105: 937-951. 1011.","pubmedId":"33404829","doi":"10.1007/s00253-020-11056-2"},{"reference":"FB2026_01, http://flybase.org (released 12th March, 2026).
","pubmedId":"","doi":""},{"reference":"Hallgren J, Tsirigos KD, Pedersen MD, Almagro Armenteros JJ, Marcatili P, Nielsen H, Krogh A, Winther O. 2022. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. biorxiv: 2022.04. 08.487609. 1512.","pubmedId":"","doi":""},{"reference":"Leader DP, Krause SA, Pandit A, Davies SA, Dow JAT. 2018. FlyAtlas 2: a new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46: D809-D815. 1498.","pubmedId":"29069479","doi":"10.1093/nar/gkx976"},{"reference":"Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. 2024. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 52: W521-W525. 1507.","pubmedId":"38597606","doi":"10.1093/nar/gkae241"},{"reference":"Meyer H, Buhr A, Callaerts P, Schiemann R, Wolfner MF, Marygold SJ. 2021. Identification and bioinformatic analysis of neprilysin and neprilysin-like metalloendopeptidases in. MicroPubl Biol. 2021 1496.","pubmedId":"34189422","doi":"10.17912/micropub.biology.000410"},{"reference":"Nalivaeva NN, Turner AJ. 2013. Neprilysin (Chapter 127), Handbook of Proteolytic Enzymes. 1491.","pubmedId":"","doi":""},{"reference":"Schling P, Schafer T. 2002. Human adipose tissue cells keep tight control on the angiotensin II levels in their vicinity. J Biol Chem. 277: 48066-75. 1492.","pubmedId":"12196514","doi":"10.1074/jbc.M204058200"},{"reference":"Sitnik JL, Francis C, Hens K, Huybrechts R, Wolfner MF, Callaerts P. 2014. Neprilysins: an evolutionarily conserved family of metalloproteases that play important roles in reproduction in Drosophila. Genetics. 196: 781-97. 1489.","pubmedId":"24395329","doi":"10.1534/genetics.113.160945"},{"reference":"Teufel F, Almagro Armenteros JJ, Johansen AR, Gislason MH, Pihl SI, Tsirigos KD, et al., Nielsen H. 2022. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol. 40: 1023-1025. 1501.","pubmedId":"34980915","doi":"10.1038/s41587-021-01156-3"},{"reference":"Turner AJ, Brown CD, Carson JA, Barnes K. 2000. The neprilysin family in health and disease. Adv Exp Med Biol. 477: 229-40. 1490.","pubmedId":"10849750","doi":"10.1007/0-306-46826-3_25"},{"reference":"Turner AJ, Isaac RE, Coates D. 2001. The neprilysin (NEP) family of zinc metalloendopeptidases: genomics and function. Bioessays. 23: 261-9. 1488.","pubmedId":"11223883","doi":"10.1002/1521-1878(200103)23:3<261::AID-BIES1036>3.0.CO;2-K"},{"reference":"Odum MT, Teufel F, Thumuluri V, Almagro Armenteros JJ, Johansen AR, Winther O, Nielsen H. 2024. DeepLoc 2.1: multi-label membrane protein type prediction using protein language models. Nucleic Acids Res. 52: W215-W220. 1511.","pubmedId":"38587188","doi":"10.1093/nar/gkae237"}],"title":"Identification of Drosophila melanogaster Strain-Specific Sequence Variations in the Nepl15 Transcript of Oregon-R relative to FlyBase Data
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"dfc846e4-16d1-4f4b-b5f4-011165c2dfeb","decision":"revise","abstract":"According to FlyBase, The Drosophila melanogaster (fruit fly) Neprilysin-like 15 (Nepl15) gene has only one annotated transcript and a 686-amino acid-long protein. However, Nepl15 transcripts exhibit organ- and sex-specific differential expression, and Nepl15 knock-out mutation results in sex-dependent contrasting phenotypes. Thus, we investigated whether unreported sex-specific Nepl15 transcripts exist. Our sequencing results of Nepl15 cDNA synthesized from the Oregon-R adult male and female RNA samples show a few changes in the codons, which alter the amino acid sequences in our samples. However, the changes do not impact the subcellular localization or overall Nepl15 protein structure as determined by bioinformatics analyses.
","acknowledgements":"We would like to thank the Texas Tech University (TTU) TrUE Scholars Undergraduate Research Program for supporting Chase Drucker with funding for reagents. American Heart Association (AHA) SURE (Supporting Undergraduate Research Experiences) scholars' program coordinated by Dr. Peter Keyel, Associate Professor of Biological Sciences at TTU, for supporting Chase with a Summer Research Internship and a travel award for presenting this work at the Scientific Sessions Conference 2025 organized by AHA. We also thank Dr. Surya Banerjee’s research lab members, Shahira Arzoo and Rubaia Tasmin, for their insights and help during this project.
","authors":[{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","methodology","software","writing_originalDraft"],"email":"cdrucker@ttu.edu","firstName":"Chase ","lastName":"Drucker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-6444-5259"},{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","investigation","methodology","formalAnalysis","validation","writing_reviewEditing","fundingAcquisition","supervision"],"email":"surya.banerjee@ttu.edu","firstName":"Surya Jyoti","lastName":"Banerjee","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7196-4315 "}],"awards":[{"awardId":"24SURE1331544","funderName":"American Heart Association (United States)","awardRecipient":"Chase Drucker"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Financial support for this project was provided by the American Heart Association (24SURE1331544), and Texas Tech University TrUE Scholars. This project is mainly funded by the Texas Tech University faculty start-up funds provided to Dr. Surya Jyoti Banerjee.
","image":{"url":"https://portal.micropublication.org/uploads/571ad2a8537550af4f3f61793c772619.jpg"},"imageCaption":"A. Multiple protein sequence alignment by ClustalW. FBNep1 (the Drosophila melanogaster typical Neprilysin1 protein sequence from FlyBase), FBNepl15 (FlyBase Nepl15 protein sequence), ORNepl15F or ORNepl15M (newly sequenced Oregon-R Nepl15 protein sequences from Female or Male adult flies). Multiple protein sequence alignment of Nep1 (typical Nep in fruit fly), FlyBase (FB) Nepl15, and Oregon-R Nepl15 protein sequences show FBNepl15 and Oregon-R Nepl15 proteins lack the (684) HEXXH and (746) EXXH catalytic motifs that are present in Neprilysin1 (Nep1). Additionally, 5 amino acids are different in the Oregon-R Nepl15 protein (at 15, 18, 199, 239, and 567 positions) from the FB Nepl15 protein sequence (see Table 2). Colored boxes indicate altered amino acid residues in Oregon-R Nepl15 protein relative to FB Nepl15 protein: (blue) indicating the original residue, (green) designating no change at the amino acid residue even though nucleotide sequence was altered, and (red) representing altered amino acid residues. The numbers underneath each colored residue correspond to the amino acid position on the Nepl15 protein sequence. B. Predicted 3D protein structure of FB Nepl15 protein made by AlphaFold 3. The box plot shows a predicted aligned errors (PAE) plot, mapping the expected positional error (Å) between pairs of residues, generated by AlphaFold 3. 3D model residues and PAE plot are colored and indicated in the provided key, in which lower values (blue) indicate higher levels of confidence. C1, C2, and C3. Overlay of the 3D models of FBNepl15 (blue) and Oregon-R Nepl15 (purple) proteins from three different angles, as generated by AlphaFold 3. Three images display different angles of these two overlapping proteins, without indicating any major change in the Oregon-R Nepl15 protein structure despite the 5 amino acid changes.
","imageTitle":"Alignment of FlyBase Nep1, Nepl15 and Oregon-R Nepl15 protein sequences, and predicted 3D structures of FlyBase and Oregon-R Nepl15 proteins
","methods":"Drosophila melanogaster husbandry
Drosophila melanogaster Oregon-R (OR) strain was maintained on Bloomington's fly food formulation (Genesee Sc Nutri-Fly_66-116) at 25 °C. 5 to 7 days old male and virgin female adult flies were used for RNA extraction.
FlyBase Data:
The FlyBase website, http://flybase.org, was used to retrieve the Nepl15 transcript and CDS sequences. The genome release number is FB2026_01 (March 12, 2026).
RNA isolation and cDNA synthesis
Total RNA was extracted from 5 to 7 days old, 25 male and 25 virgin female Oregon-R adult flies using TRI reagent (Sigma T9424) (Banerjee et al., 2021). The RNA sample purity was validated by measuring 260/280 and 230/280 ratios, and the RNA integrity was tested by gel electrophoresis. The cDNA synthesis was then performed using 5x iScript Reaction Mix (Bio-Rad 1708889) following the manufacturer's protocol.
PCR and Purification
Specific forward (FP) and reverse primer (RP) pairs (Table 3) were designed using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021)to amplify Nepl15 CDS and Transcript using the OR male and female cDNA templates separately. The primer sequences were designed based on the FlyBase Nepl15 CDS and Transcript sequences. PCR was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs M0492S) following the manufacturer's protocol. The PCR products were purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel 740609) following the manufacturer's instructions.
DNA Sequencing Analysis
We designed several primers (listed in Table 4) to cover the entire length of the Nepl15 CDS or transcript. Sanger sequencing of the purified PCR samples was performed by Azenta Life Sciences (genewiz.com). The high-quality sequence contigs were aligned to the corresponding FlyBase sequence using Serial Cloner (v2.6.1) (Branco & Choupina, 2021).
Protein sequence analysis and other bioinformatics analysis
Changes in the Oregon-R Nepl15 CDS sequences compared to the FlyBase sequence were identified using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021). Variations in the Nepl15 codon sequences between Oregon-R CDS and FlyBase CDS sequences were analyzed using Serial Cloner's built-in BLASTn and BLASTp alignment tools. Next, Clustal Omega (Madeira et al., 2024) was used to align the FlyBase Neprilysin 1 (DmNep1, a typical fly neprilysin, orthologous to human neprilysin), Oregon-R male and female Nepl15, and FlyBase Nepl15 protein sequences to identify changes in Oregon-R Nepl15 protein sequences. The newly sequenced Oregon-R Nepl15 protein sequence was analyzed for any change in its subcellular localization, signal sequence site, and 3D structure compared to those of the FlyBase-reported Nepl15 protein sequence using different bioinformatics tools like DeepLoc2.1 (Ødum et al., 2024), SignalP – 6.0 (Teufel et al., 2022), and DeepTMHMM – 1.0 (Hallgren et al., 2022), respectively.
Table 3. List of primers used for PCR.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP | ATGGCCTCTCAACCGCTTG |
Nepl15_CDS_RP | TCAGTAGAGAGTGCACTTAAAGCG |
Nepl15_T.SCRPT_FP | CCCGCTCAGTTTCGTTTC |
Nepl15_T.SCRPT_RP | ATGACAAGTGCAACAAATGCTTTT |
Table 4. List of primers used for sequencing.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP1 | TGAAACGCAAGCTTGGCGTG |
Nepl15_CDS_FP2 | GCTTTGGAAGCGTTGGATAT |
Nepl15_CDS_FP3 | TGGAATACAAGGGTAAGCCG |
Nepl15_CDS_RP1 | TATTCAGGGCGGATCGCGTG |
Nepl15_T.SCRPT_FP1 | GGTTGGCCGGAGATTCGTGT |
Nepl15_T.SCRPT_FP2 | CATGTCAAATCTGGTGGATG |
Nepl15_T.SCRPT_FP3 | TGGGATCACACCTCGGAGAG |
Nepl15_T.SCRPT_RP1 | GGCACTGTTCTCAGCTCCTC |
","reagents":"
All reagents' names, with the company names and catalog numbers, are mentioned in the methods.
","patternDescription":"Neprilysins (neutral endopeptidases; Neps) belong to the M13 family of Zinc (II) dependent metallopeptidases and were first discovered in mammals (Turner et al., 2001). Typical mammalian Neps, including human Neprilysin (HsNep) encoded by the MME (Membrane Metalloendopeptidase) gene, have a short cytoplasmic N-terminal domain, a shorter hydrophobic transmembrane domain, and a long extracellular C-terminal domain that houses highly conserved motifs. Two of these motifs, HEXXH and EXXAD, are responsible for Zn (II) binding and the subsequent proteolytic cleavage of substrate peptides, typically occurring at the N-terminal side of a hydrophobic residue with a strong preference for Phe or Leu toward the C-terminus (Nalivaeva & Turner, 2013; Sitnik et al., 2014; Turner et al., 2000).
Typical mammalian Neps are normally expressed in a variety of cell types, including brush border cells of the kidneys, brain, neutrophils, lungs, synapses, along with adipocytes and smooth muscle cells present throughout gut tissue, to name a few. Neprilysin cleaves an array of peptides and controls cellular signals that impact the nervous, cardiovascular, inflammatory, immune systems, and nutrient homeostasis (Schling & Schäfer, 2002; Turner et al., 2001).
Phylogenetic studies have identified the presence of Nep orthologs in invertebrate organisms, including Drosophila melanogaster (Bland et al., 2008; Sitnik et al., 2014). Drosophila melanogaster contains 28 identified neprilysin and neprilysin-like genes (Meyer et al., 2021). Among them, Neprilysin-like 15 (Nepl15), a predicted secreted, catalytically inactive Nep, regulates glycogen and lipid storage in a sex-dependent manner. Previous work with Nepl15ko (knock-out) flies revealed that glycogen and triacylglyceride (TAG) storage were significantly reduced in adult male mutant flies, while significantly more glycogen storage was observed in adult female mutants, albeit the mutants consume the same amount of food as the controls (Banerjee et al., 2021). Interestingly, Banerjee et al., (2021) and transcriptomics data from FlyAtlas2 (Leader et al., 2018) showed that the Nepl15 transcript is differentially expressed in both larval and adult fly organs, with higher expression in larval fat body and adult head, heart, and fat body. Overall, FlyAtlas shows that the whole adult male body expresses 4.2 times more Nepl15 than the whole adult female body. Additionally, overexpression of Nepl15 in the fat body increased triglyceride levels only, whereas its overexpression in the gut increased glycogen levels only in adult male flies, suggesting Nepl15 has tissue-specific variable effects (Banerjee et al., 2021). Interestingly, the fly database (FlyBase.org) reports that the Nepl15 gene in D. melanogaster ISO1 MT (dm6) (y1; cn1; bw1; sp1) strain has no intron and produces only one transcript. However, 10 other fly Neprilysin and Neprilysin-like genes encode more than one transcript (Table 1) (FlyBase.org).
Table 1. List of Neprilysins and the corresponding number of transcripts and unique polypeptides they produce.
Symbol | Name | Number of Transcripts | Number of Polypeptides |
Nep1 | Neprilysin 1 | 4 | 4 |
Nep2 | Neprilysin 2 | 3 | 3 |
Nep3 | Neprilysin 3 | 3 | 3 |
Nep4 | Neprilysin 4 | 3 | 3 |
Nep5 | Neprilysin 5 | 4 | 4 |
Nep6 | Neprilysin 6 | 2 | 2 |
Nep7 | Neprilysin 7 | 1 | 1 |
frma | fra mauro | 2 | 2 |
goe | gone early | 3 | 3 |
Nepl3 | Neprilysin-like 3 | 1 | 1 |
Nepl4 | Neprilysin-like 4 | 1 | 1 |
Nepl5 | Neprilysin-like 5 | 1 | 1 |
Nepl6 | Neprilysin-like 6 | 1 | 1 |
Nepl7 | Neprilysin-like 7 | 2 | 2 |
Nepl8 | Neprilysin-like 8 | 1 | 1 |
Nepl9 | Neprilysin-like 9 | 1 | 1 |
Nepl10 | Neprilysin-like 10 | 1 | 1 |
Nepl11 | Neprilysin-like 11 | 2 | 2 |
Nepl12 | Neprilysin-like 12 | 1 | 1 |
Nepl13 | Neprilysin-like 13 | 1 | 1 |
Nepl14 | Neprilysin-like 14 | 1 | 1 |
Nepl15 | Neprilysin-like 15 | 1 | 1 |
Nepl16 | Neprilysin-like 16 | 1 | 1 |
Nepl17 | Neprilysin-like 17 | 1 | 1 |
Nepl18 | Neprilysin-like 18 | 1 | 1 |
Nepl19 | Neprilysin-like 19 | 1 | 1 |
Nepl20 | Neprilysin-like 20 | 1 | 1 |
Nepl21 | Neprilysin-like 21 | 1 | 1 |
Therefore, we asked the following questions: Are there any unreported Nepl15 transcript variants present in wild-type (Oregon-R) adult male and female flies that produce different Nepl15 protein isoforms in the two sexes? Are there any differences in the 5′and 3′untranslated regions (UTRs) in the Nepl15 transcript which may contribute to its post-transcriptional regulation? To answer these questions, we isolated total RNA from the whole-body of adult male and virgin female Oregon-R flies (FBsn0000276) and synthesized cDNA. Next, we took PCR based approach to amplify the Nepl15 CDS (coding sequence, 2061 bps) and its transcript (2213 bps including the 5′and 3′UTRs), followed by sequencing them and aligning the sequences with the corresponding sequences in FlyBase.
We did not find any nucleotide sequence difference at the 5′ and 3′UTRs of the Oregon-R and FlyBase Nepl15 transcript sequences. However, sequencing results show that the Oregon-R Nepl15 CDS from male and female flies contains the exact 7-nucleotide sequence changes compared to the FlyBase sequence. These changes translate into only 5 amino acid changes, among which 3 changes include amino acids with different properties (Table 2) (Figure 1A). The Oregon-R adult male and female Nepl15 (ORNepl15M and ORNepl15F) protein sequences were aligned with the FlyBase Neprilysin1 (FBNep1) and Nepl15 (FBNepl15) protein sequences using ClustalW to show the changed 5 amino acid residues (Table 2) (Figure 1A). Further bioinformatics analysis of the Oregon-R Nepl15 protein reveals that the amino acid changes did not impact the Nepl15 predicted cleavage site (between amino acid 22 & 23) (SignalIP and DeepTMHMM) (Hallgren et al., 2022; Teufel et al., 2022), and extracellular localization (DeepLoc) (Ødum et al., 2024). Additional analysis of 3D models of the FlyBase Nepl15 (Figure 1B, blue ribbon diagram) and Oregon-R Nepl15 proteins utilizing AlphaFold 3 (Abramson et al., 2024) shows no significant change in their structures in their overlays (blue and purple ribbon depicts the Nepl15 3D protein models in FlyBase strain and Oregon-R, respectively) (Figures 1 C1 – C3).
Table 2. Nucleotide and amino acid sequencing alterations in Oregon-R Nepl15 CDS and protein compared to the corresponding FlyBase data.
Genomic Position | Nucleotide Change | Amino Acid Variant | Character Alterations |
3R:22766060 | T → C | F15L | - |
3R:22766049 | C → G | C18W | polar – hydrophobic; aromatic |
3R:22765507 | A → T | Q199L | negatively charged - hydrophobic |
3R:22765387 | G → C | R239T | Positively charged - polar |
3R:22764404 | G → T | V567L | - |
Collectively, these results reveal that a slightly different amino acid sequence in the Nepl15 protein is present in our lab-grown wild-type Oregon-R flies as compared to the FlyBase Nepl15 protein, indicative of a strain-specific amino acid sequence variation in the same protein. Bioinformatic analyses do not indicate any major structural or functional shift in the Oregon-R Nepl15 protein due to these changes. Thus, our study confirms the presence of only one Nepl15 transcript version in D. melanogaster Oregon R adult male and female flies. Although, the changes in the nucleotide sequences within the Oregon-R Nepl15 codons and corresponding amino acid changes in the Nepl15 protein may not impact the protein's localization, structure, and function, still our research outcome can contribute to future investigations in two significant ways: (a) this report will help to perform primer design, PCR, qPCR, gene cloning, guide DNA design for CRISPR, and site specific mutation accurately for Nepl15 gene in Oregon R fly strain; and (ii) if researchers use a Drosophila species or strain other than the one used in a database or previously published work, our result recommends that it is important to verify the DNA sequence before designing the components of molecular biology based experiments.
","references":[{"reference":"Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al., Jumper JM. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 630: 493-500. 1503.","pubmedId":"38718835","doi":"10.1038/s41586-024-07487-w"},{"reference":"Banerjee S, Woods C, Burnett M, Park SJ, Ja WW, Curtiss J. 2021. The Drosophila melanogaster Neprilysin Nepl15 is involved in lipid and carbohydrate storage. Sci Rep. 11: 2099. 1497.","pubmedId":"33483521","doi":"10.1038/s41598-021-81165-z"},{"reference":"Bland ND, Pinney JW, Thomas JE, Turner AJ, Isaac RE. 2008. Bioinformatic analysis of the neprilysin (M13) family of peptidases reveals complex evolutionary and functional relationships. BMC Evol Biol. 8: 16. 1494.","pubmedId":"18215274","doi":"10.1186/1471-2148-8-16"},{"reference":"Branco I, Choupina A. 2021. Bioinformatics: new tools and applications in life science and personalized medicine. Appl Microbiol Biotechnol. 105: 937-951. 1011.","pubmedId":"33404829","doi":"10.1007/s00253-020-11056-2"},{"reference":"FB2026_01, http://flybase.org (released 12th March, 2026).
","pubmedId":"","doi":""},{"reference":"Hallgren J, Tsirigos KD, Pedersen MD, Almagro Armenteros JJ, Marcatili P, Nielsen H, Krogh A, Winther O. 2022. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. biorxiv: 2022.04. 08.487609. 1512.","pubmedId":"","doi":""},{"reference":"Leader DP, Krause SA, Pandit A, Davies SA, Dow JAT. 2018. FlyAtlas 2: a new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46: D809-D815. 1498.","pubmedId":"29069479","doi":"10.1093/nar/gkx976"},{"reference":"Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. 2024. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 52: W521-W525. 1507.","pubmedId":"38597606","doi":"10.1093/nar/gkae241"},{"reference":"Meyer H, Buhr A, Callaerts P, Schiemann R, Wolfner MF, Marygold SJ. 2021. Identification and bioinformatic analysis of neprilysin and neprilysin-like metalloendopeptidases in. MicroPubl Biol. 2021 1496.","pubmedId":"34189422","doi":"10.17912/micropub.biology.000410"},{"reference":"Nalivaeva NN, Turner AJ. 2013. Neprilysin (Chapter 127), Handbook of Proteolytic Enzymes. 1491.","pubmedId":"","doi":""},{"reference":"Schling P, Schafer T. 2002. Human adipose tissue cells keep tight control on the angiotensin II levels in their vicinity. J Biol Chem. 277: 48066-75. 1492.","pubmedId":"12196514","doi":"10.1074/jbc.M204058200"},{"reference":"Sitnik JL, Francis C, Hens K, Huybrechts R, Wolfner MF, Callaerts P. 2014. Neprilysins: an evolutionarily conserved family of metalloproteases that play important roles in reproduction in Drosophila. Genetics. 196: 781-97. 1489.","pubmedId":"24395329","doi":"10.1534/genetics.113.160945"},{"reference":"Teufel F, Almagro Armenteros JJ, Johansen AR, Gislason MH, Pihl SI, Tsirigos KD, et al., Nielsen H. 2022. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol. 40: 1023-1025. 1501.","pubmedId":"34980915","doi":"10.1038/s41587-021-01156-3"},{"reference":"Turner AJ, Brown CD, Carson JA, Barnes K. 2000. The neprilysin family in health and disease. Adv Exp Med Biol. 477: 229-40. 1490.","pubmedId":"10849750","doi":"10.1007/0-306-46826-3_25"},{"reference":"Turner AJ, Isaac RE, Coates D. 2001. The neprilysin (NEP) family of zinc metalloendopeptidases: genomics and function. Bioessays. 23: 261-9. 1488.","pubmedId":"11223883","doi":"10.1002/1521-1878(200103)23:3<261::AID-BIES1036>3.0.CO;2-K"},{"reference":"Odum MT, Teufel F, Thumuluri V, Almagro Armenteros JJ, Johansen AR, Winther O, Nielsen H. 2024. DeepLoc 2.1: multi-label membrane protein type prediction using protein language models. Nucleic Acids Res. 52: W215-W220. 1511.","pubmedId":"38587188","doi":"10.1093/nar/gkae237"}],"title":"Identification of Drosophila melanogaster Strain-Specific Sequence Variations in the Nepl15 Transcript of Oregon-R relative to FlyBase Data
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"a1769cd4-e2d5-40c2-b634-f52ef61ce8c3","decision":"revise","abstract":"According to FlyBase, The Drosophila melanogaster (fruit fly) Neprilysin-like 15 (Nepl15) gene has only one annotated transcript and a 686-amino acid-long protein. However, Nepl15 transcripts exhibit organ- and sex-specific differential expression, and Nepl15 knock-out mutation results in sex-dependent contrasting phenotypes. Thus, we investigated whether unreported sex-specific Nepl15 transcripts exist. Our sequencing results of Nepl15 cDNA synthesized from the Oregon-R adult male and female RNA samples show a few changes in the codons, which alter the amino acid sequences in our samples. However, the changes do not impact the subcellular localization or overall Nepl15 protein structure as determined by bioinformatics analyses.
","acknowledgements":"We would like to thank the Texas Tech University (TTU) TrUE Scholars Undergraduate Research Program for supporting Chase Drucker with funding for reagents. American Heart Association (AHA) SURE (Supporting Undergraduate Research Experiences) scholars' program coordinated by Dr. Peter Keyel, Associate Professor of Biological Sciences at TTU, for supporting Chase with a Summer Research Internship and a travel award for presenting this work at the Scientific Sessions Conference 2025 organized by AHA. We also thank Dr. Surya Banerjee’s research lab members, Shahira Arzoo and Rubaia Tasmin, for their insights and help during this project.
","authors":[{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","methodology","software","writing_originalDraft"],"email":"cdrucker@ttu.edu","firstName":"Chase ","lastName":"Drucker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-6444-5259"},{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","investigation","methodology","formalAnalysis","validation","writing_reviewEditing","fundingAcquisition","supervision"],"email":"surya.banerjee@ttu.edu","firstName":"Surya Jyoti","lastName":"Banerjee","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7196-4315 "}],"awards":[{"awardId":"24SURE1331544","funderName":"American Heart Association (United States)","awardRecipient":"Chase Drucker"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Financial support for this project was provided by the American Heart Association (24SURE1331544), and Texas Tech University TrUE Scholars. This project is mainly funded by the Texas Tech University faculty start-up funds provided to Dr. Surya Jyoti Banerjee.
","image":{"url":"https://portal.micropublication.org/uploads/5ade7c2f3058debb1c8bb65a565723af.png"},"imageCaption":"A. Multiple protein sequence alignment by ClustalW. FBNep1 (the Drosophila melanogaster typical Neprilysin1 protein sequence from FlyBase), FBNepl15 (FlyBase Nepl15 protein sequence), ORNepl15F or ORNepl15M (newly sequenced Oregon-R Nepl15 protein sequences from Female or Male adult flies). Multiple protein sequence alignment of Nep1 (typical Nep in fruit fly), FlyBase (FB) Nepl15, and Oregon-R Nepl15 protein sequences show FBNepl15 and Oregon-R Nepl15 proteins lack the (684) HEXXH and (746) EXXH catalytic motifs that are present in Neprilysin1 (Nep1). Additionally, 5 amino acids are different in the Oregon-R Nepl15 protein (at 15, 18, 199, 239, and 567 positions) from the FB Nepl15 protein sequence (see Table 2). Colored boxes indicate altered amino acid residues in Oregon-R Nepl15 protein relative to FB Nepl15 protein: (blue) indicating the original residue, (green) designating no change at the amino acid residue even though nucleotide sequence was altered, and (red) representing altered amino acid residues. The numbers underneath each colored residue correspond to the amino acid position on the Nepl15 protein sequence. B. Predicted 3D protein structure of FB Nepl15 protein made by AlphaFold 3. The box plot shows a predicted aligned errors (PAE) plot, mapping the expected positional error (Å) between pairs of residues, generated by AlphaFold 3. 3D model residues and PAE plot are colored and indicated in the provided key, in which lower values (blue) indicate higher levels of confidence. C1, C2, and C3. Overlay of the 3D models of FBNepl15 (blue) and Oregon-R Nepl15 (purple) proteins from three different angles, as generated by AlphaFold 3. Three images display different angles of these two overlapping proteins, without indicating any major change in the Oregon-R Nepl15 protein structure despite the 5 amino acid changes.
","imageTitle":"Alignment of FlyBase Nep1, Nepl15 and Oregon-R Nepl15 protein sequences, and predicted 3D structures of FlyBase and Oregon-R Nepl15 proteins
","methods":"Drosophila melanogaster husbandry
Drosophila melanogaster Oregon-R (OR) strain was maintained on Bloomington's fly food formulation (Genesee Sc Nutri-Fly_66-116) at 25 °C. 5 to 7 days old male and virgin female adult flies were used for RNA extraction.
FlyBase Data:
The FlyBase website, http://flybase.org, was used to retrieve the Nepl15 transcript and CDS sequences. The genome release number is FB2026_01 (March 12, 2026).
RNA isolation and cDNA synthesis
Total RNA was extracted from 5 to 7 days old, 25 male and 25 virgin female Oregon-R adult flies using TRI reagent (Sigma T9424) (Banerjee et al., 2021). The RNA sample purity was validated by measuring 260/280 and 230/280 ratios, and the RNA integrity was tested by gel electrophoresis. The cDNA synthesis was then performed using 5x iScript Reaction Mix (Bio-Rad 1708889) following the manufacturer's protocol.
PCR and Purification
Specific forward (FP) and reverse primer (RP) pairs (Table 3) were designed using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021)to amplify Nepl15 CDS and Transcript using the OR male and female cDNA templates separately. The primer sequences were designed based on the FlyBase Nepl15 CDS and Transcript sequences. PCR was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs M0492S) following the manufacturer's protocol. The PCR products were purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel 740609) following the manufacturer's instructions.
DNA Sequencing Analysis
We designed several primers (listed in Table 4) to cover the entire length of the Nepl15 CDS or transcript. Sanger sequencing of the purified PCR samples was performed by Azenta Life Sciences (genewiz.com). The high-quality sequence contigs were aligned to the corresponding FlyBase sequence using Serial Cloner (v2.6.1) (Branco & Choupina, 2021).
Protein sequence analysis and other bioinformatics analysis
Changes in the Oregon-R Nepl15 CDS sequences compared to the FlyBase sequence were identified using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021). Variations in the Nepl15 codon sequences between Oregon-R CDS and FlyBase CDS sequences were analyzed using Serial Cloner's built-in BLASTn and BLASTp alignment tools. Next, Clustal Omega (Madeira et al., 2024) was used to align the FlyBase Neprilysin 1 (DmNep1, a typical fly neprilysin, orthologous to human neprilysin), Oregon-R male and female Nepl15, and FlyBase Nepl15 protein sequences to identify changes in Oregon-R Nepl15 protein sequences. The newly sequenced Oregon-R Nepl15 protein sequence was analyzed for any change in its subcellular localization, signal sequence site, and 3D structure compared to those of the FlyBase-reported Nepl15 protein sequence using different bioinformatics tools like DeepLoc2.1 (Ødum et al., 2024), SignalP – 6.0 (Teufel et al., 2022), and DeepTMHMM – 1.0 (Hallgren et al., 2022), respectively.
Table 3. List of primers used for PCR.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP | ATGGCCTCTCAACCGCTTG |
Nepl15_CDS_RP | TCAGTAGAGAGTGCACTTAAAGCG |
Nepl15_T.SCRPT_FP | CCCGCTCAGTTTCGTTTC |
Nepl15_T.SCRPT_RP | ATGACAAGTGCAACAAATGCTTTT |
Table 4. List of primers used for sequencing.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP1 | TGAAACGCAAGCTTGGCGTG |
Nepl15_CDS_FP2 | GCTTTGGAAGCGTTGGATAT |
Nepl15_CDS_FP3 | TGGAATACAAGGGTAAGCCG |
Nepl15_CDS_RP1 | TATTCAGGGCGGATCGCGTG |
Nepl15_T.SCRPT_FP1 | GGTTGGCCGGAGATTCGTGT |
Nepl15_T.SCRPT_FP2 | CATGTCAAATCTGGTGGATG |
Nepl15_T.SCRPT_FP3 | TGGGATCACACCTCGGAGAG |
Nepl15_T.SCRPT_RP1 | GGCACTGTTCTCAGCTCCTC |
","reagents":"
All reagents' names, with the company names and catalog numbers, are mentioned in the methods.
","patternDescription":"Neprilysins (neutral endopeptidases; Neps) belong to the M13 family of Zinc (II) dependent metallopeptidases and were first discovered in mammals (Turner et al., 2001). Typical mammalian Neps, including human Neprilysin (HsNep) encoded by the MME (Membrane Metalloendopeptidase) gene, have a short cytoplasmic N-terminal domain, a shorter hydrophobic transmembrane domain, and a long extracellular C-terminal domain that houses highly conserved motifs. Two of these motifs, HEXXH and EXXAD, are responsible for Zn (II) binding and the subsequent proteolytic cleavage of substrate peptides, typically occurring at the N-terminal side of a hydrophobic residue with a strong preference for Phe or Leu toward the C-terminus (Nalivaeva & Turner, 2013; Sitnik et al., 2014; Turner et al., 2000).
Typical mammalian Neps are normally expressed in a variety of cell types, including brush border cells of the kidneys, brain, neutrophils, lungs, synapses, along with adipocytes and smooth muscle cells present throughout gut tissue, to name a few. Neprilysin cleaves an array of peptides and controls cellular signals that impact the nervous, cardiovascular, inflammatory, immune systems, and nutrient homeostasis (Schling & Schäfer, 2002; Turner et al., 2001).
Phylogenetic studies have identified the presence of Nep orthologs in invertebrate organisms, including Drosophila melanogaster (Bland et al., 2008; Sitnik et al., 2014). Drosophila melanogaster contains 28 identified neprilysin and neprilysin-like genes (Meyer et al., 2021). Among them, Neprilysin-like 15 (Nepl15), a predicted secreted, catalytically inactive Nep, regulates glycogen and lipid storage in a sex-dependent manner. Previous work with Nepl15ko (knock-out) flies revealed that glycogen and triacylglyceride (TAG) storage were significantly reduced in adult male mutant flies, while significantly more glycogen storage was observed in adult female mutants, albeit the mutants consume the same amount of food as the controls (Banerjee et al., 2021). Interestingly, Banerjee et al., (2021) and transcriptomics data from FlyAtlas2 (Leader et al., 2018) showed that the Nepl15 transcript is differentially expressed in both larval and adult fly organs, with higher expression in larval fat body and adult head, heart, and fat body. Overall, FlyAtlas shows that the whole adult male body expresses 4.2 times more Nepl15 than the whole adult female body. Additionally, overexpression of Nepl15 in the fat body increased triglyceride levels only, whereas its overexpression in the gut increased glycogen levels only in adult male flies, suggesting Nepl15 has tissue-specific variable effects (Banerjee et al., 2021). Interestingly, the fly database (FlyBase.org) reports that the Nepl15 gene in D. melanogaster ISO1 MT (dm6) (y1; cn1; bw1; sp1) strain has no intron and produces only one transcript. However, 10 other fly Neprilysin and Neprilysin-like genes encode more than one transcript (Table 1) (FlyBase.org).
Table 1. List of Neprilysins and the corresponding number of transcripts and unique polypeptides they produce.
Symbol | Name | Number of Transcripts | Number of Polypeptides |
Nep1 | Neprilysin 1 | 4 | 4 |
Nep2 | Neprilysin 2 | 3 | 3 |
Nep3 | Neprilysin 3 | 3 | 3 |
Nep4 | Neprilysin 4 | 3 | 3 |
Nep5 | Neprilysin 5 | 4 | 4 |
Nep6 | Neprilysin 6 | 2 | 2 |
Nep7 | Neprilysin 7 | 1 | 1 |
frma | fra mauro | 2 | 2 |
goe | gone early | 3 | 3 |
Nepl3 | Neprilysin-like 3 | 1 | 1 |
Nepl4 | Neprilysin-like 4 | 1 | 1 |
Nepl5 | Neprilysin-like 5 | 1 | 1 |
Nepl6 | Neprilysin-like 6 | 1 | 1 |
Nepl7 | Neprilysin-like 7 | 2 | 2 |
Nepl8 | Neprilysin-like 8 | 1 | 1 |
Nepl9 | Neprilysin-like 9 | 1 | 1 |
Nepl10 | Neprilysin-like 10 | 1 | 1 |
Nepl11 | Neprilysin-like 11 | 2 | 2 |
Nepl12 | Neprilysin-like 12 | 1 | 1 |
Nepl13 | Neprilysin-like 13 | 1 | 1 |
Nepl14 | Neprilysin-like 14 | 1 | 1 |
Nepl15 | Neprilysin-like 15 | 1 | 1 |
Nepl16 | Neprilysin-like 16 | 1 | 1 |
Nepl17 | Neprilysin-like 17 | 1 | 1 |
Nepl18 | Neprilysin-like 18 | 1 | 1 |
Nepl19 | Neprilysin-like 19 | 1 | 1 |
Nepl20 | Neprilysin-like 20 | 1 | 1 |
Nepl21 | Neprilysin-like 21 | 1 | 1 |
Therefore, we asked the following questions: Are there any unreported Nepl15 transcript variants present in wild-type (Oregon-R) adult male and female flies that produce different Nepl15 protein isoforms in the two sexes? Are there any differences in the 5′and 3′untranslated regions (UTRs) in the Nepl15 transcript which may contribute to its post-transcriptional regulation? To answer these questions, we isolated total RNA from the whole-body of adult male and virgin female Oregon-R flies (FBsn0000276) and synthesized cDNA. Next, we took PCR based approach to amplify the Nepl15 CDS (coding sequence, 2061 bps) and its transcript (2213 bps including the 5′and 3′UTRs), followed by sequencing them and aligning the sequences with the corresponding sequences in FlyBase.
We did not find any nucleotide sequence difference at the 5′ and 3′UTRs of the Oregon-R and FlyBase Nepl15 transcript sequences. However, sequencing results show that the Oregon-R Nepl15 CDS from male and female flies contains the exact 7-nucleotide sequence changes compared to the FlyBase sequence. These changes translate into only 5 amino acid changes, among which 3 changes include amino acids with different properties (Table 2) (Figure 1A). The Oregon-R adult male and female Nepl15 (ORNepl15M and ORNepl15F) protein sequences were aligned with the FlyBase Neprilysin1 (FBNep1) and Nepl15 (FBNepl15) protein sequences using ClustalW to show the changed 5 amino acid residues (Table 2) (Figure 1A). Further bioinformatics analysis of the Oregon-R Nepl15 protein reveals that the amino acid changes did not impact the Nepl15 predicted cleavage site (between amino acid 22 & 23) (SignalIP and DeepTMHMM) (Hallgren et al., 2022; Teufel et al., 2022), and extracellular localization (DeepLoc) (Ødum et al., 2024). Additional analysis of 3D models of the FlyBase Nepl15 (Figure 1B, blue ribbon diagram) and Oregon-R Nepl15 proteins utilizing AlphaFold 3 (Abramson et al., 2024) shows no significant change in their structures in their overlays (blue and purple ribbon depicts the Nepl15 3D protein models in FlyBase strain and Oregon-R, respectively) (Figures 1 C1 – C3).
Table 2. Nucleotide and amino acid sequencing alterations in Oregon-R Nepl15 CDS and protein compared to the corresponding FlyBase data.
Genomic Position | Nucleotide Change | Amino Acid Variant | Character Alterations |
3R:22766060 | T → C | F15L | - |
3R:22766049 | C → G | C18W | polar – hydrophobic; aromatic |
3R:22765507 | A → T | Q199L | negatively charged - hydrophobic |
3R:22765387 | G → C | R239T | Positively charged - polar |
3R:22764404 | G → T | V567L | - |
Collectively, these results reveal that a slightly different amino acid sequence in the Nepl15 protein is present in our lab-grown wild-type Oregon-R flies as compared to the FlyBase Nepl15 protein, indicative of a strain-specific amino acid sequence variation in the same protein. Bioinformatic analyses do not indicate any major structural or functional shift in the Oregon-R Nepl15 protein due to these changes. Thus, our study confirms the presence of only one Nepl15 transcript version in D. melanogaster Oregon R adult male and female flies. Although, the changes in the nucleotide sequences within the Oregon-R Nepl15 codons and corresponding amino acid changes in the Nepl15 protein may not impact the protein's localization, structure, and function, still our research outcome can contribute to future investigations in two significant ways: (a) this report will help to perform primer design, PCR, qPCR, gene cloning, guide DNA design for CRISPR, and site specific mutation accurately for Nepl15 gene in Oregon R fly strain; and (ii) if researchers use a Drosophila species or strain other than the one used in a database or previously published work, our result recommends that it is important to verify the DNA sequence before designing the components of molecular biology based experiments.
","references":[{"reference":"Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al., Jumper JM. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 630: 493-500. 1503.","pubmedId":"38718835","doi":"10.1038/s41586-024-07487-w"},{"reference":"Banerjee S, Woods C, Burnett M, Park SJ, Ja WW, Curtiss J. 2021. The Drosophila melanogaster Neprilysin Nepl15 is involved in lipid and carbohydrate storage. Sci Rep. 11: 2099. 1497.","pubmedId":"33483521","doi":"10.1038/s41598-021-81165-z"},{"reference":"Bland ND, Pinney JW, Thomas JE, Turner AJ, Isaac RE. 2008. Bioinformatic analysis of the neprilysin (M13) family of peptidases reveals complex evolutionary and functional relationships. BMC Evol Biol. 8: 16. 1494.","pubmedId":"18215274","doi":"10.1186/1471-2148-8-16"},{"reference":"Branco I, Choupina A. 2021. Bioinformatics: new tools and applications in life science and personalized medicine. Appl Microbiol Biotechnol. 105: 937-951. 1011.","pubmedId":"33404829","doi":"10.1007/s00253-020-11056-2"},{"reference":"FB2026_01, http://flybase.org (released 12th March, 2026).
","pubmedId":"","doi":""},{"reference":"Hallgren J, Tsirigos KD, Pedersen MD, Almagro Armenteros JJ, Marcatili P, Nielsen H, Krogh A, Winther O. 2022. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. biorxiv: 2022.04. 08.487609. 1512.","pubmedId":"","doi":""},{"reference":"Leader DP, Krause SA, Pandit A, Davies SA, Dow JAT. 2018. FlyAtlas 2: a new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46: D809-D815. 1498.","pubmedId":"29069479","doi":"10.1093/nar/gkx976"},{"reference":"Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. 2024. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 52: W521-W525. 1507.","pubmedId":"38597606","doi":"10.1093/nar/gkae241"},{"reference":"Meyer H, Buhr A, Callaerts P, Schiemann R, Wolfner MF, Marygold SJ. 2021. Identification and bioinformatic analysis of neprilysin and neprilysin-like metalloendopeptidases in. MicroPubl Biol. 2021 1496.","pubmedId":"34189422","doi":"10.17912/micropub.biology.000410"},{"reference":"Nalivaeva NN, Turner AJ. 2013. Neprilysin (Chapter 127), Handbook of Proteolytic Enzymes. 1491.","pubmedId":"","doi":""},{"reference":"Schling P, Schafer T. 2002. Human adipose tissue cells keep tight control on the angiotensin II levels in their vicinity. J Biol Chem. 277: 48066-75. 1492.","pubmedId":"12196514","doi":"10.1074/jbc.M204058200"},{"reference":"Sitnik JL, Francis C, Hens K, Huybrechts R, Wolfner MF, Callaerts P. 2014. Neprilysins: an evolutionarily conserved family of metalloproteases that play important roles in reproduction in Drosophila. Genetics. 196: 781-97. 1489.","pubmedId":"24395329","doi":"10.1534/genetics.113.160945"},{"reference":"Teufel F, Almagro Armenteros JJ, Johansen AR, Gislason MH, Pihl SI, Tsirigos KD, et al., Nielsen H. 2022. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol. 40: 1023-1025. 1501.","pubmedId":"34980915","doi":"10.1038/s41587-021-01156-3"},{"reference":"Turner AJ, Brown CD, Carson JA, Barnes K. 2000. The neprilysin family in health and disease. Adv Exp Med Biol. 477: 229-40. 1490.","pubmedId":"10849750","doi":"10.1007/0-306-46826-3_25"},{"reference":"Turner AJ, Isaac RE, Coates D. 2001. The neprilysin (NEP) family of zinc metalloendopeptidases: genomics and function. Bioessays. 23: 261-9. 1488.","pubmedId":"11223883","doi":"10.1002/1521-1878(200103)23:3<261::AID-BIES1036>3.0.CO;2-K"},{"reference":"Odum MT, Teufel F, Thumuluri V, Almagro Armenteros JJ, Johansen AR, Winther O, Nielsen H. 2024. DeepLoc 2.1: multi-label membrane protein type prediction using protein language models. Nucleic Acids Res. 52: W215-W220. 1511.","pubmedId":"38587188","doi":"10.1093/nar/gkae237"}],"title":"Identification of Drosophila melanogaster Strain-Specific Sequence Variations in the Nepl15 Transcript of Oregon-R relative to FlyBase Data
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"ce2e1b36-307f-4211-b7f0-7238416ef8b9","decision":"edit","abstract":"According to FlyBase, The Drosophila melanogaster (fruit fly) Neprilysin-like 15 (Nepl15) gene has only one annotated transcript and a 686-amino acid-long protein. However, Nepl15 transcripts exhibit organ- and sex-specific differential expression, and Nepl15 knock-out mutation results in sex-dependent contrasting phenotypes. Thus, we investigated whether unreported sex-specific Nepl15 transcripts exist. Our sequencing results of Nepl15 cDNA synthesized from the Oregon-R adult male and female RNA samples show a few changes in the codons, which alter the amino acid sequences in our samples. However, the changes do not impact the subcellular localization or overall Nepl15 protein structure as determined by bioinformatics analyses.
","acknowledgements":"We would like to thank the Texas Tech University (TTU) TrUE Scholars Undergraduate Research Program for supporting Chase Drucker with funding for reagents. American Heart Association (AHA) SURE (Supporting Undergraduate Research Experiences) scholars' program coordinated by Dr. Peter Keyel, Associate Professor of Biological Sciences at TTU, for supporting Chase with a Summer Research Internship and a travel award for presenting this work at the Scientific Sessions Conference 2025 organized by AHA. We also thank Dr. Surya Banerjee’s research lab members, Shahira Arzoo and Rubaia Tasmin, for their insights and help during this project.
","authors":[{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","methodology","software","writing_originalDraft"],"email":"cdrucker@ttu.edu","firstName":"Chase ","lastName":"Drucker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-6444-5259"},{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","investigation","methodology","formalAnalysis","validation","writing_reviewEditing","fundingAcquisition","supervision"],"email":"surya.banerjee@ttu.edu","firstName":"Surya Jyoti","lastName":"Banerjee","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7196-4315 "}],"awards":[{"awardId":"24SURE1331544","funderName":"American Heart Association (United States)","awardRecipient":"Chase Drucker"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Primers sequences used for PCR and sequencing
","doi":null,"resourceType":"Dataset","name":"Primers.csv","url":"https://portal.micropublication.org/uploads/9ee988b5e35cc5acafeee20e78317a30.csv"}],"funding":"Financial support for this project was provided by the American Heart Association (24SURE1331544), and Texas Tech University TrUE Scholars. This project is mainly funded by the Texas Tech University faculty start-up funds provided to Dr. Surya Jyoti Banerjee.
","image":{"url":"https://portal.micropublication.org/uploads/5ade7c2f3058debb1c8bb65a565723af.png"},"imageCaption":"A. Multiple protein sequence alignment by ClustalW. FBNep1 (the Drosophila melanogaster typical Neprilysin1 protein sequence from FlyBase), FBNepl15 (FlyBase Nepl15 protein sequence), ORNepl15F or ORNepl15M (newly sequenced Oregon-R Nepl15 protein sequences from Female or Male adult flies). Multiple protein sequence alignment of Nep1 (typical Nep in fruit fly), FlyBase (FB) Nepl15, and Oregon-R Nepl15 protein sequences show FBNepl15 and Oregon-R Nepl15 proteins lack the (684) HEXXH and (746) EXXH catalytic motifs that are present in Neprilysin1 (Nep1). Additionally, 5 amino acids are different in the Oregon-R Nepl15 protein (at 15, 18, 199, 239, and 567 positions) from the FB Nepl15 protein sequence (see Table 2). Colored boxes indicate altered amino acid residues in Oregon-R Nepl15 protein relative to FB Nepl15 protein: (blue) indicating the original residue, (green) designating no change at the amino acid residue even though nucleotide sequence was altered, and (red) representing altered amino acid residues. The numbers underneath each colored residue correspond to the amino acid position on the Nepl15 protein sequence. B. Predicted 3D protein structure of FB Nepl15 protein made by AlphaFold 3. The box plot shows a predicted aligned errors (PAE) plot, mapping the expected positional error (Å) between pairs of residues, generated by AlphaFold 3. 3D model residues and PAE plot are colored and indicated in the provided key, in which lower values (blue) indicate higher levels of confidence. C1, C2, and C3. Overlay of the 3D models of FBNepl15 (blue) and Oregon-R Nepl15 (purple) proteins from three different angles, as generated by AlphaFold 3. Three images display different angles of these two overlapping proteins, without indicating any major change in the Oregon-R Nepl15 protein structure despite the 5 amino acid changes.
","imageTitle":"Alignment of FlyBase Nep1, Nepl15 and Oregon-R Nepl15 protein sequences, and predicted 3D structures of FlyBase and Oregon-R Nepl15 proteins
","methods":"Drosophila melanogaster husbandry
Drosophila melanogaster Oregon-R (OR) strain was maintained on Bloomington's fly food formulation (Genesee Sc Nutri-Fly_66-116) at 25 °C. 5 to 7 days old male and virgin female adult flies were used for RNA extraction.
FlyBase Data:
The FlyBase website, http://flybase.org, was used to retrieve the Nepl15 transcript and CDS sequences. The genome release number is FB2026_01 (March 12, 2026).
RNA isolation and cDNA synthesis
Total RNA was extracted from 5 to 7 days old, 25 male and 25 virgin female Oregon-R adult flies using TRI reagent (Sigma T9424) (Banerjee et al., 2021). The RNA sample purity was validated by measuring 260/280 and 230/280 ratios, and the RNA integrity was tested by gel electrophoresis. The cDNA synthesis was then performed using 5x iScript Reaction Mix (Bio-Rad 1708889) following the manufacturer's protocol.
PCR and Purification
Specific forward (FP) and reverse primer (RP) pairs (Table 3) were designed using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021)to amplify Nepl15 CDS and Transcript using the OR male and female cDNA templates separately. The primer sequences were designed based on the FlyBase Nepl15 CDS and Transcript sequences. PCR was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs M0492S) following the manufacturer's protocol. The PCR products were purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel 740609) following the manufacturer's instructions.
DNA Sequencing Analysis
We designed several primers (listed in Table 4) to cover the entire length of the Nepl15 CDS or transcript. Sanger sequencing of the purified PCR samples was performed by Azenta Life Sciences (genewiz.com). The high-quality sequence contigs were aligned to the corresponding FlyBase sequence using Serial Cloner (v2.6.1) (Branco & Choupina, 2021).
Protein sequence analysis and other bioinformatics analysis
Changes in the Oregon-R Nepl15 CDS sequences compared to the FlyBase sequence were identified using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021). Variations in the Nepl15 codon sequences between Oregon-R CDS and FlyBase CDS sequences were analyzed using Serial Cloner's built-in BLASTn and BLASTp alignment tools. Next, Clustal Omega (Madeira et al., 2024) was used to align the FlyBase Neprilysin 1 (DmNep1, a typical fly neprilysin, orthologous to human neprilysin), Oregon-R male and female Nepl15, and FlyBase Nepl15 protein sequences to identify changes in Oregon-R Nepl15 protein sequences. The newly sequenced Oregon-R Nepl15 protein sequence was analyzed for any change in its subcellular localization, signal sequence site, and 3D structure compared to those of the FlyBase-reported Nepl15 protein sequence using different bioinformatics tools like DeepLoc2.1 (Ødum et al., 2024), SignalP – 6.0 (Teufel et al., 2022), and DeepTMHMM – 1.0 (Hallgren et al., 2022), respectively.
Table 3. List of primers used for PCR.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP | ATGGCCTCTCAACCGCTTG |
Nepl15_CDS_RP | TCAGTAGAGAGTGCACTTAAAGCG |
Nepl15_T.SCRPT_FP | CCCGCTCAGTTTCGTTTC |
Nepl15_T.SCRPT_RP | ATGACAAGTGCAACAAATGCTTTT |
Table 4. List of primers used for sequencing.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP1 | TGAAACGCAAGCTTGGCGTG |
Nepl15_CDS_FP2 | GCTTTGGAAGCGTTGGATAT |
Nepl15_CDS_FP3 | TGGAATACAAGGGTAAGCCG |
Nepl15_CDS_RP1 | TATTCAGGGCGGATCGCGTG |
Nepl15_T.SCRPT_FP1 | GGTTGGCCGGAGATTCGTGT |
Nepl15_T.SCRPT_FP2 | CATGTCAAATCTGGTGGATG |
Nepl15_T.SCRPT_FP3 | TGGGATCACACCTCGGAGAG |
Nepl15_T.SCRPT_RP1 | GGCACTGTTCTCAGCTCCTC |
","reagents":"
All reagents' names, with the company names and catalog numbers, are mentioned in the methods.
","patternDescription":"Neprilysins (neutral endopeptidases; Neps) belong to the M13 family of Zinc (II) dependent metallopeptidases and were first discovered in mammals (Turner et al., 2001). Typical mammalian Neps, including human Neprilysin (HsNep) encoded by the MME (Membrane Metalloendopeptidase) gene, have a short cytoplasmic N-terminal domain, a shorter hydrophobic transmembrane domain, and a long extracellular C-terminal domain that houses highly conserved motifs. Two of these motifs, HEXXH and EXXAD, are responsible for Zn (II) binding and the subsequent proteolytic cleavage of substrate peptides, typically occurring at the N-terminal side of a hydrophobic residue with a strong preference for Phe or Leu toward the C-terminus (Nalivaeva & Turner, 2013; Sitnik et al., 2014; Turner et al., 2000).
Typical mammalian Neps are normally expressed in a variety of cell types, including brush border cells of the kidneys, brain, neutrophils, lungs, synapses, along with adipocytes and smooth muscle cells present throughout gut tissue, to name a few. Neprilysin cleaves an array of peptides and controls cellular signals that impact the nervous, cardiovascular, inflammatory, immune systems, and nutrient homeostasis (Schling & Schäfer, 2002; Turner et al., 2001).
Phylogenetic studies have identified the presence of Nep orthologs in invertebrate organisms, including Drosophila melanogaster (Bland et al., 2008; Sitnik et al., 2014). Drosophila melanogaster contains 28 identified neprilysin and neprilysin-like genes (Meyer et al., 2021). Among them, Neprilysin-like 15 (Nepl15), a predicted secreted, catalytically inactive Nep, regulates glycogen and lipid storage in a sex-dependent manner. Previous work with Nepl15ko (knock-out) flies revealed that glycogen and triacylglyceride (TAG) storage were significantly reduced in adult male mutant flies, while significantly more glycogen storage was observed in adult female mutants, albeit the mutants consume the same amount of food as the controls (Banerjee et al., 2021). Interestingly, Banerjee et al., (2021) and transcriptomics data from FlyAtlas2 (Leader et al., 2018) showed that the Nepl15 transcript is differentially expressed in both larval and adult fly organs, with higher expression in larval fat body and adult head, heart, and fat body. Overall, FlyAtlas shows that the whole adult male body expresses 4.2 times more Nepl15 than the whole adult female body. Additionally, overexpression of Nepl15 in the fat body increased triglyceride levels only, whereas its overexpression in the gut increased glycogen levels only in adult male flies, suggesting Nepl15 has tissue-specific variable effects (Banerjee et al., 2021). Interestingly, the fly database (FlyBase.org) reports that the Nepl15 gene in D. melanogaster ISO1 MT (dm6) (y1; cn1; bw1; sp1) strain has no intron and produces only one transcript. However, 10 other fly Neprilysin and Neprilysin-like genes encode more than one transcript (Table 1) (FlyBase.org).
Table 1. List of Neprilysins and the corresponding number of transcripts and unique polypeptides they produce.
Symbol | Name | Number of Transcripts | Number of Polypeptides |
Nep1 | Neprilysin 1 | 4 | 4 |
Nep2 | Neprilysin 2 | 3 | 3 |
Nep3 | Neprilysin 3 | 3 | 3 |
Nep4 | Neprilysin 4 | 3 | 3 |
Nep5 | Neprilysin 5 | 4 | 4 |
Nep6 | Neprilysin 6 | 2 | 2 |
Nep7 | Neprilysin 7 | 1 | 1 |
frma | fra mauro | 2 | 2 |
goe | gone early | 3 | 3 |
Nepl3 | Neprilysin-like 3 | 1 | 1 |
Nepl4 | Neprilysin-like 4 | 1 | 1 |
Nepl5 | Neprilysin-like 5 | 1 | 1 |
Nepl6 | Neprilysin-like 6 | 1 | 1 |
Nepl7 | Neprilysin-like 7 | 2 | 2 |
Nepl8 | Neprilysin-like 8 | 1 | 1 |
Nepl9 | Neprilysin-like 9 | 1 | 1 |
Nepl10 | Neprilysin-like 10 | 1 | 1 |
Nepl11 | Neprilysin-like 11 | 2 | 2 |
Nepl12 | Neprilysin-like 12 | 1 | 1 |
Nepl13 | Neprilysin-like 13 | 1 | 1 |
Nepl14 | Neprilysin-like 14 | 1 | 1 |
Nepl15 | Neprilysin-like 15 | 1 | 1 |
Nepl16 | Neprilysin-like 16 | 1 | 1 |
Nepl17 | Neprilysin-like 17 | 1 | 1 |
Nepl18 | Neprilysin-like 18 | 1 | 1 |
Nepl19 | Neprilysin-like 19 | 1 | 1 |
Nepl20 | Neprilysin-like 20 | 1 | 1 |
Nepl21 | Neprilysin-like 21 | 1 | 1 |
Therefore, we asked the following questions: Are there any unreported Nepl15 transcript variants present in wild-type (Oregon-R) adult male and female flies that produce different Nepl15 protein isoforms in the two sexes? Are there any differences in the 5′and 3′untranslated regions (UTRs) in the Nepl15 transcript which may contribute to its post-transcriptional regulation? To answer these questions, we isolated total RNA from the whole-body of adult male and virgin female Oregon-R flies (FBsn0000276) and synthesized cDNA. Next, we took PCR based approach to amplify the Nepl15 CDS (coding sequence, 2061 bps) and its transcript (2213 bps including the 5′and 3′UTRs), followed by sequencing them and aligning the sequences with the corresponding sequences in FlyBase.
We did not find any nucleotide sequence difference at the 5′ and 3′UTRs of the Oregon-R and FlyBase Nepl15 transcript sequences. However, sequencing results show that the Oregon-R Nepl15 CDS from male and female flies contains the exact 7-nucleotide sequence changes compared to the FlyBase sequence. These changes translate into only 5 amino acid changes, among which 3 changes include amino acids with different properties (Table 2) (Figure 1A). The Oregon-R adult male and female Nepl15 (ORNepl15M and ORNepl15F) protein sequences were aligned with the FlyBase Neprilysin1 (FBNep1) and Nepl15 (FBNepl15) protein sequences using ClustalW to show the changed 5 amino acid residues (Table 2) (Figure 1A). Further bioinformatics analysis of the Oregon-R Nepl15 protein reveals that the amino acid changes did not impact the Nepl15 predicted cleavage site (between amino acid 22 & 23) (SignalIP and DeepTMHMM) (Hallgren et al., 2022; Teufel et al., 2022), and extracellular localization (DeepLoc) (Ødum et al., 2024). Additional analysis of 3D models of the FlyBase Nepl15 (Figure 1B, blue ribbon diagram) and Oregon-R Nepl15 proteins utilizing AlphaFold 3 (Abramson et al., 2024) shows no significant change in their structures in their overlays (blue and purple ribbon depicts the Nepl15 3D protein models in FlyBase strain and Oregon-R, respectively) (Figures 1 C1 – C3).
Table 2. Nucleotide and amino acid sequencing alterations in Oregon-R Nepl15 CDS and protein compared to the corresponding FlyBase data.
Genomic Position | Nucleotide Change | Amino Acid Variant | Character Alterations |
3R:22766060 | T → C | F15L | - |
3R:22766049 | C → G | C18W | polar – hydrophobic; aromatic |
3R:22765507 | A → T | Q199L | negatively charged - hydrophobic |
3R:22765387 | G → C | R239T | Positively charged - polar |
3R:22764404 | G → T | V567L | - |
Collectively, these results reveal that a slightly different amino acid sequence in the Nepl15 protein is present in our lab-grown wild-type Oregon-R flies as compared to the FlyBase Nepl15 protein, indicative of a strain-specific amino acid sequence variation in the same protein. Bioinformatic analyses do not indicate any major structural or functional shift in the Oregon-R Nepl15 protein due to these changes. Thus, our study confirms the presence of only one Nepl15 transcript version in D. melanogaster Oregon R adult male and female flies. Although, the changes in the nucleotide sequences within the Oregon-R Nepl15 codons and corresponding amino acid changes in the Nepl15 protein may not impact the protein's localization, structure, and function, still our research outcome can contribute to future investigations in two significant ways: (a) this report will help to perform primer design, PCR, qPCR, gene cloning, guide DNA design for CRISPR, and site specific mutation accurately for Nepl15 gene in Oregon R fly strain; and (ii) if researchers use a Drosophila species or strain other than the one used in a database or previously published work, our result recommends that it is important to verify the DNA sequence before designing the components of molecular biology based experiments.
","references":[{"reference":"Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al., Jumper JM. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 630: 493-500. 1503.","pubmedId":"38718835","doi":"10.1038/s41586-024-07487-w"},{"reference":"Banerjee S, Woods C, Burnett M, Park SJ, Ja WW, Curtiss J. 2021. The Drosophila melanogaster Neprilysin Nepl15 is involved in lipid and carbohydrate storage. Sci Rep. 11: 2099. 1497.","pubmedId":"33483521","doi":"10.1038/s41598-021-81165-z"},{"reference":"Bland ND, Pinney JW, Thomas JE, Turner AJ, Isaac RE. 2008. Bioinformatic analysis of the neprilysin (M13) family of peptidases reveals complex evolutionary and functional relationships. BMC Evol Biol. 8: 16. 1494.","pubmedId":"18215274","doi":"10.1186/1471-2148-8-16"},{"reference":"Branco I, Choupina A. 2021. Bioinformatics: new tools and applications in life science and personalized medicine. Appl Microbiol Biotechnol. 105: 937-951. 1011.","pubmedId":"33404829","doi":"10.1007/s00253-020-11056-2"},{"reference":"FB2026_01, http://flybase.org (released 12th March, 2026).
","pubmedId":"","doi":""},{"reference":"Hallgren J, Tsirigos KD, Pedersen MD, Almagro Armenteros JJ, Marcatili P, Nielsen H, Krogh A, Winther O. 2022. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. biorxiv: 2022.04. 08.487609. 1512.","pubmedId":"","doi":""},{"reference":"Leader DP, Krause SA, Pandit A, Davies SA, Dow JAT. 2018. FlyAtlas 2: a new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46: D809-D815. 1498.","pubmedId":"29069479","doi":"10.1093/nar/gkx976"},{"reference":"Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. 2024. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 52: W521-W525. 1507.","pubmedId":"38597606","doi":"10.1093/nar/gkae241"},{"reference":"Meyer H, Buhr A, Callaerts P, Schiemann R, Wolfner MF, Marygold SJ. 2021. Identification and bioinformatic analysis of neprilysin and neprilysin-like metalloendopeptidases in. MicroPubl Biol. 2021 1496.","pubmedId":"34189422","doi":"10.17912/micropub.biology.000410"},{"reference":"Nalivaeva NN, Turner AJ. 2013. Neprilysin (Chapter 127), Handbook of Proteolytic Enzymes. 1491.","pubmedId":"","doi":""},{"reference":"Schling P, Schafer T. 2002. Human adipose tissue cells keep tight control on the angiotensin II levels in their vicinity. J Biol Chem. 277: 48066-75. 1492.","pubmedId":"12196514","doi":"10.1074/jbc.M204058200"},{"reference":"Sitnik JL, Francis C, Hens K, Huybrechts R, Wolfner MF, Callaerts P. 2014. Neprilysins: an evolutionarily conserved family of metalloproteases that play important roles in reproduction in Drosophila. Genetics. 196: 781-97. 1489.","pubmedId":"24395329","doi":"10.1534/genetics.113.160945"},{"reference":"Teufel F, Almagro Armenteros JJ, Johansen AR, Gislason MH, Pihl SI, Tsirigos KD, et al., Nielsen H. 2022. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol. 40: 1023-1025. 1501.","pubmedId":"34980915","doi":"10.1038/s41587-021-01156-3"},{"reference":"Turner AJ, Brown CD, Carson JA, Barnes K. 2000. The neprilysin family in health and disease. Adv Exp Med Biol. 477: 229-40. 1490.","pubmedId":"10849750","doi":"10.1007/0-306-46826-3_25"},{"reference":"Turner AJ, Isaac RE, Coates D. 2001. The neprilysin (NEP) family of zinc metalloendopeptidases: genomics and function. Bioessays. 23: 261-9. 1488.","pubmedId":"11223883","doi":"10.1002/1521-1878(200103)23:3<261::AID-BIES1036>3.0.CO;2-K"},{"reference":"Odum MT, Teufel F, Thumuluri V, Almagro Armenteros JJ, Johansen AR, Winther O, Nielsen H. 2024. DeepLoc 2.1: multi-label membrane protein type prediction using protein language models. Nucleic Acids Res. 52: W215-W220. 1511.","pubmedId":"38587188","doi":"10.1093/nar/gkae237"}],"title":"Identification of Drosophila melanogaster Strain-Specific Sequence Variations in the Nepl15 Transcript of Oregon-R relative to FlyBase Data
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"3da3c171-2084-491c-a680-a82a6e42892c","decision":"revise","abstract":"According to FlyBase, The Drosophila melanogaster (fruit fly) Neprilysin-like 15 (Nepl15) gene has only one annotated transcript and a 686-amino acid-long protein. However, Nepl15 transcripts exhibit organ- and sex-specific differential expression, and Nepl15 knock-out mutation results in sex-dependent contrasting phenotypes. Thus, we investigated whether unreported sex-specific Nepl15 transcripts exist. Our sequencing results of Nepl15 cDNA synthesized from the Oregon-R adult male and female RNA samples show a few changes in the codons, which alter the amino acid sequences in our samples. However, the changes do not impact the subcellular localization or overall Nepl15 protein structure as determined by bioinformatics analyses.
","acknowledgements":"We would like to thank the Texas Tech University (TTU) TrUE Scholars Undergraduate Research Program for supporting Chase Drucker with funding for reagents. American Heart Association (AHA) SURE (Supporting Undergraduate Research Experiences) scholars' program coordinated by Dr. Peter Keyel, Associate Professor of Biological Sciences at TTU, for supporting Chase with a Summer Research Internship and a travel award for presenting this work at the Scientific Sessions Conference 2025 organized by AHA. We also thank Dr. Surya Banerjee’s research lab members, Shahira Arzoo and Rubaia Tasmin, for their insights and help during this project.
","authors":[{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","methodology","software","writing_originalDraft"],"email":"cdrucker@ttu.edu","firstName":"Chase ","lastName":"Drucker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-6444-5259"},{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","investigation","methodology","formalAnalysis","validation","writing_reviewEditing","fundingAcquisition","supervision"],"email":"surya.banerjee@ttu.edu","firstName":"Surya Jyoti","lastName":"Banerjee","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7196-4315 "}],"awards":[{"awardId":"24SURE1331544","funderName":"American Heart Association (United States)","awardRecipient":"Chase Drucker"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":"https://portal.micropublication.org/uploads/5e7c2eef60e68b7fa84638225c613052.csv"},"extendedData":[{"description":"Primers sequences used for PCR and sequencing
","doi":null,"resourceType":"Dataset","name":"Primers.csv","url":"https://portal.micropublication.org/uploads/9ee988b5e35cc5acafeee20e78317a30.csv"}],"funding":"Financial support for this project was provided by the American Heart Association (24SURE1331544), and Texas Tech University TrUE Scholars. This project is mainly funded by the Texas Tech University faculty start-up funds provided to Dr. Surya Jyoti Banerjee.
","image":{"url":"https://portal.micropublication.org/uploads/5ade7c2f3058debb1c8bb65a565723af.png"},"imageCaption":"A. Multiple protein sequence alignment by ClustalW. FBNep1 (the Drosophila melanogaster typical Neprilysin1 protein sequence from FlyBase), FBNepl15 (FlyBase Nepl15 protein sequence), ORNepl15F or ORNepl15M (newly sequenced Oregon-R Nepl15 protein sequences from Female or Male adult flies). Multiple protein sequence alignment of Nep1 (typical Nep in fruit fly), FlyBase (FB) Nepl15, and Oregon-R Nepl15 protein sequences show FBNepl15 and Oregon-R Nepl15 proteins lack the (684) HEXXH and (746) EXXH catalytic motifs that are present in Neprilysin1 (Nep1). Additionally, 5 amino acids are different in the Oregon-R Nepl15 protein (at 15, 18, 199, 239, and 567 positions) from the FB Nepl15 protein sequence (see Table 2). Colored boxes indicate altered amino acid residues in Oregon-R Nepl15 protein relative to FB Nepl15 protein: (blue) indicating the original residue, (green) designating no change at the amino acid residue even though nucleotide sequence was altered, and (red) representing altered amino acid residues. The numbers underneath each colored residue correspond to the amino acid position on the Nepl15 protein sequence. B. Predicted 3D protein structure of FB Nepl15 protein made by AlphaFold 3. The box plot shows a predicted aligned errors (PAE) plot, mapping the expected positional error (Å) between pairs of residues, generated by AlphaFold 3. 3D model residues and PAE plot are colored and indicated in the provided key, in which lower values (blue) indicate higher levels of confidence. C1, C2, and C3. Overlay of the 3D models of FBNepl15 (blue) and Oregon-R Nepl15 (purple) proteins from three different angles, as generated by AlphaFold 3. Three images display different angles of these two overlapping proteins, without indicating any major change in the Oregon-R Nepl15 protein structure despite the 5 amino acid changes. Table: List of Neprilysins and the corresponding number of transcripts and unique polypeptides they produce (1) and nucleotide and amino acid sequencing alterations in Oregon-R Nepl15 CDS and protein compared to the corresponding FlyBase data (2).
","imageTitle":"Alignment of FlyBase Nep1, Nepl15 and Oregon-R Nepl15 protein sequences, and predicted 3D structures of FlyBase and Oregon-R Nepl15 proteins.
","methods":"Drosophila melanogaster husbandry
Drosophila melanogaster Oregon-R (OR) strain was maintained on Bloomington's fly food formulation (Genesee Sc Nutri-Fly_66-116) at 25 °C. 5 to 7 days old male and virgin female adult flies were used for RNA extraction.
FlyBase Data:
The FlyBase website, http://flybase.org, was used to retrieve the Nepl15 transcript and CDS sequences. The genome release number is FB2026_01 (March 12, 2026).
RNA isolation and cDNA synthesis
Total RNA was extracted from 5 to 7 days old, 25 male and 25 virgin female Oregon-R adult flies using TRI reagent (Sigma T9424) (Banerjee et al., 2021). The RNA sample purity was validated by measuring 260/280 and 230/280 ratios, and the RNA integrity was tested by gel electrophoresis. The cDNA synthesis was then performed using 5x iScript Reaction Mix (Bio-Rad 1708889) following the manufacturer's protocol.
PCR and Purification
Specific forward (FP) and reverse primer (RP) pairs (Table 3) were designed using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021)to amplify Nepl15 CDS and Transcript using the OR male and female cDNA templates separately. The primer sequences were designed based on the FlyBase Nepl15 CDS and Transcript sequences. PCR was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs M0492S) following the manufacturer's protocol. The PCR products were purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel 740609) following the manufacturer's instructions.
Table 3. List of primers used for PCR.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP | ATGGCCTCTCAACCGCTTG |
Nepl15_CDS_RP | TCAGTAGAGAGTGCACTTAAAGCG |
Nepl15_T.SCRPT_FP | CCCGCTCAGTTTCGTTTC |
Nepl15_T.SCRPT_RP | ATGACAAGTGCAACAAATGCTTTT |
DNA Sequencing Analysis
We designed several primers (listed in Table 4) to cover the entire length of the Nepl15 CDS or transcript. Sanger sequencing of the purified PCR samples was performed by Azenta Life Sciences (genewiz.com). The high-quality sequence contigs were aligned to the corresponding FlyBase sequence using Serial Cloner (v2.6.1) (Branco & Choupina, 2021).
Table 4. List of primers used for sequencing.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP1 | TGAAACGCAAGCTTGGCGTG |
Nepl15_CDS_FP2 | GCTTTGGAAGCGTTGGATAT |
Nepl15_CDS_FP3 | TGGAATACAAGGGTAAGCCG |
Nepl15_CDS_RP1 | TATTCAGGGCGGATCGCGTG |
Nepl15_T.SCRPT_FP1 | GGTTGGCCGGAGATTCGTGT |
Nepl15_T.SCRPT_FP2 | CATGTCAAATCTGGTGGATG |
Nepl15_T.SCRPT_FP3 | TGGGATCACACCTCGGAGAG |
Nepl15_T.SCRPT_RP1 | GGCACTGTTCTCAGCTCCTC |
Protein sequence analysis and other bioinformatics analysis
Changes in the Oregon-R Nepl15 CDS sequences compared to the FlyBase sequence were identified using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021). Variations in the Nepl15 codon sequences between Oregon-R CDS and FlyBase CDS sequences were analyzed using Serial Cloner's built-in BLASTn and BLASTp alignment tools. Next, Clustal Omega (Madeira et al., 2024) was used to align the FlyBase Neprilysin 1 (DmNep1, a typical fly neprilysin, orthologous to human neprilysin), Oregon-R male and female Nepl15, and FlyBase Nepl15 protein sequences to identify changes in Oregon-R Nepl15 protein sequences. The newly sequenced Oregon-R Nepl15 protein sequence was analyzed for any change in its subcellular localization, signal sequence site, and 3D structure compared to those of the FlyBase-reported Nepl15 protein sequence using different bioinformatics tools like DeepLoc2.1 (Ødum et al., 2024), SignalP – 6.0 (Teufel et al., 2022), and DeepTMHMM – 1.0 (Hallgren et al., 2022), respectively.
","reagents":"All reagents' names, with the company names and catalog numbers, are mentioned in the methods.
","patternDescription":"Neprilysins (neutral endopeptidases; Neps) belong to the M13 family of Zinc (II) dependent metallopeptidases and were first discovered in mammals (Turner et al., 2001). Typical mammalian Neps, including human Neprilysin (HsNep) encoded by the MME (Membrane Metalloendopeptidase) gene, have a short cytoplasmic N-terminal domain, a shorter hydrophobic transmembrane domain, and a long extracellular C-terminal domain that houses highly conserved motifs. Two of these motifs, HEXXH and EXXAD, are responsible for Zn (II) binding and the subsequent proteolytic cleavage of substrate peptides, typically occurring at the N-terminal side of a hydrophobic residue with a strong preference for Phe or Leu toward the C-terminus (Nalivaeva & Turner, 2013; Sitnik et al., 2014; Turner et al., 2000).
Typical mammalian Neps are normally expressed in a variety of cell types, including brush border cells of the kidneys, brain, neutrophils, lungs, synapses, along with adipocytes and smooth muscle cells present throughout gut tissue, to name a few. Neprilysin cleaves an array of peptides and controls cellular signals that impact the nervous, cardiovascular, inflammatory, immune systems, and nutrient homeostasis (Schling & Schäfer, 2002; Turner et al., 2001).
Phylogenetic studies have identified the presence of Nep orthologs in invertebrate organisms, including Drosophila melanogaster (Bland et al., 2008; Sitnik et al., 2014). Drosophila melanogaster contains 28 identified neprilysin and neprilysin-like genes (Meyer et al., 2021). Among them, Neprilysin-like 15 (Nepl15), a predicted secreted, catalytically inactive Nep, regulates glycogen and lipid storage in a sex-dependent manner. Previous work with Nepl15ko (knock-out) flies revealed that glycogen and triacylglyceride (TAG) storage were significantly reduced in adult male mutant flies, while significantly more glycogen storage was observed in adult female mutants, albeit the mutants consume the same amount of food as the controls (Banerjee et al., 2021). Interestingly, Banerjee et al., (2021) and transcriptomics data from FlyAtlas2 (Leader et al., 2018) showed that the Nepl15 transcript is differentially expressed in both larval and adult fly organs, with higher expression in larval fat body and adult head, heart, and fat body. Overall, FlyAtlas shows that the whole adult male body expresses 4.2 times more Nepl15 than the whole adult female body. Additionally, overexpression of Nepl15 in the fat body increased triglyceride levels only, whereas its overexpression in the gut increased glycogen levels only in adult male flies, suggesting Nepl15 has tissue-specific variable effects (Banerjee et al., 2021). Interestingly, the fly database (FlyBase.org) reports that the Nepl15 gene in D. melanogaster ISO1 MT (dm6) (y1; cn1; bw1; sp1) strain has no intron and produces only one transcript. However, 10 other fly Neprilysin and Neprilysin-like genes encode more than one transcript (Table 1) (FlyBase.org).
Therefore, we asked the following questions: Are there any unreported Nepl15 transcript variants present in wild-type (Oregon-R) adult male and female flies that produce different Nepl15 protein isoforms in the two sexes? Are there any differences in the 5′and 3′untranslated regions (UTRs) in the Nepl15 transcript which may contribute to its post-transcriptional regulation? To answer these questions, we isolated total RNA from the whole-body of adult male and virgin female Oregon-R flies (FBsn0000276) and synthesized cDNA. Next, we took PCR based approach to amplify the Nepl15 CDS (coding sequence, 2061 bps) and its transcript (2213 bps including the 5′and 3′UTRs), followed by sequencing them and aligning the sequences with the corresponding sequences in FlyBase.
We did not find any nucleotide sequence difference at the 5′ and 3′UTRs of the Oregon-R and FlyBase Nepl15 transcript sequences. However, sequencing results show that the Oregon-R Nepl15 CDS from male and female flies contains the exact 7-nucleotide sequence changes compared to the FlyBase sequence. These changes translate into only 5 amino acid changes, among which 3 changes include amino acids with different properties (Table 2) (Figure 1A). The Oregon-R adult male and female Nepl15 (ORNepl15M and ORNepl15F) protein sequences were aligned with the FlyBase Neprilysin1 (FBNep1) and Nepl15 (FBNepl15) protein sequences using ClustalW to show the changed 5 amino acid residues (Table 2) (Figure 1A). Further bioinformatics analysis of the Oregon-R Nepl15 protein reveals that the amino acid changes did not impact the Nepl15 predicted cleavage site (between amino acid 22 & 23) (SignalIP and DeepTMHMM) (Hallgren et al., 2022; Teufel et al., 2022), and extracellular localization (DeepLoc) (Ødum et al., 2024). Additional analysis of 3D models of the FlyBase Nepl15 (Figure 1B, blue ribbon diagram) and Oregon-R Nepl15 proteins utilizing AlphaFold 3 (Abramson et al., 2024) shows no significant change in their structures in their overlays (blue and purple ribbon depicts the Nepl15 3D protein models in FlyBase strain and Oregon-R, respectively) (Figures 1 C1 – C3).
Collectively, these results reveal that a slightly different amino acid sequence in the Nepl15 protein is present in our lab-grown wild-type Oregon-R flies as compared to the FlyBase Nepl15 protein, indicative of a strain-specific amino acid sequence variation in the same protein. Bioinformatic analyses do not indicate any major structural or functional shift in the Oregon-R Nepl15 protein due to these changes. Thus, our study confirms the presence of only one Nepl15 transcript version in D. melanogaster Oregon R adult male and female flies. Although, the changes in the nucleotide sequences within the Oregon-R Nepl15 codons and corresponding amino acid changes in the Nepl15 protein may not impact the protein's localization, structure, and function, still our research outcome can contribute to future investigations in two significant ways: (a) this report will help to perform primer design, PCR, qPCR, gene cloning, guide DNA design for CRISPR, and site specific mutation accurately for Nepl15 gene in Oregon R fly strain; and (ii) if researchers use a Drosophila species or strain other than the one used in a database or previously published work, our result recommends that it is important to verify the DNA sequence before designing the components of molecular biology based experiments.
","references":[{"reference":"Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al., Jumper JM. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 630: 493-500. 1503.","pubmedId":"38718835","doi":"10.1038/s41586-024-07487-w"},{"reference":"Banerjee S, Woods C, Burnett M, Park SJ, Ja WW, Curtiss J. 2021. The Drosophila melanogaster Neprilysin Nepl15 is involved in lipid and carbohydrate storage. Sci Rep. 11: 2099. 1497.","pubmedId":"33483521","doi":"10.1038/s41598-021-81165-z"},{"reference":"Bland ND, Pinney JW, Thomas JE, Turner AJ, Isaac RE. 2008. Bioinformatic analysis of the neprilysin (M13) family of peptidases reveals complex evolutionary and functional relationships. BMC Evol Biol. 8: 16. 1494.","pubmedId":"18215274","doi":"10.1186/1471-2148-8-16"},{"reference":"Branco I, Choupina A. 2021. Bioinformatics: new tools and applications in life science and personalized medicine. Appl Microbiol Biotechnol. 105: 937-951. 1011.","pubmedId":"33404829","doi":"10.1007/s00253-020-11056-2"},{"reference":"FB2026_01, http://flybase.org (released 12th March, 2026).
","pubmedId":"","doi":""},{"reference":"Hallgren J, Tsirigos KD, Pedersen MD, Almagro Armenteros JJ, Marcatili P, Nielsen H, Krogh A, Winther O. 2022. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. biorxiv: 2022.04. 08.487609. 1512.","pubmedId":"","doi":""},{"reference":"Leader DP, Krause SA, Pandit A, Davies SA, Dow JAT. 2018. FlyAtlas 2: a new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46: D809-D815. 1498.","pubmedId":"29069479","doi":"10.1093/nar/gkx976"},{"reference":"Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. 2024. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 52: W521-W525. 1507.","pubmedId":"38597606","doi":"10.1093/nar/gkae241"},{"reference":"Meyer H, Buhr A, Callaerts P, Schiemann R, Wolfner MF, Marygold SJ. 2021. Identification and bioinformatic analysis of neprilysin and neprilysin-like metalloendopeptidases in. MicroPubl Biol. 2021 1496.","pubmedId":"34189422","doi":"10.17912/micropub.biology.000410"},{"reference":"Nalivaeva NN, Turner AJ. 2013. Neprilysin (Chapter 127), Handbook of Proteolytic Enzymes. 1491.","pubmedId":"","doi":""},{"reference":"Schling P, Schafer T. 2002. Human adipose tissue cells keep tight control on the angiotensin II levels in their vicinity. J Biol Chem. 277: 48066-75. 1492.","pubmedId":"12196514","doi":"10.1074/jbc.M204058200"},{"reference":"Sitnik JL, Francis C, Hens K, Huybrechts R, Wolfner MF, Callaerts P. 2014. Neprilysins: an evolutionarily conserved family of metalloproteases that play important roles in reproduction in Drosophila. Genetics. 196: 781-97. 1489.","pubmedId":"24395329","doi":"10.1534/genetics.113.160945"},{"reference":"Teufel F, Almagro Armenteros JJ, Johansen AR, Gislason MH, Pihl SI, Tsirigos KD, et al., Nielsen H. 2022. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol. 40: 1023-1025. 1501.","pubmedId":"34980915","doi":"10.1038/s41587-021-01156-3"},{"reference":"Turner AJ, Brown CD, Carson JA, Barnes K. 2000. The neprilysin family in health and disease. Adv Exp Med Biol. 477: 229-40. 1490.","pubmedId":"10849750","doi":"10.1007/0-306-46826-3_25"},{"reference":"Turner AJ, Isaac RE, Coates D. 2001. The neprilysin (NEP) family of zinc metalloendopeptidases: genomics and function. Bioessays. 23: 261-9. 1488.","pubmedId":"11223883","doi":"10.1002/1521-1878(200103)23:3<261::AID-BIES1036>3.0.CO;2-K"},{"reference":"Odum MT, Teufel F, Thumuluri V, Almagro Armenteros JJ, Johansen AR, Winther O, Nielsen H. 2024. DeepLoc 2.1: multi-label membrane protein type prediction using protein language models. Nucleic Acids Res. 52: W215-W220. 1511.","pubmedId":"38587188","doi":"10.1093/nar/gkae237"}],"title":"Identification of Drosophila melanogaster Strain-Specific Sequence Variations in the Nepl15 Transcript of Oregon-R relative to FlyBase Data
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"b43d3752-3d39-4ff0-85d2-4998e2b951d8","decision":"edit","abstract":"According to FlyBase, the Drosophila melanogaster (fruit fly) Neprilysin-like 15 (Nepl15) gene has only one annotated transcript and a 686-amino acid-long protein. However, Nepl15 transcripts exhibit organ- and sex-specific differential expression, and Nepl15 knock-out mutation results in sex-dependent contrasting phenotypes. Thus, we investigated whether unreported sex-specific Nepl15 transcripts exist. Our sequencing results of Nepl15 cDNA synthesized from the Oregon-R adult male and female RNA samples show a few changes in the codons, which alter the amino acid sequences in our samples. However, the changes do not impact the subcellular localization or overall Nepl15 protein structure as determined by bioinformatics analyses.
","acknowledgements":"We would like to thank the Texas Tech University (TTU) TrUE Scholars Undergraduate Research Program for supporting Chase Drucker with funding for reagents. American Heart Association (AHA) SURE (Supporting Undergraduate Research Experiences) scholars' program coordinated by Dr. Peter Keyel, Associate Professor of Biological Sciences at TTU, for supporting Chase with a Summer Research Internship and a travel award for presenting this work at the Scientific Sessions Conference 2025 organized by AHA. We also thank Dr. Surya Banerjee’s research lab members, Shahira Arzoo and Rubaia Tasmin, for their insights and help during this project.
","authors":[{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","methodology","software","writing_originalDraft"],"email":"cdrucker@ttu.edu","firstName":"Chase ","lastName":"Drucker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-6444-5259"},{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","investigation","methodology","formalAnalysis","validation","writing_reviewEditing","fundingAcquisition","supervision"],"email":"surya.banerjee@ttu.edu","firstName":"Surya Jyoti","lastName":"Banerjee","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7196-4315 "}],"awards":[{"awardId":"24SURE1331544","funderName":"American Heart Association (United States)","awardRecipient":"Chase Drucker"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":"https://portal.micropublication.org/uploads/5e7c2eef60e68b7fa84638225c613052.csv"},"extendedData":[{"description":"Primers sequences used for PCR and sequencing
","doi":null,"resourceType":"Dataset","name":"Primers.csv","url":"https://portal.micropublication.org/uploads/9ee988b5e35cc5acafeee20e78317a30.csv"}],"funding":"Financial support for this project was provided by the American Heart Association (24SURE1331544), and Texas Tech University TrUE Scholars. This project is mainly funded by the Texas Tech University faculty start-up funds provided to Dr. Surya Jyoti Banerjee.
","image":{"url":"https://portal.micropublication.org/uploads/5ade7c2f3058debb1c8bb65a565723af.png"},"imageCaption":"A. Multiple protein sequence alignment by ClustalW. FBNep1 (the Drosophila melanogaster typical Neprilysin1 protein sequence from FlyBase), FBNepl15 (FlyBase Nepl15 protein sequence), ORNepl15F or ORNepl15M (newly sequenced Oregon-R Nepl15 protein sequences from Female or Male adult flies). Multiple protein sequence alignment of Nep1 (typical Nep in fruit fly), FlyBase (FB) Nepl15, and Oregon-R Nepl15 protein sequences show FBNepl15 and Oregon-R Nepl15 proteins lack the (684) HEXXH and (746) EXXH catalytic motifs that are present in Neprilysin1 (Nep1). Additionally, 5 amino acids are different in the Oregon-R Nepl15 protein (at 15, 18, 199, 239, and 567 positions) from the FB Nepl15 protein sequence (see Table 2). Colored boxes indicate altered amino acid residues in Oregon-R Nepl15 protein relative to FB Nepl15 protein: (blue) indicating the original residue, (green) designating no change at the amino acid residue even though nucleotide sequence was altered, and (red) representing altered amino acid residues. The numbers underneath each colored residue correspond to the amino acid position on the Nepl15 protein sequence. B. Predicted 3D protein structure of FB Nepl15 protein made by AlphaFold 3. The box plot shows a predicted aligned errors (PAE) plot, mapping the expected positional error (Å) between pairs of residues, generated by AlphaFold 3. 3D model residues and PAE plot are colored and indicated in the provided key, in which lower values (blue) indicate higher levels of confidence. C1, C2, and C3. Overlay of the 3D models of FBNepl15 (blue) and Oregon-R Nepl15 (purple) proteins from three different angles, as generated by AlphaFold 3. Three images display different angles of these two overlapping proteins, without indicating any major change in the Oregon-R Nepl15 protein structure despite the 5 amino acid changes. Table: List of Neprilysins and the corresponding number of transcripts and unique polypeptides they produce (1) and nucleotide and amino acid sequencing alterations in Oregon-R Nepl15 CDS and protein compared to the corresponding FlyBase data (2).
","imageTitle":"Alignment of FlyBase Nep1, Nepl15, and Oregon-R Nepl15 protein sequences (A), and predicted 3D structures of FlyBase and Oregon-R Nepl15 proteins (B and C1 to C3). Table 1: List of Neprilysins and the corresponding number of transcripts and unique polypeptides they produce. Table 2: Nucleotide and amino acid sequencing alterations in Oregon-R Nepl15 CDS and protein compared to the corresponding FlyBase data
","methods":"Drosophila melanogaster husbandry
Drosophila melanogaster Oregon-R strain was maintained on Bloomington's fly food formulation (Genesee Scientific Nutri-Fly_66-116) at 25 °C. 5 to 7 days old male and virgin female adult flies were used for RNA extraction.
FlyBase Data:
The FlyBase website, http://flybase.org, was used to retrieve the Nepl15 transcript and CDS sequences. The genome release number is FB2026_01 (March 12, 2026).
RNA isolation and cDNA synthesis
Total RNA was extracted from 5 to 7 days old, 25 male and 25 virgin female Oregon-R adult flies using TRI reagent (Sigma T9424) (Banerjee et al., 2021). The RNA sample purity was validated by measuring 260/280 and 230/280 ratios, and the RNA integrity was tested by gel electrophoresis. The cDNA synthesis was then performed using 5x iScript Reaction Mix (Bio-Rad 1708889) following the manufacturer's protocol.
PCR and Purification
Specific forward (FP) and reverse primer (RP) pairs (Table 3) were designed using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021) to amplify Nepl15 CDS and transcript using the OR male and female cDNA templates separately. The primer sequences were designed based on the FlyBase Nepl15 CDS and Transcript sequences. PCR was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs M0492S) following the manufacturer's protocol. The PCR products were purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel 740609) following the manufacturer's instructions.
Table 3. List of primers used for PCR.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP | ATGGCCTCTCAACCGCTTG |
Nepl15_CDS_RP | TCAGTAGAGAGTGCACTTAAAGCG |
Nepl15_T.SCRPT_FP | CCCGCTCAGTTTCGTTTC |
Nepl15_T.SCRPT_RP | ATGACAAGTGCAACAAATGCTTTT |
DNA Sequencing Analysis
We designed several primers (listed in Table 4) to cover the entire length of the Nepl15 CDS or transcript. Sanger sequencing of the purified PCR samples was performed by Azenta Life Sciences (genewiz.com). The high-quality sequence contigs were aligned to the corresponding FlyBase sequence using Serial Cloner (v2.6.1) (Branco & Choupina, 2021).
Table 4. List of primers used for sequencing.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP1 | TGAAACGCAAGCTTGGCGTG |
Nepl15_CDS_FP2 | GCTTTGGAAGCGTTGGATAT |
Nepl15_CDS_FP3 | TGGAATACAAGGGTAAGCCG |
Nepl15_CDS_RP1 | TATTCAGGGCGGATCGCGTG |
Nepl15_T.SCRPT_FP1 | GGTTGGCCGGAGATTCGTGT |
Nepl15_T.SCRPT_FP2 | CATGTCAAATCTGGTGGATG |
Nepl15_T.SCRPT_FP3 | TGGGATCACACCTCGGAGAG |
Nepl15_T.SCRPT_RP1 | GGCACTGTTCTCAGCTCCTC |
Protein sequence analysis and other bioinformatics analysis
Changes in the Oregon-R Nepl15 CDS sequences compared to the FlyBase sequence were identified using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021). Variations in the Nepl15 codon sequences between Oregon-R CDS and FlyBase CDS sequences were analyzed using Serial Cloner's built-in BLASTn and BLASTp alignment tools. Next, Clustal Omega (Madeira et al., 2024) was used to align the FlyBase Neprilysin 1 (DmNep1, a typical fly neprilysin, orthologous to human neprilysin), Oregon-R male and female Nepl15, and FlyBase Nepl15 protein sequences to identify changes in Oregon-R Nepl15 protein sequences. The newly sequenced Oregon-R Nepl15 protein sequence was analyzed for any change in its subcellular localization, signal sequence site, and 3D structure compared to those of the FlyBase-reported Nepl15 protein sequence using different bioinformatics tools like DeepLoc2.1 (Ødum et al., 2024), SignalP – 6.0 (Teufel et al., 2022), and DeepTMHMM – 1.0 (Hallgren et al., 2022), respectively.
AlphaFold 3 Protein Prediction
Protein structure predictions for Nepl15 were generated using AlphaFold 3 within the ChimeraX interface. The amino acid sequence of the Oregon-R Nepl15 protein was used as input. Structure prediction was performed in ChimeraX (version 1.11.1) using the following workflow: Tools to Structure Prediction to AlphaFold, after which the protein sequence was entered into the “Sequence” field and submitted for prediction. The “don't minimize” parameter was selected before the sequence in the Google Collab window to prevent minimization during model generation, consistent with previously described protocols. Multiple models were generated, and model confidence was evaluated using predicted aligned error (PAE) metrics. The structure with the highest overall confidence, defined by the lowest PAE values and highest predicted local distance difference test scores, was automatically selected for further visualization and structural alignment analyses (Abramson et al., 2024; Meng et al., 2023).
","reagents":"All reagents' names, with the company names and catalog numbers, are mentioned in the methods.
","patternDescription":"Neprilysins (neutral endopeptidases; Neps) belong to the M13 family of Zinc (II) dependent metallopeptidases and were first discovered in mammals (Turner et al., 2001). Typical mammalian Neps, including human Neprilysin (HsNep) encoded by the MME (Membrane Metalloendopeptidase) gene, have a short cytoplasmic N-terminal domain, a shorter hydrophobic transmembrane domain, and a long extracellular C-terminal domain that houses highly conserved motifs. Two of these motifs, HEXXH and EXXAD, are responsible for Zn (II) binding and the subsequent proteolytic cleavage of substrate peptides, typically occurring at the N-terminal side of a hydrophobic residue with a strong preference for Phe or Leu toward the C-terminus (Nalivaeva & Turner, 2013; Sitnik et al., 2014; Turner et al., 2000).
Typical mammalian Neps are normally expressed in a variety of cell types, including brush border cells of the kidneys, brain, neutrophils, lungs, synapses, along with adipocytes and smooth muscle cells present throughout gut tissue, to name a few. Neprilysin cleaves an array of peptides and controls cellular signals that impact the nervous, cardiovascular, inflammatory, immune systems, and nutrient homeostasis (Schling & Schäfer, 2002; Turner et al., 2001).
Phylogenetic studies have identified the presence of Nep orthologs in invertebrate organisms, including Drosophila melanogaster (Bland et al., 2008; Sitnik et al., 2014). Drosophila melanogaster contains 28 identified neprilysin and neprilysin-like genes (Meyer et al., 2021). Among them, Neprilysin-like 15 (Nepl15), a predicted secreted, catalytically inactive Nep, regulates glycogen and lipid storage in a sex-dependent manner. Previous work with Nepl15ko (knock-out) flies revealed that glycogen and triacylglyceride storage were significantly reduced in adult male mutant flies, while significantly more glycogen storage was observed in adult female mutants, albeit the mutants consume the same amount of food as the controls (Banerjee et al., 2021). Interestingly, a previous study (Banerjee et al., 2021) and transcriptomics data from FlyAtlas2 (Leader et al., 2018) showed that the Nepl15 transcript is differentially expressed in both larval and adult fly organs, with higher expression in larval fat body and adult head, heart, and fat body. Overall, FlyAtlas shows that the whole adult male body expresses 4.2 times more Nepl15 than the whole adult female body. Additionally, overexpression of Nepl15 in the fat body increased triglyceride levels only, whereas its overexpression in the gut increased glycogen levels only in adult male flies, suggesting Nepl15 has tissue-specific variable effects (Banerjee et al., 2021). Interestingly, the fly database (FlyBase.org) reports that the Nepl15 gene in D. melanogaster ISO1 MT (dm6) (y1; cn1; bw1; sp1) strain has no intron and produces only one transcript. However, 10 other fly Neprilysin and Neprilysin-like genes encode more than one transcript (Table 1) (FlyBase.org).
Therefore, we asked the following questions: Are there any unreported Nepl15 transcript variants present in wild-type (Oregon-R) adult male and female flies that produce different Nepl15 protein isoforms in the two sexes? Are there any differences in the 5′ and 3′ untranslated regions (UTRs) in the Nepl15 transcript which may contribute to its post-transcriptional regulation? To answer these questions, we isolated total RNA from the whole-body of adult male and virgin female Oregon-R flies (FBsn0000276) and synthesized cDNA. Next, we took PCR based approach to amplify the Nepl15 CDS (coding sequence, 2061 bps) and its transcript (2213 bps including the 5′ and 3′ UTRs), followed by sequencing them and aligning the sequences with the corresponding sequences in FlyBase.
We did not find any nucleotide sequence difference at the 5′ and 3′ UTRs of the Oregon-R and FlyBase Nepl15 transcript sequences. However, sequencing results show that the Oregon-R Nepl15 CDS from male and female flies contains the exact 7-nucleotide sequence changes compared to the FlyBase sequence. These changes translate into only 5 amino acid changes, among which 3 changes include amino acids with different properties (Table 2) (Figure 1A). The Oregon-R adult male and female Nepl15 (ORNepl15M and ORNepl15F) protein sequences were aligned with the FlyBase Neprilysin1 (FBNep1) and Nepl15 (FBNepl15) protein sequences using ClustalW to show the changed 5 amino acid residues (Table 2) (Figure 1A). Further bioinformatics analysis of the Oregon-R Nepl15 protein reveals that the amino acid changes did not impact the Nepl15 predicted cleavage site (between amino acids 22 and 23) (SignalIP and DeepTMHMM) (Hallgren et al., 2022; Teufel et al., 2022), and extracellular localization (DeepLoc) (Ødum et al., 2024). Additional analysis of 3D models of the FlyBase Nepl15 (Figure 1B, blue ribbon diagram) and Oregon-R Nepl15 proteins utilizing AlphaFold 3 (Abramson et al., 2024) shows no significant change in their structures in their overlays (blue and purple ribbons depict the Nepl15 3D protein models in FlyBase strain and Oregon-R, respectively) (Figures 1 C1 – C3).
Collectively, these results reveal that a slightly different amino acid sequence in the Nepl15 protein is present in our lab-grown wild-type Oregon-R flies as compared to the FlyBase Nepl15 protein, indicative of a strain-specific amino acid sequence variation in the same protein. Bioinformatic analyses do not indicate any major structural or functional shifts in the Oregon-R Nepl15 protein due to these changes. Thus, our study confirms the presence of only one Nepl15 transcript version in D. melanogaster Oregon-R adult male and female flies. Although, the changes in the nucleotide sequences within the Oregon-R Nepl15 codons and corresponding amino acid changes in the Nepl15 protein may not impact the protein's localization, structure, and function, still our research outcome can contribute to future investigations in two significant ways: (a) this report will help to perform primer design, PCR, qPCR, gene cloning, guide DNA design for CRISPR, and site specific mutation accurately for Nepl15 gene in Oregon-R fly strain; and (ii) if researchers use a Drosophila species or strain other than the one used in a database or previously published work, our result recommends that it is important to verify the DNA sequence before designing the components of molecular biology based experiments.
","references":[{"reference":"Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al., Jumper JM. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 630: 493-500. 1503.","pubmedId":"38718835","doi":"10.1038/s41586-024-07487-w"},{"reference":"Banerjee S, Woods C, Burnett M, Park SJ, Ja WW, Curtiss J. 2021. The Drosophila melanogaster Neprilysin Nepl15 is involved in lipid and carbohydrate storage. Sci Rep. 11: 2099. 1497.","pubmedId":"33483521","doi":"10.1038/s41598-021-81165-z"},{"reference":"Bland ND, Pinney JW, Thomas JE, Turner AJ, Isaac RE. 2008. Bioinformatic analysis of the neprilysin (M13) family of peptidases reveals complex evolutionary and functional relationships. BMC Evol Biol. 8: 16. 1494.","pubmedId":"18215274","doi":"10.1186/1471-2148-8-16"},{"reference":"Branco I, Choupina A. 2021. Bioinformatics: new tools and applications in life science and personalized medicine. Appl Microbiol Biotechnol. 105: 937-951. 1011.","pubmedId":"33404829","doi":"10.1007/s00253-020-11056-2"},{"reference":"FB2026_01, http://flybase.org (released 12th March, 2026).
","pubmedId":"","doi":""},{"reference":"Hallgren J, Tsirigos KD, Pedersen MD, Almagro Armenteros JJ, Marcatili P, Nielsen H, Krogh A, Winther O. 2022. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. biorxiv: 2022.04. 08.487609. 1512.","pubmedId":"","doi":""},{"reference":"Leader DP, Krause SA, Pandit A, Davies SA, Dow JAT. 2018. FlyAtlas 2: a new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46: D809-D815. 1498.","pubmedId":"29069479","doi":"10.1093/nar/gkx976"},{"reference":"Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. 2024. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 52: W521-W525. 1507.","pubmedId":"38597606","doi":"10.1093/nar/gkae241"},{"reference":"Meng EC, Goddard TD, Pettersen EF, Couch GS, Pearson ZJ, Morris JH, Ferrin TE. 2023.
Identification of Drosophila melanogaster Strain-Specific Sequence Variations in the Nepl15 Transcript of Oregon-R relative to FlyBase Data
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]},{"id":"8bcbe534-e81e-436a-88b3-8ca8200d1904","decision":"publish","abstract":"According to FlyBase, the Drosophila melanogaster (fruit fly) Neprilysin-like 15 (Nepl15) gene has only one annotated transcript and a 686-amino acid-long protein. However, Nepl15 transcripts exhibit organ- and sex-specific differential expression, and Nepl15 knock-out mutation results in sex-dependent contrasting phenotypes. Thus, we investigated whether unreported sex-specific Nepl15 transcripts exist. Our sequencing results of Nepl15 cDNA synthesized from the Oregon-R adult male and female RNA samples show a few changes in the codons, which alter the amino acid sequences in our samples. However, the changes do not impact the subcellular localization or overall Nepl15 protein structure as determined by bioinformatics analyses.
","acknowledgements":"We would like to thank the Texas Tech University (TTU) TrUE Scholars Undergraduate Research Program for supporting Chase Drucker with funding for reagents. American Heart Association (AHA) SURE (Supporting Undergraduate Research Experiences) scholars' program coordinated by Dr. Peter Keyel, Associate Professor of Biological Sciences at TTU, for supporting Chase with a Summer Research Internship and a travel award for presenting this work at the Scientific Sessions Conference 2025 organized by AHA. We also thank Dr. Surya Banerjee’s research lab members, Shahira Arzoo and Rubaia Tasmin, for their insights and help during this project.
","authors":[{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","methodology","software","writing_originalDraft"],"email":"cdrucker@ttu.edu","firstName":"Chase ","lastName":"Drucker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-6444-5259"},{"affiliations":["Texas Tech University, Lubbock, Texas, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","investigation","methodology","formalAnalysis","validation","writing_reviewEditing","fundingAcquisition","supervision"],"email":"surya.banerjee@ttu.edu","firstName":"Surya Jyoti","lastName":"Banerjee","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7196-4315 "}],"awards":[{"awardId":"24SURE1331544","funderName":"American Heart Association (United States)","awardRecipient":"Chase Drucker"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":"https://portal.micropublication.org/uploads/5e7c2eef60e68b7fa84638225c613052.csv"},"extendedData":[],"funding":"Financial support for this project was provided by the American Heart Association (24SURE1331544), and Texas Tech University TrUE Scholars. This project is mainly funded by the Texas Tech University faculty start-up funds provided to Dr. Surya Jyoti Banerjee.
","image":{"url":"https://portal.micropublication.org/uploads/5ade7c2f3058debb1c8bb65a565723af.png"},"imageCaption":"A. Multiple protein sequence alignment by ClustalW. FBNep1 (the Drosophila melanogaster typical Neprilysin1 protein sequence from FlyBase), FBNepl15 (FlyBase Nepl15 protein sequence), ORNepl15F or ORNepl15M (newly sequenced Oregon-R Nepl15 protein sequences from Female or Male adult flies). Multiple protein sequence alignment of Nep1 (typical Nep in fruit fly), FlyBase (FB) Nepl15, and Oregon-R Nepl15 protein sequences show FBNepl15 and Oregon-R Nepl15 proteins lack the (684) HEXXH and (746) EXXH catalytic motifs that are present in Neprilysin1 (Nep1). Additionally, 5 amino acids are different in the Oregon-R Nepl15 protein (at 15, 18, 199, 239, and 567 positions) from the FB Nepl15 protein sequence (see Table 2). Colored boxes indicate altered amino acid residues in Oregon-R Nepl15 protein relative to FB Nepl15 protein: (blue) indicating the original residue, (green) designating no change at the amino acid residue even though nucleotide sequence was altered, and (red) representing altered amino acid residues. The numbers underneath each colored residue correspond to the amino acid position on the Nepl15 protein sequence. B. Predicted 3D protein structure of FB Nepl15 protein made by AlphaFold 3. The box plot shows a predicted aligned errors (PAE) plot, mapping the expected positional error (Å) between pairs of residues, generated by AlphaFold 3. 3D model residues and PAE plot are colored and indicated in the provided key, in which lower values (blue) indicate higher levels of confidence. C1, C2, and C3. Overlay of the 3D models of FBNepl15 (blue) and Oregon-R Nepl15 (purple) proteins from three different angles, as generated by AlphaFold 3. Three images display different angles of these two overlapping proteins, without indicating any major change in the Oregon-R Nepl15 protein structure despite the 5 amino acid changes.
","imageTitle":"Alignment of FlyBase Nep1, Nepl15, and Oregon-R Nepl15 protein sequences (A), and predicted 3D structures of FlyBase and Oregon-R Nepl15 proteins (B and C1 to C3). Table 1: List of Neprilysins and the corresponding number of transcripts and unique polypeptides they produce. Table 2: Nucleotide and amino acid sequencing alterations in Oregon-R Nepl15 CDS and protein compared to the corresponding FlyBase data
","methods":"Drosophila melanogaster husbandry
Drosophila melanogaster Oregon-R strain was maintained on Bloomington's fly food formulation (Genesee Scientific Nutri-Fly_66-116) at 25 °C. 5 to 7 days old male and virgin female adult flies were used for RNA extraction.
FlyBase Data:
The FlyBase website, http://flybase.org, was used to retrieve the Nepl15 transcript and CDS sequences. The genome release number is FB2026_01 (March 12, 2026).
RNA isolation and cDNA synthesis
Total RNA was extracted from 5 to 7 days old, 25 male and 25 virgin female Oregon-R adult flies using TRI reagent (Sigma T9424) (Banerjee et al., 2021). The RNA sample purity was validated by measuring 260/280 and 230/280 ratios, and the RNA integrity was tested by gel electrophoresis. The cDNA synthesis was then performed using 5x iScript Reaction Mix (Bio-Rad 1708889) following the manufacturer's protocol.
PCR and Purification
Specific forward (FP) and reverse primer (RP) pairs (Table 3) were designed using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021) to amplify Nepl15 CDS and transcript using the OR male and female cDNA templates separately. The primer sequences were designed based on the FlyBase Nepl15 CDS and Transcript sequences. PCR was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs M0492S) following the manufacturer's protocol. The PCR products were purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel 740609) following the manufacturer's instructions.
Table 3. List of primers used for PCR.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP | ATGGCCTCTCAACCGCTTG |
Nepl15_CDS_RP | TCAGTAGAGAGTGCACTTAAAGCG |
Nepl15_T.SCRPT_FP | CCCGCTCAGTTTCGTTTC |
Nepl15_T.SCRPT_RP | ATGACAAGTGCAACAAATGCTTTT |
DNA Sequencing Analysis
We designed several primers (listed in Table 4) to cover the entire length of the Nepl15 CDS or transcript. Sanger sequencing of the purified PCR samples was performed by Azenta Life Sciences (genewiz.com). The high-quality sequence contigs were aligned to the corresponding FlyBase sequence using Serial Cloner (v2.6.1) (Branco & Choupina, 2021).
Table 4. List of primers used for sequencing.
Primer | Sequence (5' to 3') |
Nepl15_CDS_FP1 | TGAAACGCAAGCTTGGCGTG |
Nepl15_CDS_FP2 | GCTTTGGAAGCGTTGGATAT |
Nepl15_CDS_FP3 | TGGAATACAAGGGTAAGCCG |
Nepl15_CDS_RP1 | TATTCAGGGCGGATCGCGTG |
Nepl15_T.SCRPT_FP1 | GGTTGGCCGGAGATTCGTGT |
Nepl15_T.SCRPT_FP2 | CATGTCAAATCTGGTGGATG |
Nepl15_T.SCRPT_FP3 | TGGGATCACACCTCGGAGAG |
Nepl15_T.SCRPT_RP1 | GGCACTGTTCTCAGCTCCTC |
Protein sequence analysis and other bioinformatics analysis
Changes in the Oregon-R Nepl15 CDS sequences compared to the FlyBase sequence were identified using the Serial Cloner (v2.6.1) (Branco & Choupina, 2021). Variations in the Nepl15 codon sequences between Oregon-R CDS and FlyBase CDS sequences were analyzed using Serial Cloner's built-in BLASTn and BLASTp alignment tools. Next, Clustal Omega (Madeira et al., 2024) was used to align the FlyBase Neprilysin 1 (DmNep1, a typical fly neprilysin, orthologous to human neprilysin), Oregon-R male and female Nepl15, and FlyBase Nepl15 protein sequences to identify changes in Oregon-R Nepl15 protein sequences. The newly sequenced Oregon-R Nepl15 protein sequence was analyzed for any change in its subcellular localization, signal sequence site, and 3D structure compared to those of the FlyBase-reported Nepl15 protein sequence using different bioinformatics tools like DeepLoc2.1 (Ødum et al., 2024), SignalP – 6.0 (Teufel et al., 2022), and DeepTMHMM – 1.0 (Hallgren et al., 2022), respectively.
AlphaFold 3 Protein Prediction
Protein structure predictions for Nepl15 were generated using AlphaFold 3 within the ChimeraX interface. The amino acid sequence of the Oregon-R Nepl15 protein was used as input. Structure prediction was performed in ChimeraX (version 1.11.1) using the following workflow: Tools to Structure Prediction to AlphaFold, after which the protein sequence was entered into the “Sequence” field and submitted for prediction. The “don't minimize” parameter was selected before the sequence in the Google Collab window to prevent minimization during model generation, consistent with previously described protocols. Multiple models were generated, and model confidence was evaluated using predicted aligned error (PAE) metrics. The structure with the highest overall confidence, defined by the lowest PAE values and highest predicted local distance difference test scores, was automatically selected for further visualization and structural alignment analyses (Abramson et al., 2024; Meng et al., 2023).
","reagents":"All reagents' names, with the company names and catalog numbers, are mentioned in the methods.
","patternDescription":"Neprilysins (neutral endopeptidases; Neps) belong to the M13 family of Zinc (II) dependent metallopeptidases and were first discovered in mammals (Turner et al., 2001). Typical mammalian Neps, including human Neprilysin (HsNep) encoded by the MME (Membrane Metalloendopeptidase) gene, have a short cytoplasmic N-terminal domain, a shorter hydrophobic transmembrane domain, and a long extracellular C-terminal domain that houses highly conserved motifs. Two of these motifs, HEXXH and EXXAD, are responsible for Zn (II) binding and the subsequent proteolytic cleavage of substrate peptides, typically occurring at the N-terminal side of a hydrophobic residue with a strong preference for Phe or Leu toward the C-terminus (Nalivaeva & Turner, 2013; Sitnik et al., 2014; Turner et al., 2000).
Typical mammalian Neps are normally expressed in a variety of cell types, including brush border cells of the kidneys, brain, neutrophils, lungs, synapses, along with adipocytes and smooth muscle cells present throughout gut tissue, to name a few. Neprilysin cleaves an array of peptides and controls cellular signals that impact the nervous, cardiovascular, inflammatory, immune systems, and nutrient homeostasis (Schling & Schäfer, 2002; Turner et al., 2001).
Phylogenetic studies have identified the presence of Nep orthologs in invertebrate organisms, including Drosophila melanogaster (Bland et al., 2008; Sitnik et al., 2014). Drosophila melanogaster contains 28 identified neprilysin and neprilysin-like genes (Meyer et al., 2021). Among them, Neprilysin-like 15 (Nepl15), a predicted secreted, catalytically inactive Nep, regulates glycogen and lipid storage in a sex-dependent manner. Previous work with Nepl15ko (knock-out) flies revealed that glycogen and triacylglyceride storage were significantly reduced in adult male mutant flies, while significantly more glycogen storage was observed in adult female mutants, albeit the mutants consume the same amount of food as the controls (Banerjee et al., 2021). Interestingly, a previous study (Banerjee et al., 2021) and transcriptomics data from FlyAtlas2 (Leader et al., 2018) showed that the Nepl15 transcript is differentially expressed in both larval and adult fly organs, with higher expression in larval fat body and adult head, heart, and fat body. Overall, FlyAtlas shows that the whole adult male body expresses 4.2 times more Nepl15 than the whole adult female body. Additionally, overexpression of Nepl15 in the fat body increased triglyceride levels only, whereas its overexpression in the gut increased glycogen levels only in adult male flies, suggesting Nepl15 has tissue-specific variable effects (Banerjee et al., 2021). Interestingly, the fly database (FlyBase.org) reports that the Nepl15 gene in D. melanogaster ISO1 MT (dm6) (y1; cn1 bw1 sp1) strain has no intron and produces only one transcript. However, 10 other fly Neprilysin and Neprilysin-like genes encode more than one transcript (Table 1) (FlyBase.org).
Therefore, we asked the following questions: Are there any unreported Nepl15 transcript variants present in wild-type (Oregon-R) adult male and female flies that produce different Nepl15 protein isoforms in the two sexes? Are there any differences in the 5′ and 3′ untranslated regions (UTRs) in the Nepl15 transcript which may contribute to its post-transcriptional regulation? To answer these questions, we isolated total RNA from the whole-body of adult male and virgin female Oregon-R flies (FBsn0000276) and synthesized cDNA. Next, we took PCR based approach to amplify the Nepl15 CDS (coding sequence, 2061 bps) and its transcript (2213 bps including the 5′ and 3′ UTRs), followed by sequencing them and aligning the sequences with the corresponding sequences in FlyBase.
We did not find any nucleotide sequence difference at the 5′ and 3′ UTRs of the Oregon-R and FlyBase Nepl15 transcript sequences. However, sequencing results show that the Oregon-R Nepl15 CDS from male and female flies contains the exact 7-nucleotide sequence changes compared to the FlyBase sequence. These changes translate into only 5 amino acid changes, among which 3 changes include amino acids with different properties (Table 2) (Figure 1A). The Oregon-R adult male and female Nepl15 (ORNepl15M and ORNepl15F) protein sequences were aligned with the FlyBase Neprilysin1 (FBNep1) and Nepl15 (FBNepl15) protein sequences using ClustalW to show the changed 5 amino acid residues (Table 2) (Figure 1A). Further bioinformatics analysis of the Oregon-R Nepl15 protein reveals that the amino acid changes did not impact the Nepl15 predicted cleavage site (between amino acids 22 and 23) (SignalIP and DeepTMHMM) (Hallgren et al., 2022; Teufel et al., 2022), and extracellular localization (DeepLoc) (Ødum et al., 2024). Additional analysis of 3D models of the FlyBase Nepl15 (Figure 1B, blue ribbon diagram) and Oregon-R Nepl15 proteins utilizing AlphaFold 3 (Abramson et al., 2024) shows no significant change in their structures in their overlays (blue and purple ribbons depict the Nepl15 3D protein models in FlyBase strain and Oregon-R, respectively) (Figures 1 C1 – C3).
Collectively, these results reveal that a slightly different amino acid sequence in the Nepl15 protein is present in our lab-grown wild-type Oregon-R flies as compared to the FlyBase Nepl15 protein, indicative of a strain-specific amino acid sequence variation in the same protein. Bioinformatic analyses do not indicate any major structural or functional shifts in the Oregon-R Nepl15 protein due to these changes. Thus, our study confirms the presence of only one Nepl15 transcript version in D. melanogaster Oregon-R adult male and female flies. Although, the changes in the nucleotide sequences within the Oregon-R Nepl15 codons and corresponding amino acid changes in the Nepl15 protein may not impact the protein's localization, structure, and function, still our research outcome can contribute to future investigations in two significant ways: (i) this report will help to perform primer design, PCR, qPCR, gene cloning, guide DNA design for CRISPR, and site specific mutation accurately for Nepl15 gene in Oregon-R fly strain; and (ii) if researchers use a Drosophila species or strain other than the one used in a database or previously published work, our result recommends that it is important to verify the DNA sequence before designing the components of molecular biology based experiments.
","references":[{"reference":"Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al., Jumper JM. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 630: 493-500. 1503.","pubmedId":"38718835","doi":"10.1038/s41586-024-07487-w"},{"reference":"Banerjee S, Woods C, Burnett M, Park SJ, Ja WW, Curtiss J. 2021. The Drosophila melanogaster Neprilysin Nepl15 is involved in lipid and carbohydrate storage. Sci Rep. 11: 2099. 1497.","pubmedId":"33483521","doi":"10.1038/s41598-021-81165-z"},{"reference":"Bland ND, Pinney JW, Thomas JE, Turner AJ, Isaac RE. 2008. Bioinformatic analysis of the neprilysin (M13) family of peptidases reveals complex evolutionary and functional relationships. BMC Evol Biol. 8: 16. 1494.","pubmedId":"18215274","doi":"10.1186/1471-2148-8-16"},{"reference":"Branco I, Choupina A. 2021. Bioinformatics: new tools and applications in life science and personalized medicine. Appl Microbiol Biotechnol. 105: 937-951. 1011.","pubmedId":"33404829","doi":"10.1007/s00253-020-11056-2"},{"reference":"FB2026_01, http://flybase.org (released 12th March, 2026).
","pubmedId":"","doi":""},{"reference":"Hallgren J, Tsirigos KD, Pedersen MD, Almagro Armenteros JJ, Marcatili P, Nielsen H, Krogh A, Winther O. 2022. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. biorxiv: 2022.04. 08.487609. 1512.","pubmedId":"","doi":""},{"reference":"Leader DP, Krause SA, Pandit A, Davies SA, Dow JAT. 2018. FlyAtlas 2: a new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46: D809-D815. 1498.","pubmedId":"29069479","doi":"10.1093/nar/gkx976"},{"reference":"Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. 2024. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 52: W521-W525. 1507.","pubmedId":"38597606","doi":"10.1093/nar/gkae241"},{"reference":"Meng EC, Goddard TD, Pettersen EF, Couch GS, Pearson ZJ, Morris JH, Ferrin TE. 2023.
Identification of Drosophila melanogaster Strain-Specific Sequence Variations in the Nepl15 Transcript of Oregon-R relative to FlyBase Data
","reviews":[],"curatorReviews":[{"curator":{"displayName":"FlyBase Curators"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"82c623ac-fa5a-4d57-a19e-877f92909edd","citedBy":[],"parsedCsv":{"csvHeader":[{"accessor":"Table 1. Symbol","Header":"Table 1. Symbol"},{"accessor":"Name","Header":"Name"},{"accessor":"Number of Transcripts","Header":"Number of Transcripts"},{"accessor":"Number of Polypeptides","Header":"Number of Polypeptides"}],"csvData":[{"Table 1. Symbol":"Nep1","Name":"Neprilysin 1","Number of Transcripts":"4","Number of Polypeptides":"4"},{"Table 1. Symbol":"Nep2","Name":"Neprilysin 2","Number of Transcripts":"3","Number of Polypeptides":"3"},{"Table 1. Symbol":"Nep3","Name":"Neprilysin 3","Number of Transcripts":"3","Number of Polypeptides":"3"},{"Table 1. Symbol":"Nep4","Name":"Neprilysin 4","Number of Transcripts":"3","Number of Polypeptides":"3"},{"Table 1. Symbol":"Nep5","Name":"Neprilysin 5","Number of Transcripts":"4","Number of Polypeptides":"4"},{"Table 1. Symbol":"Nep6","Name":"Neprilysin 6","Number of Transcripts":"2","Number of Polypeptides":"2"},{"Table 1. Symbol":"Nep7","Name":"Neprilysin 7","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"frma","Name":"fra mauro","Number of Transcripts":"2","Number of Polypeptides":"2"},{"Table 1. Symbol":"goe","Name":"gone early","Number of Transcripts":"3","Number of Polypeptides":"3"},{"Table 1. Symbol":"Nepl3","Name":"Neprilysin-like 3","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl4","Name":"Neprilysin-like 4","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl5","Name":"Neprilysin-like 5","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl6","Name":"Neprilysin-like 6","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl7","Name":"Neprilysin-like 7","Number of Transcripts":"2","Number of Polypeptides":"2"},{"Table 1. Symbol":"Nepl8","Name":"Neprilysin-like 8","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl9","Name":"Neprilysin-like 9","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl10","Name":"Neprilysin-like 10","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl11","Name":"Neprilysin-like 11","Number of Transcripts":"2","Number of Polypeptides":"2"},{"Table 1. Symbol":"Nepl12","Name":"Neprilysin-like 12","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl13","Name":"Neprilysin-like 13","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl14","Name":"Neprilysin-like 14","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl15","Name":"Neprilysin-like 15","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl16","Name":"Neprilysin-like 16","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl17","Name":"Neprilysin-like 17","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl18","Name":"Neprilysin-like 18","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl19","Name":"Neprilysin-like 19","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl20","Name":"Neprilysin-like 20","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"Nepl21","Name":"Neprilysin-like 21","Number of Transcripts":"1","Number of Polypeptides":"1"},{"Table 1. Symbol":"","Name":"","Number of Transcripts":"","Number of Polypeptides":""},{"Table 1. Symbol":"Table 2. Genomic Position","Name":"Nucleotide Change","Number of Transcripts":"Amino Acid Variant","Number of Polypeptides":"Character Alterations"},{"Table 1. Symbol":"3R:22766060","Name":"T to C","Number of Transcripts":"F15L","Number of Polypeptides":"None"},{"Table 1. Symbol":"3R:22766049","Name":"C to G","Number of Transcripts":"C18W","Number of Polypeptides":"polar - hydrophobic; aromatic"},{"Table 1. Symbol":"3R:22765507","Name":"A to T","Number of Transcripts":"Q199L","Number of Polypeptides":"negatively charged - hydrophobic"},{"Table 1. Symbol":"3R:22765387","Name":"G to C","Number of Transcripts":"R239T","Number of Polypeptides":"Positively charged - polar"},{"Table 1. Symbol":"3R:22764404","Name":"G to T","Number of Transcripts":"V567L","Number of Polypeptides":"None"}]}}}, "staticQueryHashes": ["2114697108"]}