The nuclear envelope maintains nucleocytoplasmic compartmentalization. Divergent strategies exist to accommodate the nuclear envelope during mitotic chromatin segregation. While the endosomal sorting complexes required for transport (ESCRT) machinery drives nuclear envelope remodeling during this process, recent work in Schizosaccharomyces japonicus suggests an ESCRT-independent pathway promoting nucleocytoplasmic compartmentalization mediated by Alx1. We investigate if this ESCRT-independent pathway is conserved in Schizosaccharomyces pombe. We find Alx1-GFP is recruited to a mitotic nuclear envelope hole in S. pombe, but that recruitment depends on the ESCRT machinery. Our data suggest diverse strategies of mitotic nuclear envelope remodeling necessitate varying strategies of promoting nucleocytoplasmic compartmentalization.
","acknowledgements":"The authors thank Ivan Surovtsev and William Chadwick for assistance with the Find_n_Fits_Spots script.
","authors":[{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","fundingAcquisition","investigation","writing_originalDraft"],"email":"K_PENA@uncg.edu","firstName":"Kaela D.","lastName":"Genereux","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0001-9398-7902"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"ONWALKER@uncg.edu","firstName":"Olivia N.","lastName":"Walker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0002-6328-9860"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"SOBENDERS@uncg.edu","firstName":"Sage O.","lastName":"Benders","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-2948-6581"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","software"],"email":"let@hpcacougars.org","firstName":"Thanh Truc","lastName":"Le","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-3923-8437"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["conceptualization","dataCuration","formalAnalysis","fundingAcquisition","investigation","methodology","project","resources","supervision","validation","writing_originalDraft","writing_reviewEditing"],"email":"nrader@uncg.edu","firstName":"Nicholas R.","lastName":"Ader","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7744-4484"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by UNC Greensboro through startup funds to N.R.A., a Munroe Grant to K.G. as well as an Undergraduate Research, Scholarship, and Creativity Award from the Undergraduate Research, Scholarship and Creativity Office to O.W. UNC Greensboro Department of Biology provided support through an Undergraduate Research Award to S.O.B. The Draelos Foundation provided support for T.T.L. and N.R.A.
","image":{"url":"https://portal.micropublication.org/uploads/0db77794799b989a2aa98f24623e0f0c.png"},"imageCaption":"A: Live-cell fluorescence micrographs of Alx1-GFP in S. pombe representative of cell populations at different stages of the cell cycle. For each subpanel: left, images of Alx1-GFP; middle, sum projection of mCherry-Atb2 (mitotic spindle) and Pcp1-mCherry (SPB); right, magnified views of region of interest (merge at the bottom). Top row shows wild type (WT) cells, and bottom row shows cmp7∆ cells. Scale bars, 1 µm (main images) and 500 nm (regions of interest).
B: Percentage of nuclei with Alx1-GFP co-localized with the SPB at the indicated phases of the cell cycle. Data for WT (gray) and cmp7Δ (teal) cells are shown. Points and error bars are the mean and range, respectively, from at least three biological replicates; ≥50 nuclei per replicate. Strains used in A and B are listed in Supplementary Table 1: Alx1-GFP (NASP617; n = 268 nuclei); Alx1-GFP, cmp7∆ (NASP616; n = 423 nuclei).
C: Copy number of Alx1-GFP as a function of time in anaphase B. Black line represents a simple linear regression with the coefficient of determination (r2) indicated. Data from three biological replicates are shown, represented by different point shapes (triangle, circle, square) with at least 14 cells per biological replicate.. Strains used are listed in Supplementary Table 1: Alx1-GFP (NASP617; n = 106); Fta3-GFP (NASP56).
D: A model of Alx1 recruitment to the nuclear envelope in S. pombe, indicating dependence on Cmp7. Nucleoplasm, blue; cytoplasm, beige; spindle pole body (SPB), dark magenta; mitotic spindle, light magenta.
","imageTitle":"Alx1 is recruited to a mitotic nuclear envelope hole in a Cmp7-dependent manner
","methods":"S. pombe culture and strain construction. S. pombe strains were cultured as standard (Moreno et al., 1991), with all experiments performed in either agar plates or liquid culture of yeast extract supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (YE5S). The pFA6a-MX6-based drug-resistance cassettes were used for carboxy (C)-terminal tagging (Bähler et al., 1998; Hentges et al., 2005). A plasmid Editor (ApE) 2.0.61 was used for visualization and virtual manipulation of DNA sequences (Davis and Jorgensen, 2022), with S. pombe genome information accessed through PomBase (Rutherford et al., 2024; Wood et al., 2002). PCR of whole yeast (colony PCR) (Huxley et al., 1990) was used to confirm genomic integration following lithium acetate transformation (Murray et al., 2016). Monomeric enhanced GFP (mEGFP) used for strain creation throughoutwith a 3×HA linker; abbreviated as GFP in Figure and Description.
Live-cell fluorescence microscopy. Cells expressing fluorescently tagged proteins were cultured to logarithmic phase (OD600 0.4–0.8), concentrated by brief centrifugation, and mounted on 1.4% agarose in Edinburgh minimal medium supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (EMM5S) pad sandwiched with a no. 1.5 glass coverslip, a glass slide, and then sealed with VALAP (1:1:1, vaseline:lanonin:paraffin) for imaging. Live-cell fluorescence microscopy was performed using a Nikon microscope imaging system with an incubated stage (Oko Lab) set to 32˚C. An LED light source (Nikon, D-LEDI) was used for illumination. For GFP: 475 nm excitation with a FITC filter cube (excitation 465–495 nm, emission 515–555 nm, long pass 505 nm). For mCherry: 550 nm excitation with an mCherry filter set (excitation 540–580, emission 593–667 nm, long pass 585 nm). Channels were acquired sequentially on an ORCA-Fusion BT Digital CMOS camera (Hamamatsu C15440-20UP) using a Plan Apo Lambda D 100× oil objective with a numerical aperture of 1.45. Z-stacks spanning the nuclear envelope region (~3.5–4.8 µm) were acquired every 200 nm to visualize Alx1-GFP localization at the mitotic nuclear envelope. Widefield images were deconvolved in NIS-Elements using a Richardson-Lucy method. Cells were classified into phases as previously published using mCherry-Atb2 (Ader et al., 2023). All Alx1-GFP images are shown at equivalent display range, set to maximize display range for Alx1-GFP image shown in WT anaphase B (Fig. 1A). For images in the mCherry channel (mCherry-Atb2 and Pcp1-mCherry), the gamma has been adjusted to 0.05 to allow both fluorophores to be displayed without pixel saturation. mCherry images were manually adjusted to to maximize display range for each image. Figures were designed and prepared using Prism, Adobe Illustrator 2026, and Fiji.
Quantification of the average copy number of Alx1 subunits. Cells were prepared for imaging by overnight culture as described in live-cell fluorescence microscopy. Cells (NASP56) expressing Fta3-GFP were mounted on the same pad as Alx1-GFP cells and imaged as above. Raw images were analyzed using a custom MATLAB script, ‘Find_n_Fit_Spots’ (https://github.com/LusKingLab/Find_n_Fit_Spots_3D) as previously described (Ader et al., 2023).
","reagents":"Supplementary Table 1. List of S. pombe strains used in this study. | ||
|---|---|---|
Strain (NASP) | Genotype | Origin |
56 | fta3::fta3-mEGFP:kanMX6 | leu1-32 | ura4-D18 | ade6-M210 | h+ | Ader et al., 2023 |
616 | alx1::alx1-3xHA-mEGFP:kanMX6 | cmp7::hygMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
617 | alx1::alx1-3xHA-mEGFP:kanMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
Supplementary Table 2. List of primers used in this study for Alx1 C-term Tag Cassette Construction | |
|---|---|
Primer Name | Sequence |
prNA253_alx1_L3 | GCTTTAGAGAAGCTGTTGATGCCAAG |
prNA254_alx1_L4 | ttaattaacccggggatccgTTTTTTTGACGATTTAAACTTGATTTTATGGATTTCAGG |
prNA255_alx1_L5 | gtttaaacgagctcgaattcGATTATCATATGTGATCATATAGTATTAAATCCGCATACA |
prNA256_alx1_L6 | AAATGCTTCAACGGTGTGGATGG |
Supplementary Table 3. Plasmids used in this study. | |||
|---|---|---|---|
Identifier | Name/Description | Usage | Origin |
pNA8 | pNA8_pFA6a-3xHA-mEGFP-KanMX6 | Template for PCR based chromosomal integration of 3×HA-mEGFP ORF | Ader et al., 2023 |
The nuclear envelope is critical for maintenance of nucleocytoplasmic compartmentalization. However, nuclear division in many species necessitates a transient disruption of the nuclear envelope to accommodate chromatin segregation by cytoplasmic machinery. At the resolution of nuclear division, holes in the reforming nuclear envelope are sealed by the endosomal sorting complexes required for transport (ESCRT) machinery (Gu et al., 2017; Olmos et al., 2015; Vietri et al., 2015).
The ESCRT machinery remodels membranes across the cell through a group of filament-forming subunits, ESCRT-IIIs, which are canonically targeted to specific membranes by the ESCRT-I/II family of proteins (Burigotto and Carlton, 2025). However, non-canonical recruitment of ESCRT-IIIs by alternative, membrane-specific proteins is also possible. For example, at the nuclear envelope, the unique ESCRT-II/III hybrid protein, Cmp7, recruits ESCRT-III proteins to facilitate nuclear envelope sealing independent of ESCRT-I/IIs via binding to the integral inner nuclear membrane protein Heh1/LEM2 (Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; von Appen et al., 2020; Webster et al., 2016).
Alx1 localizes to a mitotic nuclear envelope hole. Recently, the ESCRT-associated protein, Alx1, has been suggested to play an ESCRT-independent role in the mitotic nuclear envelope sealing of Schizosaccharomyces japonicus (Lee et al., 2020; Sydir et al., 2026). To determine if the presence of an ESCRT-independent nuclear envelope remodeling pathway was conserved across species, we sought to investigate Alx1 involvement in nuclear envelope remodeling in the related fission yeast, Schizosaccharomyces pombe. Notably, while closely related to S. japonicus, S. pombe employ more conservative nuclear envelope remodeling during mitosis, simply transiently inserting their microtubule organizing center, the spindle pole body (SPB), into their nuclear envelope to nucleate a mitotic spindle (Ding et al., 1997). Unlike S. japonicus, S. pombe maintain nucleocytoplasmic compartmentation during mitosis (Arai et al., 2010; Asakawa et al., 2010).
To investigate a potential ESCRT-independent role of Alx1 in mitotic nuclear envelope remodeling in S. pombe, we performed live-cell fluorescence microscopy of cells endogenously expressing Alx1-GFP. Unlike core ESCRT-III proteins (Vps32, Ist1, Did4, Vps24) previously observed by live-cell fluorescence microscopy (Ader et al., 2023), we observed no Alx1-GFP puncta in interphase cells, suggesting that Alx1 is not involved in the formation of intraendosomal vesicles (Fig. 1A). Conversely, when we examined mitotic cells, we observed robust Alx1-GFP recruitment to the site of a mitotic nuclear envelope hole, visualized as co-localization of Alx1-GFP and a SPB protein (Pcp1-mCherry) (Fig. 1A, B). Notably, we did not observe recruitment of Alx1-GFP to a mitotic “tail” of the nuclear envelope as in S. japonicus (Lee et al., 2020). Thus, while Alx1 appears to perform a mitotic role at a nuclear envelope hole in S. pombe, as in S. japonicus, this function appears to be restricted to the mitotic nuclear envelope hole created by the SPB.
Copy number of Alx1 remains constant during anaphase B. While the molecular architecture of in vivo ESCRT assembly remains enigmatic, previous work has sought to determine an absolute number of ESCRT subunits and their stoichiometry at sites of both intraendosomal vesicle formation (Adell et al., 2017) and nuclear envelope constriction/sealing (Ader et al., 2023). Hence, we calculated the absolute number of Alx1-GFP molecules at a nuclear envelope hole throughout mitosis using the kinetochore protein Fta3 as a molecular standard (Ader et al., 2023; Lawrimore et al., 2011). We determined this nuclear envelope hole contains an average of 83 ± 11 molecules of Alx1-GFP and that this level remains relatively constant over the course of anaphase B (Fig. 1C). When considered in the context of the previously published copy number of other ESCRT molecules at a mitotic nuclear envelope hole, this suggests that Alx1 may play a role akin to the more abundant Vps32 (72 molecules) and Vps24 (77 molecules) ESCRT proteins, rather than the lower abundant Cmp7 (15 molecules), Ist1 (25–34 molecules) and Did4 (25 molecules) (Ader et al., 2023).
Alx1 recruitment to a mitotic nuclear envelope hole requires Cmp7. We next sought to determine if the presence of Alx1 at a mitotic nuclear envelope hole was consistent with an ESCRT-independent pathway. As all previously observed ESCRT-III recruitment to the nuclear envelope depends on Cmp7 (Ader et al., 2023; Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; Vietri et al., 2015), recruitment of Alx1-GFP to a mitotic nuclear envelope hole in cells lacking CMP7 would suggest an ESCRT-independent role for Alx1. However, we observed that Alx1-GFP recruitment to a mitotic nuclear envelope hole was completely abolished in cmp7∆ cells (Fig. 1A, B). This suggests that in S. pombe, unlike S. japonicus, the contribution of Alx1 to membrane remodeling of a mitotic nuclear envelope hole is ESCRT-dependent (Fig. 1D).
Taken together, our data suggest that even closely related organisms may employ significantly different strategies for nuclear division. While it is tempting to speculate that the presence of an ESCRT-independent pathway for post-mitotic nuclear envelope sealing in S. japonicus may be a consequence of this yeast’s more “open” mitosis compared to S. pombe, further work across more diverse species is needed.
","references":[{"reference":"Adell MAY, Migliano SM, Upadhyayula S, Bykov YS, Sprenger S, Pakdel M, et al., Teis. 2017. Recruitment dynamics of ESCRT-III and Vps4 to endosomes and implications for reverse membrane budding. eLife 6: 10.7554/elife.31652.
","pubmedId":"","doi":"10.7554/eLife.31652"},{"reference":"Ader NR, Chen L, Surovtsev IV, Chadwick WL, Rodriguez EC, King MC, Lusk CP. 2023. An ESCRT grommet cooperates with a diffusion barrier to maintain nuclear integrity. Nature Cell Biology 25: 1465-1477.
","pubmedId":"","doi":"10.1038/s41556-023-01235-4"},{"reference":"Arai K, Sato M, Tanaka K, Yamamoto M. 2010. Nuclear Compartmentalization Is Abolished during Fission Yeast Meiosis. Current Biology 20: 1913-1918.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.004"},{"reference":"Asakawa H, Kojidani T, Mori C, Osakada H, Sato M, Ding DQ, Hiraoka Y, Haraguchi T. 2010. Virtual Breakdown of the Nuclear Envelope in Fission Yeast Meiosis. Current Biology 20: 1919-1925.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.070"},{"reference":"Bähler Jr, Wu JQ, Longtine MS, Shah NG, Mckenzie III A, Steever AB, et al., Pringle. 1998. Heterologous modules for efficient and versatile PCR-based gene targeting inSchizosaccharomyces pombe. Yeast 14: 943-951.
","pubmedId":"","doi":"10.1002/(sici)1097-0061(199807)14:10<943::Aid-yea292>3.0.Co;2-y"},{"reference":"Burigotto M, Carlton JG. 2025. ESCRT-III function in membrane fission and repair. Nature Reviews Molecular Cell Biology 27: 297-315.
","pubmedId":"","doi":"10.1038/s41580-025-00909-1"},{"reference":"Davis MW, Jorgensen EM. 2022. ApE, A Plasmid Editor: A Freely Available DNA Manipulation and Visualization Program. Frontiers in Bioinformatics 2: 10.3389/fbinf.2022.818619.
","pubmedId":"","doi":"10.3389/fbinf.2022.818619"},{"reference":"Ding R, West RR, Morphew DM, Oakley BR, McIntosh JR. 1997. The spindle pole body of Schizosaccharomyces pombe enters and leaves the nuclear envelope as the cell cycle proceeds. Molecular Biology of the Cell 8: 1461-1479.
","pubmedId":"","doi":"10.1091/mbc.8.8.1461"},{"reference":"Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, et al., Frost. 2017. LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Proceedings of the National Academy of Sciences 114: 10.1073/pnas.1613916114.
","pubmedId":"","doi":"10.1073/pnas.1613916114"},{"reference":"Hentges P, Van Driessche B, Tafforeau L, Vandenhaute J, Carr AM. 2005. Three novel antibiotic marker cassettes for gene disruption and marker switching inSchizosaccharomyces pombe. Yeast 22: 1013-1019.
","pubmedId":"","doi":"10.1002/yea.1291"},{"reference":"Huxley C, Green ED, Dunbam I. 1990. Rapid assessment of S. cerevisiae mating type by PCR. Trends in Genetics 6: 236.
","pubmedId":"","doi":"10.1016/0168-9525(90)90190-h"},{"reference":"Lawrimore J, Bloom KS, Salmon ED. 2011. Point centromeres contain more than a single centromere-specific Cse4 (CENP-A) nucleosome. Journal of Cell Biology 195: 573-582.
","pubmedId":"","doi":"10.1083/jcb.201106036"},{"reference":"Lee IJ, Stokasimov E, Dempsey N, Varberg JM, Jacob E, Jaspersen SL, Pellman D. 2020. Factors promoting nuclear envelope assembly independent of the canonical ESCRT pathway. Journal of Cell Biology 219: 10.1083/jcb.201908232.
","pubmedId":"","doi":"10.1083/jcb.201908232"},{"reference":"Moreno S, Klar A, Nurse P. 1991. [56] Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods in Enzymology,Guide to Yeast Genetics and Molecular Biology : 795-823.
","pubmedId":"","doi":"10.1016/0076-6879(91)94059-l"},{"reference":"Murray JM, Watson AT, Carr AM. 2016. Transformation of Schizosaccharomyces pombe: Lithium Acetate/ Dimethyl Sulfoxide Procedure. Cold Spring Harbor Protocols 2016: pdb.prot090969.
","pubmedId":"","doi":"10.1101/pdb.prot090969"},{"reference":"Olmos Y, Hodgson L, Mantell J, Verkade P, Carlton JG. 2015. ESCRT-III controls nuclear envelope reformation. Nature 522: 236-239.
","pubmedId":"","doi":"10.1038/nature14503"},{"reference":"Olmos Y, Perdrix-Rosell A, Carlton JG. 2016. Membrane Binding by CHMP7 Coordinates ESCRT-III-Dependent Nuclear Envelope Reformation. Current Biology 26: 2635-2641.
","pubmedId":"","doi":"10.1016/j.cub.2016.07.039"},{"reference":"Rutherford KM, Lera-Ramírez M, Wood V. 2024. PomBase: a Global Core Biodata Resource—growth, collaboration, and sustainability. GENETICS 227: 10.1093/genetics/iyae007.
","pubmedId":"","doi":"10.1093/genetics/iyae007"},{"reference":"Sydir EM, Farra MH, Whitford AL, Hinojosa S, Kao PY, Paulo JA, et al., Pellman. 2026. Components of an ESCRT-independent nuclear envelope assembly pathway. : 10.64898/2026.02.01.703137.
","pubmedId":"","doi":"10.64898/2026.02.01.703137"},{"reference":"Thaller DJ, Allegretti M, Borah S, Ronchi P, Beck M, Lusk CP. 2019. An ESCRT-LEM protein surveillance system is poised to directly monitor the nuclear envelope and nuclear transport system. eLife 8: 10.7554/elife.45284.
","pubmedId":"","doi":"10.7554/eLife.45284"},{"reference":"Vietri M, Schink KO, Campsteijn C, Wegner CS, Schultz SW, Christ L, et al., Stenmark. 2015. Spastin and ESCRT-III coordinate mitotic spindle disassembly and nuclear envelope sealing. Nature 522: 231-235.
","pubmedId":"","doi":"10.1038/nature14408"},{"reference":"von Appen A, LaJoie D, Johnson IE, Trnka MJ, Pick SM, Burlingame AL, Ullman KS, Frost A. 2020. LEM2 phase separation promotes ESCRT-mediated nuclear envelope reformation. Nature 582: 115-118.
","pubmedId":"","doi":"10.1038/s41586-020-2232-x"},{"reference":"Webster BM, Thaller DJ, Jäger J, Ochmann SE, Borah S, Lusk CP. 2016. Chm7 and Heh1 collaborate to link nuclear pore complex quality control with nuclear envelope sealing. The EMBO Journal 35: 2447-2467.
","pubmedId":"","doi":"10.15252/embj.201694574"},{"reference":"Wood V, Gwilliam R, Rajandream MA, Lyne M, Lyne R, Stewart A, et al., Nurse. 2002. The genome sequence of Schizosaccharomyces pombe. Nature 415: 871-880.
","pubmedId":"","doi":"10.1038/nature724"}],"title":"Cmp7-dependent recruitment of Alx1 to a mitotic nuclear envelope hole in Schizosaccharomyces pombe
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Pascal Curator Carme"},"openAcknowledgement":false,"submitted":null}]},{"id":"a3c85c0f-0a22-4046-a2b6-26cebbe0d385","decision":"revise","abstract":"The nuclear envelope maintains nucleocytoplasmic compartmentalization. Divergent strategies exist to accommodate the nuclear envelope during mitotic chromatin segregation. While the endosomal sorting complexes required for transport (ESCRT) machinery drives nuclear envelope remodeling during this process, recent work in Schizosaccharomyces japonicus suggests an ESCRT-independent pathway promoting nucleocytoplasmic compartmentalization mediated by Alx1. We investigate if this ESCRT-independent pathway is conserved in Schizosaccharomyces pombe. We find Alx1-GFP is recruited to a mitotic nuclear envelope hole in S. pombe, but that recruitment depends on the ESCRT machinery. Our data suggest diverse strategies of mitotic nuclear envelope remodeling necessitate varying strategies of promoting nucleocytoplasmic compartmentalization.
","acknowledgements":"The authors thank Ivan Surovtsev and William Chadwick for assistance with the Find_n_Fits_Spots script.
","authors":[{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","fundingAcquisition","investigation","writing_originalDraft"],"email":"K_PENA@uncg.edu","firstName":"Kaela D.","lastName":"Genereux","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0001-9398-7902"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"ONWALKER@uncg.edu","firstName":"Olivia N.","lastName":"Walker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0002-6328-9860"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"SOBENDERS@uncg.edu","firstName":"Sage O.","lastName":"Benders","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-2948-6581"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","software"],"email":"let@hpcacougars.org","firstName":"Thanh Truc","lastName":"Le","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-3923-8437"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["conceptualization","dataCuration","formalAnalysis","fundingAcquisition","investigation","methodology","project","resources","supervision","validation","writing_originalDraft","writing_reviewEditing"],"email":"nrader@uncg.edu","firstName":"Nicholas R.","lastName":"Ader","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7744-4484"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by UNC Greensboro through startup funds to N.R.A., a Munroe Grant to K.G. as well as an Undergraduate Research, Scholarship, and Creativity Award from the Undergraduate Research, Scholarship and Creativity Office to O.W. UNC Greensboro Department of Biology provided support through an Undergraduate Research Award to S.O.B. The Draelos Foundation provided support for T.T.L. and N.R.A.
","image":{"url":"https://portal.micropublication.org/uploads/0db77794799b989a2aa98f24623e0f0c.png"},"imageCaption":"A: Live-cell fluorescence micrographs of Alx1-GFP in S. pombe representative of cell populations at different stages of the cell cycle. For each subpanel: left, images of Alx1-GFP; middle, sum projection of mCherry-Atb2 (mitotic spindle) and Pcp1-mCherry (SPB); right, magnified views of region of interest (merge at the bottom). Top row shows wild type (WT) cells, and bottom row shows cmp7∆ cells. Scale bars, 1 µm (main images) and 500 nm (regions of interest).
B: Percentage of nuclei with Alx1-GFP co-localized with the SPB at the indicated phases of the cell cycle. Data for WT (gray) and cmp7Δ (teal) cells are shown. Points and error bars are the mean and range, respectively, from at least three biological replicates; ≥50 nuclei per replicate. Strains used in A and B are listed in Table 1: Alx1-GFP (NASP617; n = 268 nuclei); Alx1-GFP, cmp7∆ (NASP616; n = 423 nuclei).
C: Copy number of Alx1-GFP as a function of time in anaphase B. Black line represents a simple linear regression with the coefficient of determination (r2) indicated. Data from three biological replicates are shown, represented by different point shapes (triangle, circle, square) with at least 14 cells per biological replicate.. Strains used are listed in Table 1: Alx1-GFP (NASP617; n = 106); Fta3-GFP (NASP56).
D: A model of Alx1 recruitment to the nuclear envelope in S. pombe, indicating dependence on Cmp7. Nucleoplasm, blue; cytoplasm, beige; spindle pole body (SPB), dark magenta; mitotic spindle, light magenta.
","imageTitle":"Alx1 is recruited to a mitotic nuclear envelope hole in a Cmp7-dependent manner
","methods":"S. pombe culture and strain construction. S. pombe strains were cultured as standard (Moreno et al., 1991), with all experiments performed in either agar plates or liquid culture of yeast extract supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (YE5S). The pFA6a-MX6-based drug-resistance cassettes were used for carboxy (C)-terminal tagging (Bähler et al., 1998; Hentges et al., 2005). A plasmid Editor (ApE) 2.0.61 was used for visualization and virtual manipulation of DNA sequences (Davis and Jorgensen, 2022), with S. pombe genome information accessed through PomBase (Rutherford et al., 2024; Wood et al., 2002). PCR of whole yeast (colony PCR) (Huxley et al., 1990) was used to confirm genomic integration following lithium acetate transformation (Murray et al., 2016). Monomeric enhanced GFP (mEGFP) used for strain creation throughoutwith a 3×HA linker; abbreviated as GFP in Figure and Description.
Live-cell fluorescence microscopy. Cells expressing fluorescently tagged proteins were cultured to logarithmic phase (OD600 0.4–0.8), concentrated by brief centrifugation, and mounted on 1.4% agarose in Edinburgh minimal medium supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (EMM5S) pad sandwiched with a no. 1.5 glass coverslip, a glass slide, and then sealed with VALAP (1:1:1, vaseline:lanonin:paraffin) for imaging. Live-cell fluorescence microscopy was performed using a Nikon microscope imaging system with an incubated stage (Oko Lab) set to 32˚C. An LED light source (Nikon, D-LEDI) was used for illumination. For GFP: 475 nm excitation with a FITC filter cube (excitation 465–495 nm, emission 515–555 nm, long pass 505 nm). For mCherry: 550 nm excitation with an mCherry filter set (excitation 540–580, emission 593–667 nm, long pass 585 nm). Channels were acquired sequentially on an ORCA-Fusion BT Digital CMOS camera (Hamamatsu C15440-20UP) using a Plan Apo Lambda D 100× oil objective with a numerical aperture of 1.45. Z-stacks spanning the nuclear envelope region (~3.5–4.8 µm) were acquired every 200 nm to visualize Alx1-GFP localization at the mitotic nuclear envelope. Widefield images were deconvolved in NIS-Elements using a Richardson-Lucy method. Cells were classified into phases as previously published using mCherry-Atb2 (Ader et al., 2023). All Alx1-GFP images are shown at equivalent display range, set to maximize display range for Alx1-GFP image shown in WT anaphase B (Fig. 1A). For images in the mCherry channel (mCherry-Atb2 and Pcp1-mCherry), the gamma has been adjusted to 0.05 to allow both fluorophores to be displayed without pixel saturation. mCherry images were manually adjusted to to maximize display range for each image. Figures were designed and prepared using Prism, Adobe Illustrator 2026, and Fiji.
Quantification of the average copy number of Alx1 subunits. Cells were prepared for imaging by overnight culture as described in live-cell fluorescence microscopy. Cells (NASP56) expressing Fta3-GFP were mounted on the same pad as Alx1-GFP cells and imaged as above. Raw images were analyzed using a custom MATLAB script, ‘Find_n_Fit_Spots’ (https://github.com/LusKingLab/Find_n_Fit_Spots_3D) as previously described (Ader et al., 2023).
","reagents":"Table 1. List of S. pombe strains used in this study. | ||
|---|---|---|
Strain (NASP) | Genotype | Origin |
56 | fta3::fta3-mEGFP:kanMX6 | leu1-32 | ura4-D18 | ade6-M210 | h+ | Ader et al., 2023 |
616 | alx1::alx1-3xHA-mEGFP:kanMX6 | cmp7::hygMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
617 | alx1::alx1-3xHA-mEGFP:kanMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
Table 2. List of primers used in this study. | |
|---|---|
Primer Name | Sequence |
prNA253_alx1_L3 | GCTTTAGAGAAGCTGTTGATGCCAAG |
prNA254_alx1_L4 | ttaattaacccggggatccgTTTTTTTGACGATTTAAACTTGATTTTATGGATTTCAGG |
prNA255_alx1_L5 | gtttaaacgagctcgaattcGATTATCATATGTGATCATATAGTATTAAATCCGCATACA |
prNA256_alx1_L6 | AAATGCTTCAACGGTGTGGATGG |
Table 3. Plasmids used in this study. | |||
|---|---|---|---|
Identifier | Name/Description | Usage | Origin |
pNA8 | pNA8_pFA6a-3xHA-mEGFP-KanMX6 | Template for PCR based chromosomal integration of 3×HA-mEGFP ORF | Ader et al., 2023 |
The nuclear envelope is critical for maintenance of nucleocytoplasmic compartmentalization. However, nuclear division in many species necessitates a transient disruption of the nuclear envelope to accommodate chromatin segregation by cytoplasmic machinery. At the resolution of nuclear division, holes in the reforming nuclear envelope are sealed by the endosomal sorting complexes required for transport (ESCRT) machinery (Gu et al., 2017; Olmos et al., 2015; Vietri et al., 2015).
The ESCRT machinery remodels membranes across the cell through a group of filament-forming subunits, ESCRT-IIIs, which are canonically targeted to specific membranes by the ESCRT-I/II family of proteins (Burigotto and Carlton, 2025). However, non-canonical recruitment of ESCRT-IIIs by alternative, membrane-specific proteins is also possible. For example, at the nuclear envelope, the unique ESCRT-II/III hybrid protein, Cmp7, recruits ESCRT-III proteins to facilitate nuclear envelope sealing independent of ESCRT-I/IIs via binding to the integral inner nuclear membrane protein Heh1/LEM2 (Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; von Appen et al., 2020; Webster et al., 2016).
Recently, the ESCRT-associated protein, Alx1, has been suggested to play an ESCRT-independent role in the mitotic nuclear envelope sealing of Schizosaccharomyces japonicus (Lee et al., 2020; Sydir et al., 2026). To determine if the presence of an ESCRT-independent nuclear envelope remodeling pathway was conserved across species, we sought to investigate Alx1 involvement in nuclear envelope remodeling in the related fission yeast, Schizosaccharomyces pombe. Notably, while closely related to S. japonicus, S. pombe employ more conservative nuclear envelope remodeling during mitosis, simply transiently inserting their microtubule organizing center, the spindle pole body (SPB), into their nuclear envelope to nucleate a mitotic spindle (Ding et al., 1997). Unlike S. japonicus, S. pombe maintain nucleocytoplasmic compartmentation during mitosis (Arai et al., 2010; Asakawa et al., 2010).
To investigate a potential ESCRT-independent role of Alx1 in mitotic nuclear envelope remodeling in S. pombe, we performed live-cell fluorescence microscopy of cells endogenously expressing Alx1-GFP. Unlike core ESCRT-III proteins (Vps32, Ist1, Did4, Vps24) previously observed by live-cell fluorescence microscopy (Ader et al., 2023), we observed no Alx1-GFP puncta in interphase cells, suggesting that Alx1 is not involved in the formation of intraendosomal vesicles (Fig. 1A). Conversely, when we examined mitotic cells, we observed robust Alx1-GFP recruitment to the site of a mitotic nuclear envelope hole, visualized as co-localization of Alx1-GFP and a SPB protein (Pcp1-mCherry) (Fig. 1A, B). Notably, we did not observe recruitment of Alx1-GFP to a mitotic “tail” of the nuclear envelope as in S. japonicus (Lee et al., 2020). Thus, while Alx1 appears to perform a mitotic role at a nuclear envelope hole in S. pombe, as in S. japonicus, this function appears to be restricted to the mitotic nuclear envelope hole created by the SPB.
While the molecular architecture of in vivo ESCRT assembly remains enigmatic, previous work has sought to determine an absolute number of ESCRT subunits and their stoichiometry at sites of both intraendosomal vesicle formation (Adell et al., 2017) and nuclear envelope constriction/sealing (Ader et al., 2023). Hence, we calculated the absolute number of Alx1-GFP molecules at a nuclear envelope hole throughout mitosis using the kinetochore protein Fta3 as a molecular standard (Ader et al., 2023; Lawrimore et al., 2011). We determined this nuclear envelope hole contains an average of 83 ± 11 molecules of Alx1-GFP and that this level remains relatively constant over the course of anaphase B (Fig. 1C). When considered in the context of the previously published copy number of other ESCRT molecules at a mitotic nuclear envelope hole, this suggests that Alx1 may play a role akin to the more abundant Vps32 (72 molecules) and Vps24 (77 molecules) ESCRT proteins, rather than the lower abundant Cmp7 (15 molecules), Ist1 (25–34 molecules) and Did4 (25 molecules) (Ader et al., 2023).
We next sought to determine if the presence of Alx1 at a mitotic nuclear envelope hole was consistent with an ESCRT-independent pathway. As all previously observed ESCRT-III recruitment to the nuclear envelope depends on Cmp7 (Ader et al., 2023; Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; Vietri et al., 2015), recruitment of Alx1-GFP to a mitotic nuclear envelope hole in cells lacking CMP7 would suggest an ESCRT-independent role for Alx1. However, we observed that Alx1-GFP recruitment to a mitotic nuclear envelope hole was completely abolished in cmp7∆ cells (Fig. 1A, B). This suggests that in S. pombe, unlike S. japonicus, the contribution of Alx1 to membrane remodeling of a mitotic nuclear envelope hole is ESCRT-dependent (Fig. 1D).
Taken together, our data suggest that even closely related organisms may employ significantly different strategies for nuclear division. While it is tempting to speculate that the presence of an ESCRT-independent pathway for post-mitotic nuclear envelope sealing in S. japonicus may be a consequence of this yeast’s more “open” mitosis compared to S. pombe, further work across more diverse species is needed.
","references":[{"reference":"Adell MAY, Migliano SM, Upadhyayula S, Bykov YS, Sprenger S, Pakdel M, et al., Teis. 2017. Recruitment dynamics of ESCRT-III and Vps4 to endosomes and implications for reverse membrane budding. eLife 6: 10.7554/elife.31652.
","pubmedId":"","doi":"10.7554/eLife.31652"},{"reference":"Ader NR, Chen L, Surovtsev IV, Chadwick WL, Rodriguez EC, King MC, Lusk CP. 2023. An ESCRT grommet cooperates with a diffusion barrier to maintain nuclear integrity. Nature Cell Biology 25: 1465-1477.
","pubmedId":"","doi":"10.1038/s41556-023-01235-4"},{"reference":"Arai K, Sato M, Tanaka K, Yamamoto M. 2010. Nuclear Compartmentalization Is Abolished during Fission Yeast Meiosis. Current Biology 20: 1913-1918.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.004"},{"reference":"Asakawa H, Kojidani T, Mori C, Osakada H, Sato M, Ding DQ, Hiraoka Y, Haraguchi T. 2010. Virtual Breakdown of the Nuclear Envelope in Fission Yeast Meiosis. Current Biology 20: 1919-1925.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.070"},{"reference":"Bähler Jr, Wu JQ, Longtine MS, Shah NG, Mckenzie III A, Steever AB, et al., Pringle. 1998. Heterologous modules for efficient and versatile PCR-based gene targeting inSchizosaccharomyces pombe. Yeast 14: 943-951.
","pubmedId":"","doi":"10.1002/(sici)1097-0061(199807)14:10<943::Aid-yea292>3.0.Co;2-y"},{"reference":"Burigotto M, Carlton JG. 2025. ESCRT-III function in membrane fission and repair. Nature Reviews Molecular Cell Biology 27: 297-315.
","pubmedId":"","doi":"10.1038/s41580-025-00909-1"},{"reference":"Davis MW, Jorgensen EM. 2022. ApE, A Plasmid Editor: A Freely Available DNA Manipulation and Visualization Program. Frontiers in Bioinformatics 2: 10.3389/fbinf.2022.818619.
","pubmedId":"","doi":"10.3389/fbinf.2022.818619"},{"reference":"Ding R, West RR, Morphew DM, Oakley BR, McIntosh JR. 1997. The spindle pole body of Schizosaccharomyces pombe enters and leaves the nuclear envelope as the cell cycle proceeds. Molecular Biology of the Cell 8: 1461-1479.
","pubmedId":"","doi":"10.1091/mbc.8.8.1461"},{"reference":"Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, et al., Frost. 2017. LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Proceedings of the National Academy of Sciences 114: 10.1073/pnas.1613916114.
","pubmedId":"","doi":"10.1073/pnas.1613916114"},{"reference":"Hentges P, Van Driessche B, Tafforeau L, Vandenhaute J, Carr AM. 2005. Three novel antibiotic marker cassettes for gene disruption and marker switching inSchizosaccharomyces pombe. Yeast 22: 1013-1019.
","pubmedId":"","doi":"10.1002/yea.1291"},{"reference":"Huxley C, Green ED, Dunbam I. 1990. Rapid assessment of S. cerevisiae mating type by PCR. Trends in Genetics 6: 236.
","pubmedId":"","doi":"10.1016/0168-9525(90)90190-h"},{"reference":"Lawrimore J, Bloom KS, Salmon ED. 2011. Point centromeres contain more than a single centromere-specific Cse4 (CENP-A) nucleosome. Journal of Cell Biology 195: 573-582.
","pubmedId":"","doi":"10.1083/jcb.201106036"},{"reference":"Lee IJ, Stokasimov E, Dempsey N, Varberg JM, Jacob E, Jaspersen SL, Pellman D. 2020. Factors promoting nuclear envelope assembly independent of the canonical ESCRT pathway. Journal of Cell Biology 219: 10.1083/jcb.201908232.
","pubmedId":"","doi":"10.1083/jcb.201908232"},{"reference":"Moreno S, Klar A, Nurse P. 1991. [56] Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods in Enzymology,Guide to Yeast Genetics and Molecular Biology : 795-823.
","pubmedId":"","doi":"10.1016/0076-6879(91)94059-l"},{"reference":"Murray JM, Watson AT, Carr AM. 2016. Transformation of Schizosaccharomyces pombe: Lithium Acetate/ Dimethyl Sulfoxide Procedure. Cold Spring Harbor Protocols 2016: pdb.prot090969.
","pubmedId":"","doi":"10.1101/pdb.prot090969"},{"reference":"Olmos Y, Hodgson L, Mantell J, Verkade P, Carlton JG. 2015. ESCRT-III controls nuclear envelope reformation. Nature 522: 236-239.
","pubmedId":"","doi":"10.1038/nature14503"},{"reference":"Olmos Y, Perdrix-Rosell A, Carlton JG. 2016. Membrane Binding by CHMP7 Coordinates ESCRT-III-Dependent Nuclear Envelope Reformation. Current Biology 26: 2635-2641.
","pubmedId":"","doi":"10.1016/j.cub.2016.07.039"},{"reference":"Rutherford KM, Lera-Ramírez M, Wood V. 2024. PomBase: a Global Core Biodata Resource—growth, collaboration, and sustainability. GENETICS 227: 10.1093/genetics/iyae007.
","pubmedId":"","doi":"10.1093/genetics/iyae007"},{"reference":"Sydir EM, Farra MH, Whitford AL, Hinojosa S, Kao PY, Paulo JA, et al., Pellman. 2026. Components of an ESCRT-independent nuclear envelope assembly pathway. : 10.64898/2026.02.01.703137.
","pubmedId":"","doi":"10.64898/2026.02.01.703137"},{"reference":"Thaller DJ, Allegretti M, Borah S, Ronchi P, Beck M, Lusk CP. 2019. An ESCRT-LEM protein surveillance system is poised to directly monitor the nuclear envelope and nuclear transport system. eLife 8: 10.7554/elife.45284.
","pubmedId":"","doi":"10.7554/eLife.45284"},{"reference":"Vietri M, Schink KO, Campsteijn C, Wegner CS, Schultz SW, Christ L, et al., Stenmark. 2015. Spastin and ESCRT-III coordinate mitotic spindle disassembly and nuclear envelope sealing. Nature 522: 231-235.
","pubmedId":"","doi":"10.1038/nature14408"},{"reference":"von Appen A, LaJoie D, Johnson IE, Trnka MJ, Pick SM, Burlingame AL, Ullman KS, Frost A. 2020. LEM2 phase separation promotes ESCRT-mediated nuclear envelope reformation. Nature 582: 115-118.
","pubmedId":"","doi":"10.1038/s41586-020-2232-x"},{"reference":"Webster BM, Thaller DJ, Jäger J, Ochmann SE, Borah S, Lusk CP. 2016. Chm7 and Heh1 collaborate to link nuclear pore complex quality control with nuclear envelope sealing. The EMBO Journal 35: 2447-2467.
","pubmedId":"","doi":"10.15252/embj.201694574"},{"reference":"Wood V, Gwilliam R, Rajandream MA, Lyne M, Lyne R, Stewart A, et al., Nurse. 2002. The genome sequence of Schizosaccharomyces pombe. Nature 415: 871-880.
","pubmedId":"","doi":"10.1038/nature724"}],"title":"Cmp7-dependent recruitment of Alx1 to a mitotic nuclear envelope hole in Schizosaccharomyces pombe
","reviews":[{"reviewer":{"displayName":"I-Ju Lee"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Pascal Curator Carme"},"openAcknowledgement":false,"submitted":null}]},{"id":"b5c66770-a29a-4a06-b526-89a74a9e8bf5","decision":"accept","abstract":"The nuclear envelope maintains nucleocytoplasmic compartmentalization. Divergent strategies exist to accommodate the nuclear envelope during mitotic chromatin segregation. While the endosomal sorting complexes required for transport (ESCRT) machinery drives nuclear envelope remodeling during this process, recent work in Schizosaccharomyces japonicus suggests an ESCRT-independent pathway promoting nucleocytoplasmic compartmentalization mediated by Alx1. We investigate if this ESCRT-independent pathway is conserved in Schizosaccharomyces pombe. We find Alx1-GFP is recruited to a mitotic nuclear envelope hole in S. pombe, but that recruitment depends on the ESCRT machinery. Our data suggest diverse strategies of mitotic nuclear envelope remodeling necessitate varying strategies of promoting nucleocytoplasmic compartmentalization.
","acknowledgements":"The authors thank Ivan Surovtsev and William Chadwick for assistance with the Find_n_Fits_Spots script.
","authors":[{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","fundingAcquisition","investigation","writing_originalDraft","writing_reviewEditing"],"email":"K_PENA@uncg.edu","firstName":"Kaela D.","lastName":"Genereux","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0001-9398-7902"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"ONWALKER@uncg.edu","firstName":"Olivia N.","lastName":"Walker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0002-6328-9860"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"SOBENDERS@uncg.edu","firstName":"Sage O.","lastName":"Benders","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-2948-6581"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","software"],"email":"let@hpcacougars.org","firstName":"Thanh Truc","lastName":"Le","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-3923-8437"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["conceptualization","dataCuration","formalAnalysis","fundingAcquisition","investigation","methodology","project","resources","supervision","validation","writing_originalDraft","writing_reviewEditing"],"email":"nrader@uncg.edu","firstName":"Nicholas R.","lastName":"Ader","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7744-4484"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by UNC Greensboro through startup funds to N.R.A., a Munroe Grant to K.G. as well as an Undergraduate Research, Scholarship, and Creativity Award from the Undergraduate Research, Scholarship and Creativity Office to O.W. UNC Greensboro Department of Biology provided support through an Undergraduate Research Award to S.O.B. The Draelos Foundation provided support for T.T.L. and N.R.A.
","image":{"url":"https://portal.micropublication.org/uploads/0db77794799b989a2aa98f24623e0f0c.png"},"imageCaption":"A: Live-cell fluorescence micrographs of Alx1-GFP in S. pombe representative of cell populations at different stages of the cell cycle. For each subpanel: left, images of Alx1-GFP; middle, sum projection of mCherry-Atb2 (mitotic spindle) and Pcp1-mCherry (SPB); right, magnified views of region of interest (merge at the bottom). Top row shows wild type (WT) cells, and bottom row shows cmp7∆ cells. Scale bars, 1 µm (main images) and 500 nm (regions of interest).
B: Percentage of nuclei with Alx1-GFP co-localized with the SPB at the indicated phases of the cell cycle. Data for WT (gray) and cmp7Δ (teal) cells are shown. Points and error bars are the mean and range, respectively, from at least three biological replicates; ≥50 nuclei per replicate. Strains used in A and B are listed in Table 1: Alx1-GFP (NASP617; n = 268 nuclei); Alx1-GFP, cmp7∆ (NASP616; n = 423 nuclei).
C: Copy number of Alx1-GFP as a function of time in anaphase B. Black line represents a simple linear regression with the coefficient of determination (r2) indicated. Data from three biological replicates are shown, represented by different point shapes (triangle, circle, square) with at least 14 cells per biological replicate.. Strains used are listed in Table 1: Alx1-GFP (NASP617; n = 106); Fta3-GFP (NASP56).
D: A model of Alx1 recruitment to the nuclear envelope in S. pombe, indicating dependence on Cmp7. Nucleoplasm, blue; cytoplasm, beige; spindle pole body (SPB), dark magenta; mitotic spindle, light magenta.
","imageTitle":"Alx1 is recruited to a mitotic nuclear envelope hole in a Cmp7-dependent manner
","methods":"S. pombe culture and strain construction. S. pombe strains were cultured as standard (Moreno et al., 1991), with all experiments performed in either agar plates or liquid culture of yeast extract supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (YE5S). The pFA6a-MX6-based drug-resistance cassettes were used for carboxy (C)-terminal tagging (Bähler et al., 1998; Hentges et al., 2005). A plasmid Editor (ApE) 2.0.61 was used for visualization and virtual manipulation of DNA sequences (Davis and Jorgensen, 2022), with S. pombe genome information accessed through PomBase (Rutherford et al., 2024; Wood et al., 2002). PCR of whole yeast (colony PCR) (Huxley et al., 1990) was used to confirm genomic integration following lithium acetate transformation (Murray et al., 2016). Monomeric enhanced GFP (mEGFP) used for strain creation throughoutwith a 3×HA linker; abbreviated as GFP in Figure and Description.
Live-cell fluorescence microscopy. Cells expressing fluorescently tagged proteins were cultured to logarithmic phase (OD600 0.4–0.8), concentrated by brief centrifugation, and mounted on 1.4% agarose in Edinburgh minimal medium supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (EMM5S) pad sandwiched with a no. 1.5 glass coverslip, a glass slide, and then sealed with VALAP (1:1:1, vaseline:lanonin:paraffin) for imaging. Live-cell fluorescence microscopy was performed using a Nikon microscope imaging system with an incubated stage (Oko Lab) set to 32˚C. An LED light source (Nikon, D-LEDI) was used for illumination. For GFP: 475 nm excitation with a FITC filter cube (excitation 465–495 nm, emission 515–555 nm, long pass 505 nm). For mCherry: 550 nm excitation with an mCherry filter set (excitation 540–580, emission 593–667 nm, long pass 585 nm). Channels were acquired sequentially on an ORCA-Fusion BT Digital CMOS camera (Hamamatsu C15440-20UP) using a Plan Apo Lambda D 100× oil objective with a numerical aperture of 1.45. Z-stacks spanning the nuclear envelope region (~3.5–4.8 µm) were acquired every 200 nm to visualize Alx1-GFP localization at the mitotic nuclear envelope. Widefield images were deconvolved in NIS-Elements using a Richardson-Lucy method. Cells were classified into phases as previously published using mCherry-Atb2 (Ader et al., 2023). All Alx1-GFP images are shown at equivalent display range, set to maximize display range for Alx1-GFP image shown in WT anaphase B (Fig. 1A). For images in the mCherry channel (mCherry-Atb2 and Pcp1-mCherry), the gamma has been adjusted to 0.05 to allow both fluorophores to be displayed without pixel saturation. mCherry images were manually adjusted to to maximize display range for each image. Figures were designed and prepared using Prism, Adobe Illustrator 2026, and Fiji.
Quantification of the average copy number of Alx1 subunits. Cells were prepared for imaging by overnight culture as described in live-cell fluorescence microscopy. Cells (NASP56) expressing Fta3-GFP were mounted on the same pad as Alx1-GFP cells and imaged as above. Raw images were analyzed using a custom MATLAB script, ‘Find_n_Fit_Spots' (https://github.com/LusKingLab/Find_n_Fit_Spots_3D) as previously described (Ader et al., 2023).
","reagents":"Table 1. List of S. pombe strains used in this study. | ||
|---|---|---|
Strain (NASP) | Genotype | Origin |
56 | fta3::fta3-mEGFP:kanMX6 | leu1-32 | ura4-D18 | ade6-M210 | h+ | Ader et al., 2023 |
616 | alx1::alx1-3xHA-mEGFP:kanMX6 | cmp7::hygMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
617 | alx1::alx1-3xHA-mEGFP:kanMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
Table 2. List of primers used in this study. | |
|---|---|
Primer Name | Sequence |
prNA253_alx1_L3 | GCTTTAGAGAAGCTGTTGATGCCAAG |
prNA254_alx1_L4 | ttaattaacccggggatccgTTTTTTTGACGATTTAAACTTGATTTTATGGATTTCAGG |
prNA255_alx1_L5 | gtttaaacgagctcgaattcGATTATCATATGTGATCATATAGTATTAAATCCGCATACA |
prNA256_alx1_L6 | AAATGCTTCAACGGTGTGGATGG |
Table 3. Plasmids used in this study. | |||
|---|---|---|---|
Identifier | Name/Description | Usage | Origin |
pNA8 | pNA8_pFA6a-3xHA-mEGFP-KanMX6 | Template for PCR based chromosomal integration of 3×HA-mEGFP ORF | Ader et al., 2023 |
The nuclear envelope is critical for maintenance of nucleocytoplasmic compartmentalization. However, nuclear division in many species necessitates a transient disruption of the nuclear envelope to accommodate chromatin segregation by cytoplasmic machinery. At the resolution of nuclear division, holes in the reforming nuclear envelope are sealed by the endosomal sorting complexes required for transport (ESCRT) machinery (Gu et al., 2017; Olmos et al., 2015; Vietri et al., 2015).
\n\n\nThe ESCRT machinery remodels membranes across the cell through a group of filament-forming subunits, ESCRT-IIIs, which are canonically targeted to specific membranes by the ESCRT-I/II family of proteins (Burigotto and Carlton, 2025). However, non-canonical recruitment of ESCRT-IIIs by alternative, membrane-specific proteins is also possible. For example, at the nuclear envelope, the unique ESCRT-II/III hybrid protein, Cmp7, recruits ESCRT-III proteins to facilitate nuclear envelope sealing independent of ESCRT-I/IIs via binding to the integral inner nuclear membrane protein Heh1/LEM2 (Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; von Appen et al., 2020; Webster et al., 2016).
\n\n\nRecently, the ESCRT-associated protein, Alx1, has been suggested to play an ESCRT-independent role in the mitotic nuclear envelope sealing of Schizosaccharomyces japonicus. While the precise mechanism of this ESCRT-independent pathway remain to be elucidated, it appears to strongly depend on the role of Alx1 (Lee et al., 2020; Sydir et al., 2026). To determine if the presence of an ESCRT-independent nuclear envelope remodeling pathway was conserved across species, we sought to investigate Alx1 involvement in nuclear envelope remodeling in the related fission yeast, Schizosaccharomyces pombe. Notably, while closely related to S. japonicus, S. pombe employ more conservative nuclear envelope remodeling during mitosis, simply transiently inserting their microtubule organizing center, the spindle pole body (SPB), into their nuclear envelope to nucleate a mitotic spindle (Ding et al., 1997). Unlike S. japonicus, S. pombe maintain nucleocytoplasmic compartmentation during mitosis (Arai et al., 2010; Asakawa et al., 2010).
\n\n\nTo investigate a potential ESCRT-independent role of Alx1 in mitotic nuclear envelope remodeling in S. pombe, we performed live-cell fluorescence microscopy of cells endogenously expressing Alx1-GFP. Unlike core ESCRT-III proteins previously observed by live-cell fluorescence microscopy (Ader et al., 2023), we observed no Alx1-GFP puncta in interphase cells, suggesting that Alx1 is not involved in the formation of intraendosomal vesicles (Fig. 1A). Conversely, when we examined mitotic cells, we observed robust Alx1-GFP recruitment to the site of a mitotic nuclear envelope hole, visualized as co-localization of Alx1-GFP and a SPB protein (Pcp1-mCherry) (Fig. 1A, B). Notably, we did not observe recruitment of Alx1-GFP to a mitotic “tail” of the nuclear envelope as in S. japonicus (Lee et al., 2020). Thus, while Alx1 appears to perform a mitotic role at a nuclear envelope hole in S. pombe, as in S. japonicus, this function appears to be restricted to the mitotic nuclear envelope hole created by the SPB.
\n\n\nWhile the molecular architecture of in vivo ESCRT assembly remains enigmatic, previous work has sought to determine an absolute number of ESCRT subunits and their stoichiometry at sites of both intraendosomal vesicle formation (Adell et al., 2017) and nuclear envelope constriction/sealing (Ader et al., 2023). Hence, we calculated the absolute number of Alx1-GFP molecules at a nuclear envelope hole throughout mitosis using the kinetochore protein Fta3 as a molecular standard (Ader et al., 2023; Lawrimore et al., 2011). We determined this nuclear envelope hole contains an average of 83 ± 11 molecules of Alx1-GFP and that this level remains relatively constant over the course of anaphase B (Fig. 1C). Thus, while the precise role of Alx1 at a nuclear envelope hole remains to be determined, it appears to be present in an approximate 1:1 stoichiometry with the mitotically recruited ESCRT-III subunit Vps32 (72 molecules; CHMP4 in Homo sapiens; Snf7 in Saccharomyces cerevisiae) and in higher abundance compared to Cmp7 (15 molecules) and Ist1 (30 molecules) (Ader et al., 2023).
\n\n\nWe next sought to determine if the presence of Alx1 at a mitotic nuclear envelope hole was consistent with an ESCRT-independent pathway. As all previously observed ESCRT-III recruitment to the nuclear envelope depends on Cmp7 (Ader et al., 2023; Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; Vietri et al., 2015), recruitment of Alx1-GFP to a mitotic nuclear envelope hole in cells lacking CMP7 would suggest an ESCRT-independent role for Alx1. However, we observed that Alx1-GFP recruitment to a mitotic nuclear envelope hole was completely abolished in cmp7∆ cells (Fig. 1A, B). This suggests that in S. pombe, unlike S. japonicus, the contribution of Alx1 to membrane remodeling of a mitotic nuclear envelope hole is ESCRT-dependent (Fig. 1D).
\n\n\nTaken together, our data suggest that even closely related organisms may employ significantly different strategies for nuclear division. While it is tempting to speculate that the presence of an ESCRT-independent pathway for post-mitotic nuclear envelope sealing in S. japonicus may be a consequence of this yeast's more “open” mitosis compared to S. pombe, further work across more diverse species is needed.
","references":[{"reference":"Adell MAY, Migliano SM, Upadhyayula S, Bykov YS, Sprenger S, Pakdel M, et al., Teis. 2017. Recruitment dynamics of ESCRT-III and Vps4 to endosomes and implications for reverse membrane budding. eLife 6: 10.7554/elife.31652.
","pubmedId":"","doi":"10.7554/eLife.31652"},{"reference":"Ader NR, Chen L, Surovtsev IV, Chadwick WL, Rodriguez EC, King MC, Lusk CP. 2023. An ESCRT grommet cooperates with a diffusion barrier to maintain nuclear integrity. Nature Cell Biology 25: 1465-1477.
","pubmedId":"","doi":"10.1038/s41556-023-01235-4"},{"reference":"Arai K, Sato M, Tanaka K, Yamamoto M. 2010. Nuclear Compartmentalization Is Abolished during Fission Yeast Meiosis. Current Biology 20: 1913-1918.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.004"},{"reference":"Asakawa H, Kojidani T, Mori C, Osakada H, Sato M, Ding DQ, Hiraoka Y, Haraguchi T. 2010. Virtual Breakdown of the Nuclear Envelope in Fission Yeast Meiosis. Current Biology 20: 1919-1925.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.070"},{"reference":"Bähler Jr, Wu JQ, Longtine MS, Shah NG, Mckenzie III A, Steever AB, et al., Pringle. 1998. Heterologous modules for efficient and versatile PCR-based gene targeting inSchizosaccharomyces pombe. Yeast 14: 943-951.
","pubmedId":"","doi":"10.1002/(sici)1097-0061(199807)14:10<943::Aid-yea292>3.0.Co;2-y"},{"reference":"Burigotto M, Carlton JG. 2025. ESCRT-III function in membrane fission and repair. Nature Reviews Molecular Cell Biology 27: 297-315.
","pubmedId":"","doi":"10.1038/s41580-025-00909-1"},{"reference":"Davis MW, Jorgensen EM. 2022. ApE, A Plasmid Editor: A Freely Available DNA Manipulation and Visualization Program. Frontiers in Bioinformatics 2: 10.3389/fbinf.2022.818619.
","pubmedId":"","doi":"10.3389/fbinf.2022.818619"},{"reference":"Ding R, West RR, Morphew DM, Oakley BR, McIntosh JR. 1997. The spindle pole body of Schizosaccharomyces pombe enters and leaves the nuclear envelope as the cell cycle proceeds. Molecular Biology of the Cell 8: 1461-1479.
","pubmedId":"","doi":"10.1091/mbc.8.8.1461"},{"reference":"Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, et al., Frost. 2017. LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Proceedings of the National Academy of Sciences 114: 10.1073/pnas.1613916114.
","pubmedId":"","doi":"10.1073/pnas.1613916114"},{"reference":"Hentges P, Van Driessche B, Tafforeau L, Vandenhaute J, Carr AM. 2005. Three novel antibiotic marker cassettes for gene disruption and marker switching inSchizosaccharomyces pombe. Yeast 22: 1013-1019.
","pubmedId":"","doi":"10.1002/yea.1291"},{"reference":"Huxley C, Green ED, Dunbam I. 1990. Rapid assessment of S. cerevisiae mating type by PCR. Trends in Genetics 6: 236.
","pubmedId":"","doi":"10.1016/0168-9525(90)90190-h"},{"reference":"Lawrimore J, Bloom KS, Salmon ED. 2011. Point centromeres contain more than a single centromere-specific Cse4 (CENP-A) nucleosome. Journal of Cell Biology 195: 573-582.
","pubmedId":"","doi":"10.1083/jcb.201106036"},{"reference":"Lee IJ, Stokasimov E, Dempsey N, Varberg JM, Jacob E, Jaspersen SL, Pellman D. 2020. Factors promoting nuclear envelope assembly independent of the canonical ESCRT pathway. Journal of Cell Biology 219: 10.1083/jcb.201908232.
","pubmedId":"","doi":"10.1083/jcb.201908232"},{"reference":"Moreno S, Klar A, Nurse P. 1991. [56] Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods in Enzymology,Guide to Yeast Genetics and Molecular Biology : 795-823.
","pubmedId":"","doi":"10.1016/0076-6879(91)94059-l"},{"reference":"Murray JM, Watson AT, Carr AM. 2016. Transformation of Schizosaccharomyces pombe: Lithium Acetate/ Dimethyl Sulfoxide Procedure. Cold Spring Harbor Protocols 2016: pdb.prot090969.
","pubmedId":"","doi":"10.1101/pdb.prot090969"},{"reference":"Olmos Y, Hodgson L, Mantell J, Verkade P, Carlton JG. 2015. ESCRT-III controls nuclear envelope reformation. Nature 522: 236-239.
","pubmedId":"","doi":"10.1038/nature14503"},{"reference":"Olmos Y, Perdrix-Rosell A, Carlton JG. 2016. Membrane Binding by CHMP7 Coordinates ESCRT-III-Dependent Nuclear Envelope Reformation. Current Biology 26: 2635-2641.
","pubmedId":"","doi":"10.1016/j.cub.2016.07.039"},{"reference":"Rutherford KM, Lera-Ramírez M, Wood V. 2024. PomBase: a Global Core Biodata Resource—growth, collaboration, and sustainability. GENETICS 227: 10.1093/genetics/iyae007.
","pubmedId":"","doi":"10.1093/genetics/iyae007"},{"reference":"Sydir EM, Farra MH, Whitford AL, Hinojosa S, Kao PY, Paulo JA, et al., Pellman. 2026. Components of an ESCRT-independent nuclear envelope assembly pathway. : 10.64898/2026.02.01.703137.
","pubmedId":"","doi":"10.64898/2026.02.01.703137"},{"reference":"Thaller DJ, Allegretti M, Borah S, Ronchi P, Beck M, Lusk CP. 2019. An ESCRT-LEM protein surveillance system is poised to directly monitor the nuclear envelope and nuclear transport system. eLife 8: 10.7554/elife.45284.
","pubmedId":"","doi":"10.7554/eLife.45284"},{"reference":"Vietri M, Schink KO, Campsteijn C, Wegner CS, Schultz SW, Christ L, et al., Stenmark. 2015. Spastin and ESCRT-III coordinate mitotic spindle disassembly and nuclear envelope sealing. Nature 522: 231-235.
","pubmedId":"","doi":"10.1038/nature14408"},{"reference":"von Appen A, LaJoie D, Johnson IE, Trnka MJ, Pick SM, Burlingame AL, Ullman KS, Frost A. 2020. LEM2 phase separation promotes ESCRT-mediated nuclear envelope reformation. Nature 582: 115-118.
","pubmedId":"","doi":"10.1038/s41586-020-2232-x"},{"reference":"Webster BM, Thaller DJ, Jäger J, Ochmann SE, Borah S, Lusk CP. 2016. Chm7 and Heh1 collaborate to link nuclear pore complex quality control with nuclear envelope sealing. The EMBO Journal 35: 2447-2467.
","pubmedId":"","doi":"10.15252/embj.201694574"},{"reference":"Wood V, Gwilliam R, Rajandream MA, Lyne M, Lyne R, Stewart A, et al., Nurse. 2002. The genome sequence of Schizosaccharomyces pombe. Nature 415: 871-880.
","pubmedId":"","doi":"10.1038/nature724"}],"title":"Cmp7-dependent recruitment of Alx1 to a mitotic nuclear envelope hole in Schizosaccharomyces pombe
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Pascal Curator Carme"},"openAcknowledgement":false,"submitted":"1776409129217"}]},{"id":"01e3eeb3-7ef9-4abd-843e-d08f4817c220","decision":"revise","abstract":"The nuclear envelope maintains nucleocytoplasmic compartmentalization. Divergent strategies exist to accommodate the nuclear envelope during mitotic chromatin segregation. While the endosomal sorting complexes required for transport (ESCRT) machinery drives nuclear envelope remodeling during this process, recent work in Schizosaccharomyces japonicus suggests an ESCRT-independent pathway promoting nucleocytoplasmic compartmentalization mediated by Alx1. We investigate if this ESCRT-independent pathway is conserved in Schizosaccharomyces pombe. We find Alx1-GFP is recruited to a mitotic nuclear envelope hole in S. pombe, but that recruitment depends on the ESCRT machinery. Our data suggest diverse strategies of mitotic nuclear envelope remodeling necessitate varying strategies of promoting nucleocytoplasmic compartmentalization.
","acknowledgements":"The authors thank Ivan Surovtsev and William Chadwick for assistance with the Find_n_Fits_Spots script.
","authors":[{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","fundingAcquisition","investigation","writing_originalDraft","writing_reviewEditing"],"email":"K_PENA@uncg.edu","firstName":"Kaela D.","lastName":"Genereux","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0001-9398-7902"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"ONWALKER@uncg.edu","firstName":"Olivia N.","lastName":"Walker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0002-6328-9860"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"SOBENDERS@uncg.edu","firstName":"Sage O.","lastName":"Benders","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-2948-6581"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","software"],"email":"let@hpcacougars.org","firstName":"Thanh Truc","lastName":"Le","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-3923-8437"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["conceptualization","dataCuration","formalAnalysis","fundingAcquisition","investigation","methodology","project","resources","supervision","validation","writing_originalDraft","writing_reviewEditing"],"email":"nrader@uncg.edu","firstName":"Nicholas R.","lastName":"Ader","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7744-4484"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by UNC Greensboro through startup funds to N.R.A., a Munroe Grant to K.G. as well as an Undergraduate Research, Scholarship, and Creativity Award from the Undergraduate Research, Scholarship and Creativity Office to O.W. UNC Greensboro Department of Biology provided support through an Undergraduate Research Award to S.O.B. The Draelos Foundation provided support for T.T.L. and N.R.A.
","image":{"url":"https://portal.micropublication.org/uploads/0dbe89f5900b6ad9d8be45ff30845507.png"},"imageCaption":"A: Live-cell fluorescence micrographs of Alx1-GFP in S. pombe representative of cell populations at different stages of the cell cycle. For each subpanel: left, images of Alx1-GFP; middle, sum projection of mCherry-Atb2 (mitotic spindle) and Pcp1-mCherry (SPB); right, magnified views of region of interest (merge at the bottom). Top row shows wild type (WT) cells, and bottom row shows cmp7∆ cells. Scale bars, 1 µm (main images) and 500 nm (regions of interest).
B: Percentage of nuclei with Alx1-GFP co-localized with the SPB at the indicated phases of the cell cycle. Data for WT (gray) and cmp7Δ (teal) cells are shown. Points and error bars are the mean and range, respectively, from at least three biological replicates; ≥50 nuclei per replicate. Strains used in A and B are listed in Table 1: Alx1-GFP (NASP617; n = 268 nuclei); Alx1-GFP, cmp7∆ (NASP616; n = 423 nuclei).
C: Copy number of Alx1-GFP as a function of time in anaphase B. Black line represents a simple linear regression with the coefficient of determination (r2) indicated. Data from three biological replicates are shown, represented by different point shapes (triangle, circle, square) with at least 14 cells per biological replicate. Strains used are listed in Table 1: Alx1-GFP (NASP617; n = 106); Fta3-GFP (NASP56).
D: A model of Alx1 recruitment to the nuclear envelope in S. pombe, indicating dependence on Cmp7. Nucleoplasm, blue; cytoplasm, beige; spindle pole body (SPB), dark magenta; mitotic spindle, light magenta.
","imageTitle":"Alx1 is recruited to a mitotic nuclear envelope hole in a Cmp7-dependent manner
","methods":"S. pombe culture and strain construction. S. pombe strains were cultured as standard (Moreno et al., 1991), with all experiments performed in either agar plates or liquid culture of yeast extract supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (YE5S). The pFA6a-MX6-based drug-resistance cassettes were used for carboxy (C)-terminal tagging (Bähler et al., 1998; Hentges et al., 2005). A plasmid Editor (ApE) 2.0.61 was used for visualization and virtual manipulation of DNA sequences (Davis and Jorgensen, 2022), with S. pombe genome information accessed through PomBase (Carme et al., 2026). PCR of whole yeast (colony PCR) (Huxley et al., 1990) was used to confirm genomic integration following lithium acetate transformation (Murray et al., 2016). Monomeric enhanced GFP (mEGFP) used for strain creation throughoutwith a 3×HA linker; abbreviated as GFP in Figure and Description.
Live-cell fluorescence microscopy. Cells expressing fluorescently tagged proteins were cultured to logarithmic phase (OD600 0.4–0.8), concentrated by brief centrifugation, and mounted on 1.4% agarose in Edinburgh minimal medium supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (EMM5S) pad sandwiched with a no. 1.5 glass coverslip, a glass slide, and then sealed with VALAP (1:1:1, vaseline:lanonin:paraffin) for imaging. Live-cell fluorescence microscopy was performed using a Nikon microscope imaging system with an incubated stage (Oko Lab) set to 32˚C. An LED light source (Nikon, D-LEDI) was used for illumination. For GFP: 475 nm excitation with a FITC filter cube (excitation 465–495 nm, emission 515–555 nm, long pass 505 nm). For mCherry: 550 nm excitation with an mCherry filter set (excitation 540–580, emission 593–667 nm, long pass 585 nm). Channels were acquired sequentially on an ORCA-Fusion BT Digital CMOS camera (Hamamatsu C15440-20UP) using a Plan Apo Lambda D 100× oil objective with a numerical aperture of 1.45. Z-stacks spanning the nuclear envelope region (~3.5–4.8 µm) were acquired every 200 nm to visualize Alx1-GFP localization at the mitotic nuclear envelope. Widefield images were deconvolved in NIS-Elements using a Richardson-Lucy method. Cells were classified into phases as previously published using mCherry-Atb2 (Ader et al., 2023). All Alx1-GFP images are shown at equivalent display range, set to maximize display range for Alx1-GFP image shown in WT anaphase B (Fig. 1A). For images in the mCherry channel (mCherry-Atb2 and Pcp1-mCherry), the gamma has been adjusted to 0.05 to allow both fluorophores to be displayed without pixel saturation. mCherry images were manually adjusted to to maximize display range for each image. Figures were designed and prepared using Prism, Adobe Illustrator 2026, and Fiji.
Quantification of the average copy number of Alx1 subunits. Cells were prepared for imaging by overnight culture as described in live-cell fluorescence microscopy. Cells (NASP56) expressing Fta3-GFP were mounted on the same pad as Alx1-GFP cells and imaged as above. Raw images were analyzed using a custom MATLAB script, ‘Find_n_Fit_Spots' (https://github.com/LusKingLab/Find_n_Fit_Spots_3D) as previously described (Ader et al., 2023).
","reagents":"Table 1. List of S. pombe strains used in this study. | ||
|---|---|---|
Strain (NASP) | Genotype | Origin |
56 | fta3::fta3-mEGFP:kanMX6 | leu1-32 | ura4-D18 | ade6-M210 | h+ | Ader et al., 2023 |
616 | alx1::alx1-3xHA-mEGFP:kanMX6 | cmp7::hygMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
617 | alx1::alx1-3xHA-mEGFP:kanMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
Table 2. List of primers used in this study. | |
|---|---|
Primer Name | Sequence |
prNA253_alx1_L3 | GCTTTAGAGAAGCTGTTGATGCCAAG |
prNA254_alx1_L4 | ttaattaacccggggatccgTTTTTTTGACGATTTAAACTTGATTTTATGGATTTCAGG |
prNA255_alx1_L5 | gtttaaacgagctcgaattcGATTATCATATGTGATCATATAGTATTAAATCCGCATACA |
prNA256_alx1_L6 | AAATGCTTCAACGGTGTGGATGG |
Table 3. Plasmids used in this study. | |||
|---|---|---|---|
Identifier | Name/Description | Usage | Origin |
pNA8 | pNA8_pFA6a-3xHA-mEGFP-KanMX6 | Template for PCR based chromosomal integration of 3×HA-mEGFP ORF | Ader et al., 2023 |
The nuclear envelope is critical for maintenance of nucleocytoplasmic compartmentalization. However, nuclear division in many species necessitates a transient disruption of the nuclear envelope to accommodate chromatin segregation by cytoplasmic machinery. At the resolution of nuclear division, holes in the reforming nuclear envelope are sealed by the endosomal sorting complexes required for transport (ESCRT) machinery (Gu et al., 2017; Olmos et al., 2015; Vietri et al., 2015).
The ESCRT machinery remodels membranes across the cell through a group of filament-forming subunits, ESCRT-IIIs, which are canonically targeted to specific membranes by the ESCRT-I/II family of proteins (Burigotto and Carlton, 2025). However, non-canonical recruitment of ESCRT-IIIs by alternative, membrane-specific proteins is also possible. For example, at the nuclear envelope, the unique ESCRT-II/III hybrid protein, Cmp7, recruits ESCRT-III proteins to facilitate nuclear envelope sealing independent of ESCRT-I/IIs via binding to the integral inner nuclear membrane protein Heh1/Lem2 (LEMD2 in Homo sapiens; Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; von Appen et al., 2020; Webster et al., 2016).
Recently, the ESCRT-associated protein, Alx1, has been suggested to play an ESCRT-independent role in the mitotic nuclear envelope sealing of Schizosaccharomyces japonicus. While the precise mechanism of this ESCRT-independent pathway remains to be elucidated, it appears to strongly depend on the role of Alx1 (Lee et al., 2020; Sydir et al., 2026). To determine if the presence of an ESCRT-independent nuclear envelope remodeling pathway was conserved across species, we sought to investigate Alx1 involvement in nuclear envelope remodeling in the related fission yeast, Schizosaccharomyces pombe. Notably, while closely related to S. japonicus, S. pombe employ more conservative nuclear envelope remodeling during mitosis, simply transiently inserting their microtubule organizing center, the spindle pole body (SPB), into their nuclear envelope to nucleate a mitotic spindle (Ding et al., 1997). Unlike S. japonicus, S. pombe maintain nucleocytoplasmic compartmentation during mitosis (Arai et al., 2010; Asakawa et al., 2010).
To investigate a potential ESCRT-independent role of Alx1 in mitotic nuclear envelope remodeling in S. pombe, we performed live-cell fluorescence microscopy of cells endogenously expressing Alx1-GFP. Unlike core ESCRT-III proteins previously observed by live-cell fluorescence microscopy (Ader et al., 2023), we observed no Alx1-GFP puncta in interphase cells, suggesting that Alx1 is not involved in the formation of intraendosomal vesicles (Fig. 1A). Conversely, when we examined mitotic cells, we observed robust Alx1-GFP recruitment to the site of a mitotic nuclear envelope hole, visualized as co-localization of Alx1-GFP and a SPB protein (Pcp1-mCherry) (Fig. 1A, B). Notably, we did not observe recruitment of Alx1-GFP to a mitotic “tail” of the nuclear envelope as in S. japonicus (Lee et al., 2020). Thus, while Alx1 appears to perform a mitotic role at a nuclear envelope hole in S. pombe, as in S. japonicus, this function appears to be restricted to the mitotic nuclear envelope hole created by the SPB.
While the molecular architecture of in vivo ESCRT assembly remains enigmatic, previous work has sought to determine an absolute number of ESCRT subunits and their stoichiometry at sites of both intraendosomal vesicle formation (Adell et al., 2017) and nuclear envelope constriction/sealing (Ader et al., 2023). Hence, we calculated the absolute number of Alx1-GFP molecules at a nuclear envelope hole throughout mitosis using the kinetochore protein Fta3 as a molecular standard (Ader et al., 2023; Lawrimore et al., 2011). We determined this nuclear envelope hole contains an average of 83 ± 11 molecules of Alx1-GFP and that this level remains relatively constant over the course of anaphase B (Fig. 1C). Thus, while the precise role of Alx1 at a nuclear envelope hole remains to be determined, Alx1 appears to be present in an approximate 1:1 stoichiometry with the mitotically recruited ESCRT-III subunit Vps32 (72 molecules; CHMP4 in Homo sapiens; Snf7 in Saccharomyces cerevisiae) and in higher abundance compared to Cmp7 (15 molecules) and Ist1 (30 molecules) (Ader et al., 2023).
We next sought to determine if the presence of Alx1 at a mitotic nuclear envelope hole was consistent with an ESCRT-independent pathway. As all previously observed ESCRT-III recruitment to the nuclear envelope depends on Cmp7 (Ader et al., 2023; Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; Vietri et al., 2015), recruitment of Alx1-GFP to a mitotic nuclear envelope hole in cells lacking cmp7 would suggest an ESCRT-independent role for Alx1. However, we observed that Alx1-GFP recruitment to a mitotic nuclear envelope hole was completely abolished in cmp7∆ cells (Fig. 1A, B). This suggests that in S. pombe, unlike S. japonicus, the contribution of Alx1 to membrane remodeling of a mitotic nuclear envelope hole is ESCRT-dependent (Fig. 1D).
Taken together, our data suggest that even closely related organisms may employ significantly different strategies for nuclear division. While it is tempting to speculate that the presence of an ESCRT-independent pathway for post-mitotic nuclear envelope sealing in S. japonicus may be a consequence of this yeast's more “open” mitosis compared to S. pombe, further work across more diverse species is needed.
","references":[{"reference":"Adell MAY, Migliano SM, Upadhyayula S, Bykov YS, Sprenger S, Pakdel M, et al., Teis. 2017. Recruitment dynamics of ESCRT-III and Vps4 to endosomes and implications for reverse membrane budding. eLife 6: 10.7554/elife.31652.
","pubmedId":"","doi":"10.7554/eLife.31652"},{"reference":"Ader NR, Chen L, Surovtsev IV, Chadwick WL, Rodriguez EC, King MC, Lusk CP. 2023. An ESCRT grommet cooperates with a diffusion barrier to maintain nuclear integrity. Nature Cell Biology 25: 1465-1477.
","pubmedId":"","doi":"10.1038/s41556-023-01235-4"},{"reference":"Arai K, Sato M, Tanaka K, Yamamoto M. 2010. Nuclear Compartmentalization Is Abolished during Fission Yeast Meiosis. Current Biology 20: 1913-1918.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.004"},{"reference":"Asakawa H, Kojidani T, Mori C, Osakada H, Sato M, Ding DQ, Hiraoka Y, Haraguchi T. 2010. Virtual Breakdown of the Nuclear Envelope in Fission Yeast Meiosis. Current Biology 20: 1919-1925.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.070"},{"reference":"Bähler Jr, Wu JQ, Longtine MS, Shah NG, Mckenzie III A, Steever AB, et al., Pringle. 1998. Heterologous modules for efficient and versatile PCR-based gene targeting inSchizosaccharomyces pombe. Yeast 14: 943-951.
","pubmedId":"","doi":"10.1002/(sici)1097-0061(199807)14:10<943::Aid-yea292>3.0.Co;2-y"},{"reference":"Burigotto M, Carlton JG. 2025. ESCRT-III function in membrane fission and repair. Nature Reviews Molecular Cell Biology 27: 297-315.
","pubmedId":"","doi":"10.1038/s41580-025-00909-1"},{"reference":"Carme P, Rutherford K, Bähler Jr, Mata J, Wood V. 2026. PomBase in 2026: expanding knowledge, modeling connections. GENETICS 232: 10.1093/genetics/iyag001.
","pubmedId":"","doi":"10.1093/genetics/iyag001"},{"reference":"Davis MW, Jorgensen EM. 2022. ApE, A Plasmid Editor: A Freely Available DNA Manipulation and Visualization Program. Frontiers in Bioinformatics 2: 10.3389/fbinf.2022.818619.
","pubmedId":"","doi":"10.3389/fbinf.2022.818619"},{"reference":"Ding R, West RR, Morphew DM, Oakley BR, McIntosh JR. 1997. The spindle pole body of Schizosaccharomyces pombe enters and leaves the nuclear envelope as the cell cycle proceeds. Molecular Biology of the Cell 8: 1461-1479.
","pubmedId":"","doi":"10.1091/mbc.8.8.1461"},{"reference":"Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, et al., Frost. 2017. LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Proceedings of the National Academy of Sciences 114: 10.1073/pnas.1613916114.
","pubmedId":"","doi":"10.1073/pnas.1613916114"},{"reference":"Hentges P, Van Driessche B, Tafforeau L, Vandenhaute J, Carr AM. 2005. Three novel antibiotic marker cassettes for gene disruption and marker switching inSchizosaccharomyces pombe. Yeast 22: 1013-1019.
","pubmedId":"","doi":"10.1002/yea.1291"},{"reference":"Huxley C, Green ED, Dunbam I. 1990. Rapid assessment of S. cerevisiae mating type by PCR. Trends in Genetics 6: 236.
","pubmedId":"","doi":"10.1016/0168-9525(90)90190-h"},{"reference":"Lawrimore J, Bloom KS, Salmon ED. 2011. Point centromeres contain more than a single centromere-specific Cse4 (CENP-A) nucleosome. Journal of Cell Biology 195: 573-582.
","pubmedId":"","doi":"10.1083/jcb.201106036"},{"reference":"Lee IJ, Stokasimov E, Dempsey N, Varberg JM, Jacob E, Jaspersen SL, Pellman D. 2020. Factors promoting nuclear envelope assembly independent of the canonical ESCRT pathway. Journal of Cell Biology 219: 10.1083/jcb.201908232.
","pubmedId":"","doi":"10.1083/jcb.201908232"},{"reference":"Moreno S, Klar A, Nurse P. 1991. [56] Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods in Enzymology,Guide to Yeast Genetics and Molecular Biology : 795-823.
","pubmedId":"","doi":"10.1016/0076-6879(91)94059-l"},{"reference":"Murray JM, Watson AT, Carr AM. 2016. Transformation of Schizosaccharomyces pombe: Lithium Acetate/ Dimethyl Sulfoxide Procedure. Cold Spring Harbor Protocols 2016: pdb.prot090969.
","pubmedId":"","doi":"10.1101/pdb.prot090969"},{"reference":"Olmos Y, Hodgson L, Mantell J, Verkade P, Carlton JG. 2015. ESCRT-III controls nuclear envelope reformation. Nature 522: 236-239.
","pubmedId":"","doi":"10.1038/nature14503"},{"reference":"Olmos Y, Perdrix-Rosell A, Carlton JG. 2016. Membrane Binding by CHMP7 Coordinates ESCRT-III-Dependent Nuclear Envelope Reformation. Current Biology 26: 2635-2641.
","pubmedId":"","doi":"10.1016/j.cub.2016.07.039"},{"reference":"Rutherford KM, Lera-Ramírez M, Wood V. 2024. PomBase: a Global Core Biodata Resource—growth, collaboration, and sustainability. GENETICS 227: 10.1093/genetics/iyae007.
","pubmedId":"","doi":"10.1093/genetics/iyae007"},{"reference":"Sydir EM, Farra MH, Whitford AL, Hinojosa S, Kao PY, Paulo JA, et al., Pellman. 2026. Components of an ESCRT-independent nuclear envelope assembly pathway. : 10.64898/2026.02.01.703137.
","pubmedId":"","doi":"10.64898/2026.02.01.703137"},{"reference":"Thaller DJ, Allegretti M, Borah S, Ronchi P, Beck M, Lusk CP. 2019. An ESCRT-LEM protein surveillance system is poised to directly monitor the nuclear envelope and nuclear transport system. eLife 8: 10.7554/elife.45284.
","pubmedId":"","doi":"10.7554/eLife.45284"},{"reference":"Vietri M, Schink KO, Campsteijn C, Wegner CS, Schultz SW, Christ L, et al., Stenmark. 2015. Spastin and ESCRT-III coordinate mitotic spindle disassembly and nuclear envelope sealing. Nature 522: 231-235.
","pubmedId":"","doi":"10.1038/nature14408"},{"reference":"von Appen A, LaJoie D, Johnson IE, Trnka MJ, Pick SM, Burlingame AL, Ullman KS, Frost A. 2020. LEM2 phase separation promotes ESCRT-mediated nuclear envelope reformation. Nature 582: 115-118.
","pubmedId":"","doi":"10.1038/s41586-020-2232-x"},{"reference":"Webster BM, Thaller DJ, Jäger J, Ochmann SE, Borah S, Lusk CP. 2016. Chm7 and Heh1 collaborate to link nuclear pore complex quality control with nuclear envelope sealing. The EMBO Journal 35: 2447-2467.
","pubmedId":"","doi":"10.15252/embj.201694574"},{"reference":"Wood V, Gwilliam R, Rajandream MA, Lyne M, Lyne R, Stewart A, et al., Nurse. 2002. The genome sequence of Schizosaccharomyces pombe. Nature 415: 871-880.
","pubmedId":"","doi":"10.1038/nature724"}],"title":"Cmp7-dependent recruitment of Alx1 to a mitotic nuclear envelope hole in Schizosaccharomyces pombe
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Pascal Curator Carme"},"openAcknowledgement":false,"submitted":null}]},{"id":"1194059e-5f5a-40f2-b3f0-d00f202616c0","decision":"publish","abstract":"The nuclear envelope maintains nucleocytoplasmic compartmentalization. Divergent strategies exist to accommodate the nuclear envelope during mitotic chromatin segregation. While the endosomal sorting complexes required for transport (ESCRT) machinery drives nuclear envelope remodeling during this process, recent work in Schizosaccharomyces japonicus suggests an ESCRT-independent pathway promoting nucleocytoplasmic compartmentalization mediated by Alx1. We investigate if this ESCRT-independent pathway is conserved in Schizosaccharomyces pombe. We find Alx1-GFP is recruited to a mitotic nuclear envelope hole in S. pombe, but that recruitment depends on the ESCRT machinery. Our data suggest diverse strategies of mitotic nuclear envelope remodeling necessitate varying strategies of promoting nucleocytoplasmic compartmentalization.
","acknowledgements":"The authors thank Ivan Surovtsev and William Chadwick for assistance with the Find_n_Fits_Spots script.
","authors":[{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","fundingAcquisition","investigation","writing_originalDraft","writing_reviewEditing"],"email":"K_PENA@uncg.edu","firstName":"Kaela D.","lastName":"Genereux","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0001-9398-7902"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"ONWALKER@uncg.edu","firstName":"Olivia N.","lastName":"Walker","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":"0009-0002-6328-9860"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","writing_reviewEditing"],"email":"SOBENDERS@uncg.edu","firstName":"Sage O.","lastName":"Benders","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-2948-6581"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["dataCuration","formalAnalysis","fundingAcquisition","investigation","software"],"email":"let@hpcacougars.org","firstName":"Thanh Truc","lastName":"Le","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-3923-8437"},{"affiliations":["University of North Carolina at Greensboro"],"departments":["Department of Biology"],"credit":["conceptualization","dataCuration","formalAnalysis","fundingAcquisition","investigation","methodology","project","resources","supervision","validation","writing_originalDraft","writing_reviewEditing"],"email":"nrader@uncg.edu","firstName":"Nicholas R.","lastName":"Ader","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7744-4484"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by UNC Greensboro through startup funds to N.R.A., a Munroe Grant to K.G. as well as an Undergraduate Research, Scholarship, and Creativity Award from the Undergraduate Research, Scholarship and Creativity Office to O.W. UNC Greensboro Department of Biology provided support through an Undergraduate Research Award to S.O.B. The Draelos Foundation provided support for T.T.L. and N.R.A.
","image":{"url":"https://portal.micropublication.org/uploads/0dbe89f5900b6ad9d8be45ff30845507.png"},"imageCaption":"A: Live-cell fluorescence micrographs of Alx1-GFP in S. pombe representative of cell populations at different stages of the cell cycle. For each subpanel: left, images of Alx1-GFP; middle, sum projection of mCherry-Atb2 (mitotic spindle) and Pcp1-mCherry (SPB); right, magnified views of region of interest (merge at the bottom). Top row shows wild type (WT) cells, and bottom row shows cmp7∆ cells. Scale bars, 1 µm (main images) and 500 nm (regions of interest).
B: Percentage of nuclei with Alx1-GFP co-localized with the SPB at the indicated phases of the cell cycle. Data for WT (gray) and cmp7Δ (teal) cells are shown. Points and error bars are the mean and range, respectively, from at least three biological replicates; ≥50 nuclei per replicate. Strains used in A and B are listed in Table 1: Alx1-GFP (NASP617; n = 268 nuclei); Alx1-GFP, cmp7∆ (NASP616; n = 423 nuclei).
C: Copy number of Alx1-GFP as a function of time in anaphase B. Black line represents a simple linear regression with the coefficient of determination (r2) indicated. Data from three biological replicates are shown, represented by different point shapes (triangle, circle, square) with at least 14 cells per biological replicate. Strains used are listed in Table 1: Alx1-GFP (NASP617; n = 106); Fta3-GFP (NASP56).
D: A model of Alx1 recruitment to the nuclear envelope in S. pombe, indicating dependence on Cmp7. Nucleoplasm, blue; cytoplasm, beige; spindle pole body (SPB), dark magenta; mitotic spindle, light magenta.
","imageTitle":"Alx1 is recruited to a mitotic nuclear envelope hole in a Cmp7-dependent manner
","methods":"S. pombe culture and strain construction. S. pombe strains were cultured as standard (Moreno et al., 1991), with all experiments performed in either agar plates or liquid culture of yeast extract supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (YE5S). The pFA6a-MX6-based drug-resistance cassettes were used for carboxy (C)-terminal tagging (Bähler et al., 1998; Hentges et al., 2005). A plasmid Editor (ApE) 2.0.61 was used for visualization and virtual manipulation of DNA sequences (Davis and Jorgensen, 2022), with S. pombe genome information accessed through PomBase (Carme et al., 2026). PCR of whole yeast (colony PCR) (Huxley et al., 1990) was used to confirm genomic integration following lithium acetate transformation (Murray et al., 2016). Monomeric enhanced GFP (mEGFP) used for strain creation throughoutwith a 3×HA linker; abbreviated as GFP in Figure and Description.
Live-cell fluorescence microscopy. Cells expressing fluorescently tagged proteins were cultured to logarithmic phase (OD600 0.4–0.8), concentrated by brief centrifugation, and mounted on 1.4% agarose in Edinburgh minimal medium supplemented with 250 mg/L adenine, histidine, leucine, uracil, and lysine hydrochloride (EMM5S) pad sandwiched with a no. 1.5 glass coverslip, a glass slide, and then sealed with VALAP (1:1:1, vaseline:lanonin:paraffin) for imaging. Live-cell fluorescence microscopy was performed using a Nikon microscope imaging system with an incubated stage (Oko Lab) set to 32˚C. An LED light source (Nikon, D-LEDI) was used for illumination. For GFP: 475 nm excitation with a FITC filter cube (excitation 465–495 nm, emission 515–555 nm, long pass 505 nm). For mCherry: 550 nm excitation with an mCherry filter set (excitation 540–580, emission 593–667 nm, long pass 585 nm). Channels were acquired sequentially on an ORCA-Fusion BT Digital CMOS camera (Hamamatsu C15440-20UP) using a Plan Apo Lambda D 100× oil objective with a numerical aperture of 1.45. Z-stacks spanning the nuclear envelope region (~3.5–4.8 µm) were acquired every 200 nm to visualize Alx1-GFP localization at the mitotic nuclear envelope. Widefield images were deconvolved in NIS-Elements using a Richardson-Lucy method. Cells were classified into phases as previously published using mCherry-Atb2 (Ader et al., 2023). All Alx1-GFP images are shown at equivalent display range, set to maximize display range for Alx1-GFP image shown in WT anaphase B (Fig. 1A). For images in the mCherry channel (mCherry-Atb2 and Pcp1-mCherry), the gamma has been adjusted to 0.05 to allow both fluorophores to be displayed without pixel saturation. mCherry images were manually adjusted to to maximize display range for each image. Figures were designed and prepared using Prism, Adobe Illustrator 2026, and Fiji.
Quantification of the average copy number of Alx1 subunits. Cells were prepared for imaging by overnight culture as described in live-cell fluorescence microscopy. Cells (NASP56) expressing Fta3-GFP were mounted on the same pad as Alx1-GFP cells and imaged as above. Raw images were analyzed using a custom MATLAB script, ‘Find_n_Fit_Spots' (https://github.com/LusKingLab/Find_n_Fit_Spots_3D) as previously described (Ader et al., 2023).
","reagents":"Table 1. List of S. pombe strains used in this study. | ||
|---|---|---|
Strain (NASP) | Genotype | Origin |
56 | fta3::fta3-mEGFP:kanMX6 | leu1-32 | ura4-D18 | ade6-M210 | h+ | Ader et al., 2023 |
616 | alx1::alx1-3xHA-mEGFP:kanMX6 | cmp7::hygMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
617 | alx1::alx1-3xHA-mEGFP:kanMX6 | pcp1::pcp1-mCherry:natMX6 | aurR-pnda3-mCherry-atb2 | leu1-32 | ura4-D18 | This work |
Table 2. List of primers used in this study. | |
|---|---|
Primer Name | Sequence |
prNA253_alx1_L3 | GCTTTAGAGAAGCTGTTGATGCCAAG |
prNA254_alx1_L4 | ttaattaacccggggatccgTTTTTTTGACGATTTAAACTTGATTTTATGGATTTCAGG |
prNA255_alx1_L5 | gtttaaacgagctcgaattcGATTATCATATGTGATCATATAGTATTAAATCCGCATACA |
prNA256_alx1_L6 | AAATGCTTCAACGGTGTGGATGG |
Table 3. Plasmids used in this study. | |||
|---|---|---|---|
Identifier | Name/Description | Usage | Origin |
pNA8 | pNA8_pFA6a-3xHA-mEGFP-KanMX6 | Template for PCR based chromosomal integration of 3×HA-mEGFP ORF | Ader et al., 2023 |
The nuclear envelope is critical for maintenance of nucleocytoplasmic compartmentalization. However, nuclear division in many species necessitates a transient disruption of the nuclear envelope to accommodate chromatin segregation by cytoplasmic machinery. At the resolution of nuclear division, holes in the reforming nuclear envelope are sealed by the endosomal sorting complexes required for transport (ESCRT) machinery (Gu et al., 2017; Olmos et al., 2015; Vietri et al., 2015).
The ESCRT machinery remodels membranes across the cell through a group of filament-forming subunits, ESCRT-IIIs, which are canonically targeted to specific membranes by the ESCRT-I/II family of proteins (Burigotto and Carlton, 2025). However, non-canonical recruitment of ESCRT-IIIs by alternative, membrane-specific proteins is also possible. For example, at the nuclear envelope, the unique ESCRT-II/III hybrid protein, Cmp7, recruits ESCRT-III proteins to facilitate nuclear envelope sealing independent of ESCRT-I/IIs via binding to the integral inner nuclear membrane protein Heh1/Lem2 (LEMD2 in Homo sapiens; Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; von Appen et al., 2020; Webster et al., 2016).
Recently, the ESCRT-associated protein, Alx1, has been suggested to play an ESCRT-independent role in the mitotic nuclear envelope sealing of Schizosaccharomyces japonicus. While the precise mechanism of this ESCRT-independent pathway remains to be elucidated, it appears to strongly depend on the role of Alx1 (Lee et al., 2020; Sydir et al., 2026). To determine if the presence of an ESCRT-independent nuclear envelope remodeling pathway was conserved across species, we sought to investigate Alx1 involvement in nuclear envelope remodeling in the related fission yeast, Schizosaccharomyces pombe. Notably, while closely related to S. japonicus, S. pombe employ more conservative nuclear envelope remodeling during mitosis, simply transiently inserting their microtubule organizing center, the spindle pole body (SPB), into their nuclear envelope to nucleate a mitotic spindle (Ding et al., 1997). Unlike S. japonicus, S. pombe maintain nucleocytoplasmic compartmentation during mitosis (Arai et al., 2010; Asakawa et al., 2010).
To investigate a potential ESCRT-independent role of Alx1 in mitotic nuclear envelope remodeling in S. pombe, we performed live-cell fluorescence microscopy of cells endogenously expressing Alx1-GFP. Unlike core ESCRT-III proteins previously observed by live-cell fluorescence microscopy (Ader et al., 2023), we observed no Alx1-GFP puncta in interphase cells, suggesting that Alx1 is not involved in the formation of intraendosomal vesicles (Fig. 1A). Conversely, when we examined mitotic cells, we observed robust Alx1-GFP recruitment to the site of a mitotic nuclear envelope hole, visualized as co-localization of Alx1-GFP and a SPB protein (Pcp1-mCherry) (Fig. 1A, B). Notably, we did not observe recruitment of Alx1-GFP to a mitotic “tail” of the nuclear envelope as in S. japonicus (Lee et al., 2020). Thus, while Alx1 appears to perform a mitotic role at a nuclear envelope hole in S. pombe, as in S. japonicus, this function appears to be restricted to the mitotic nuclear envelope hole created by the SPB.
While the molecular architecture of in vivo ESCRT assembly remains enigmatic, previous work has sought to determine an absolute number of ESCRT subunits and their stoichiometry at sites of both intraendosomal vesicle formation (Adell et al., 2017) and nuclear envelope constriction/sealing (Ader et al., 2023). Hence, we calculated the absolute number of Alx1-GFP molecules at a nuclear envelope hole throughout mitosis using the kinetochore protein Fta3 as a molecular standard (Ader et al., 2023; Lawrimore et al., 2011). We determined this nuclear envelope hole contains an average of 83 ± 11 molecules of Alx1-GFP and that this level remains relatively constant over the course of anaphase B (Fig. 1C). Thus, while the precise role of Alx1 at a nuclear envelope hole remains to be determined, Alx1 appears to be present in an approximate 1:1 stoichiometry with the mitotically recruited ESCRT-III subunit Vps32 (72 molecules; CHMP4 in Homo sapiens; Snf7 in Saccharomyces cerevisiae) and in higher abundance compared to Cmp7 (15 molecules) and Ist1 (30 molecules) (Ader et al., 2023).
We next sought to determine if the presence of Alx1 at a mitotic nuclear envelope hole was consistent with an ESCRT-independent pathway. As all previously observed ESCRT-III recruitment to the nuclear envelope depends on Cmp7 (Ader et al., 2023; Gu et al., 2017; Olmos et al., 2016; Thaller et al., 2019; Vietri et al., 2015), recruitment of Alx1-GFP to a mitotic nuclear envelope hole in cells lacking cmp7 would suggest an ESCRT-independent role for Alx1. However, we observed that Alx1-GFP recruitment to a mitotic nuclear envelope hole was completely abolished in cmp7∆ cells (Fig. 1A, B). This suggests that in S. pombe, unlike S. japonicus, the contribution of Alx1 to membrane remodeling of a mitotic nuclear envelope hole is ESCRT-dependent (Fig. 1D).
Taken together, our data suggest that even closely related organisms may employ significantly different strategies for nuclear division. While it is tempting to speculate that the presence of an ESCRT-independent pathway for post-mitotic nuclear envelope sealing in S. japonicus may be a consequence of this yeast's more “open” mitosis compared to S. pombe, further work across more diverse species is needed.
","references":[{"reference":"Adell MAY, Migliano SM, Upadhyayula S, Bykov YS, Sprenger S, Pakdel M, et al., Teis. 2017. Recruitment dynamics of ESCRT-III and Vps4 to endosomes and implications for reverse membrane budding. eLife 6: 10.7554/elife.31652.
","pubmedId":"","doi":"10.7554/eLife.31652"},{"reference":"Ader NR, Chen L, Surovtsev IV, Chadwick WL, Rodriguez EC, King MC, Lusk CP. 2023. An ESCRT grommet cooperates with a diffusion barrier to maintain nuclear integrity. Nature Cell Biology 25: 1465-1477.
","pubmedId":"","doi":"10.1038/s41556-023-01235-4"},{"reference":"Arai K, Sato M, Tanaka K, Yamamoto M. 2010. Nuclear Compartmentalization Is Abolished during Fission Yeast Meiosis. Current Biology 20: 1913-1918.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.004"},{"reference":"Asakawa H, Kojidani T, Mori C, Osakada H, Sato M, Ding DQ, Hiraoka Y, Haraguchi T. 2010. Virtual Breakdown of the Nuclear Envelope in Fission Yeast Meiosis. Current Biology 20: 1919-1925.
","pubmedId":"","doi":"10.1016/j.cub.2010.09.070"},{"reference":"Bähler Jr, Wu JQ, Longtine MS, Shah NG, Mckenzie III A, Steever AB, et al., Pringle. 1998. Heterologous modules for efficient and versatile PCR-based gene targeting inSchizosaccharomyces pombe. Yeast 14: 943-951.
","pubmedId":"","doi":"10.1002/(sici)1097-0061(199807)14:10<943::Aid-yea292>3.0.Co;2-y"},{"reference":"Burigotto M, Carlton JG. 2025. ESCRT-III function in membrane fission and repair. Nature Reviews Molecular Cell Biology 27: 297-315.
","pubmedId":"","doi":"10.1038/s41580-025-00909-1"},{"reference":"Carme P, Rutherford K, Bähler Jr, Mata J, Wood V. 2026. PomBase in 2026: expanding knowledge, modeling connections. GENETICS 232: 10.1093/genetics/iyag001.
","pubmedId":"","doi":"10.1093/genetics/iyag001"},{"reference":"Davis MW, Jorgensen EM. 2022. ApE, A Plasmid Editor: A Freely Available DNA Manipulation and Visualization Program. Frontiers in Bioinformatics 2: 10.3389/fbinf.2022.818619.
","pubmedId":"","doi":"10.3389/fbinf.2022.818619"},{"reference":"Ding R, West RR, Morphew DM, Oakley BR, McIntosh JR. 1997. The spindle pole body of Schizosaccharomyces pombe enters and leaves the nuclear envelope as the cell cycle proceeds. Molecular Biology of the Cell 8: 1461-1479.
","pubmedId":"","doi":"10.1091/mbc.8.8.1461"},{"reference":"Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, et al., Frost. 2017. LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Proceedings of the National Academy of Sciences 114: 10.1073/pnas.1613916114.
","pubmedId":"","doi":"10.1073/pnas.1613916114"},{"reference":"Hentges P, Van Driessche B, Tafforeau L, Vandenhaute J, Carr AM. 2005. Three novel antibiotic marker cassettes for gene disruption and marker switching inSchizosaccharomyces pombe. Yeast 22: 1013-1019.
","pubmedId":"","doi":"10.1002/yea.1291"},{"reference":"Huxley C, Green ED, Dunbam I. 1990. Rapid assessment of S. cerevisiae mating type by PCR. Trends in Genetics 6: 236.
","pubmedId":"","doi":"10.1016/0168-9525(90)90190-h"},{"reference":"Lawrimore J, Bloom KS, Salmon ED. 2011. Point centromeres contain more than a single centromere-specific Cse4 (CENP-A) nucleosome. Journal of Cell Biology 195: 573-582.
","pubmedId":"","doi":"10.1083/jcb.201106036"},{"reference":"Lee IJ, Stokasimov E, Dempsey N, Varberg JM, Jacob E, Jaspersen SL, Pellman D. 2020. Factors promoting nuclear envelope assembly independent of the canonical ESCRT pathway. Journal of Cell Biology 219: 10.1083/jcb.201908232.
","pubmedId":"","doi":"10.1083/jcb.201908232"},{"reference":"Moreno S, Klar A, Nurse P. 1991. [56] Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods in Enzymology,Guide to Yeast Genetics and Molecular Biology : 795-823.
","pubmedId":"","doi":"10.1016/0076-6879(91)94059-l"},{"reference":"Murray JM, Watson AT, Carr AM. 2016. Transformation of Schizosaccharomyces pombe: Lithium Acetate/ Dimethyl Sulfoxide Procedure. Cold Spring Harbor Protocols 2016: pdb.prot090969.
","pubmedId":"","doi":"10.1101/pdb.prot090969"},{"reference":"Olmos Y, Hodgson L, Mantell J, Verkade P, Carlton JG. 2015. ESCRT-III controls nuclear envelope reformation. Nature 522: 236-239.
","pubmedId":"","doi":"10.1038/nature14503"},{"reference":"Olmos Y, Perdrix-Rosell A, Carlton JG. 2016. Membrane Binding by CHMP7 Coordinates ESCRT-III-Dependent Nuclear Envelope Reformation. Current Biology 26: 2635-2641.
","pubmedId":"","doi":"10.1016/j.cub.2016.07.039"},{"reference":"Sydir EM, Farra MH, Whitford AL, Hinojosa S, Kao PY, Paulo JA, et al., Pellman. 2026. Components of an ESCRT-independent nuclear envelope assembly pathway. : 10.64898/2026.02.01.703137.
","pubmedId":"","doi":"10.64898/2026.02.01.703137"},{"reference":"Thaller DJ, Allegretti M, Borah S, Ronchi P, Beck M, Lusk CP. 2019. An ESCRT-LEM protein surveillance system is poised to directly monitor the nuclear envelope and nuclear transport system. eLife 8: 10.7554/elife.45284.
","pubmedId":"","doi":"10.7554/eLife.45284"},{"reference":"Vietri M, Schink KO, Campsteijn C, Wegner CS, Schultz SW, Christ L, et al., Stenmark. 2015. Spastin and ESCRT-III coordinate mitotic spindle disassembly and nuclear envelope sealing. Nature 522: 231-235.
","pubmedId":"","doi":"10.1038/nature14408"},{"reference":"von Appen A, LaJoie D, Johnson IE, Trnka MJ, Pick SM, Burlingame AL, Ullman KS, Frost A. 2020. LEM2 phase separation promotes ESCRT-mediated nuclear envelope reformation. Nature 582: 115-118.
","pubmedId":"","doi":"10.1038/s41586-020-2232-x"},{"reference":"Webster BM, Thaller DJ, Jäger J, Ochmann SE, Borah S, Lusk CP. 2016. Chm7 and Heh1 collaborate to link nuclear pore complex quality control with nuclear envelope sealing. The EMBO Journal 35: 2447-2467.
","pubmedId":"","doi":"10.15252/embj.201694574"}],"title":"Cmp7-dependent recruitment of Alx1 to a mitotic nuclear envelope hole in Schizosaccharomyces pombe
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Pascal Curator Carme"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"f6c1f3d5-a670-4fd3-bffd-910bb3672576","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}