Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. The products of autophagic degradation may be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions. However, the role of nucleolar proteins in autophagy remains largely unexplored. Here we identify Ribosomal RNA processing 8 (Rrp8) as a positive regulator of autophagy flux in the yeast Saccharomyces cerevisiae. Our work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation.
","acknowledgements":"","authors":[{"affiliations":["Oakland University, Rochester, MI, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","investigation","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"sbadenahallinar@oakland.edu","firstName":"Swaroopa","lastName":"Badenahalli Narasimhaiah","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Oakland University, Rochester, MI, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","dataCuration","formalAnalysis","fundingAcquisition","investigation","methodology","project","resources","supervision","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"delormeaxford@oakland.edu","firstName":"Elizabeth","lastName":"Delorme-Axford","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"https://orcid.org/0000-0002-7455-7616"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by grant funding from PCR Biosystems and Oakland University (OU) startup funds (to EDA). SBN was supported by a graduate teaching assistantship obtained through the OU Department of Biological Sciences. EDA is supported by funding from the National Institute of General Medical Sciences R15GM159346.
","image":{"url":"https://portal.micropublication.org/uploads/65f7450c99c25849abb78802fa212ce5.png"},"imageCaption":"WT (JMY347), atg13Δ (EDA328), and rrp8Δ (SBN08) strains were grown to mid-log phase in YPD (+N), then starved for nitrogen (-N) in SD-N medium for 4 h. Pho8Δ60 activity was measured and normalized to the activity of starved WT cells, which was set at 100%. (B) WT (EDA291) and rrp8Δ (SBN03) strains expressing GFP-Atg8 were grown in nutrient-rich media, and then starved for nitrogen as indicated. Protein extracts were analyzed by SDS-PAGE and blotted using an antibody that recognizes GFP. GAPDH is the loading control. A representative blot is shown (n=3). (C) Densitometry of blots represented in (B). Processed GFP-Atg8 was calculated by determining the ratio of free GFP: total GFP (sum of free GFP and full-length GFP-Atg8). Results shown are relative to the WT strain during starvation (2 h SD-N), which was set to 1 (n=3). (D) Loss of RRP8 decreases cell survival after prolonged nitrogen starvation. WT (BY4742) and rrp8∆ cells were grown in nutrient-rich YPD medium (+N) until mid-log phase and then starved for nitrogen for 7 days (–N). Cells were serially diluted and spotted onto YPD plates, incubated for 2 days, and imaged. The image shown is representative of n=4 independent experiments. (E) RRP8 expression decreases during nitrogen starvation. WT (BY4741) cells were grown to mid-log phase in YPD (+N) and then shifted to nitrogen starved (-N) media for 1 hour. Total RNA was extracted, and RT-qPCR was performed. Results shown are relative to the level of expression in WT cells under rich conditions, which was set to 1 (n=3). (F) Rrp8-PA fusion protein levels decrease with nitrogen starvation. WT (SBN15) cells endogenously expressing Rrp8-PA fusion protein were grown to mid-log phase in YPD then starved for nitrogen for the time points indicated. Protein extracts were resolved by SDS-PAGE and blotted with anti-PA or anti-GAPDH (loading control) antibodies. A representative blot is shown (n=4). (G) Densitometry of blots represented in (F). The percentage of Rrp8-PA:GAPDH was quantified. (H) Loss of SFP1 decreases Rrp8-PA fusion protein levels. WT (SBN15) and sfp1Δ (SBN21) endogenously expressing Rrp8-PA were grown to mid-log phase in YPD (+N) starved for nitrogen for 2 h (-N). Protein extracts were analyzed as in (F). A representative blot is shown (n=3). (I) Densitometry of blots represented in (H). The percentage of Rrp8-PA:GAPDH was quantified. For (A), (C), (E), (G), and (I), results shown are the mean. Error bars indicate standard deviation.
","imageTitle":"Rrp8 positively regulates autophagy flux
","methods":"Yeast Strains, Media, and Cell Culture: Saccharomyces cerevisiae yeast strains used in this study are listed in the accompanying table. Yeast cells were grown in YPD (1% yeast extract, 2% peptone, and 2% glucose) medium (Gibco, A1374501). To induce autophagy, cells were grown to mid-log phase in YPD, then shifted to nitrogen starvation medium (SD-N; 0.17% yeast nitrogen base without ammonium sulfate or amino acids and 2% glucose) for the indicated time points. Chromosome tagging and gene deletions were performed using established methods (Gueldener et al., 2002; Longtine et al., 1998).
Pho8Δ60 Assay: The Pho8Δ60 assay was performed using the SmartReader 96 microplate absorbance reader (Accuris, MR9600) as previously described (Tasmi et al., 2026). Pho8Δ60 values were normalized to the protein content of each sample determined by the Pierce BCA Protein Assay kit (Thermo Scientific, 23227) as described (Delorme-Axford et al., 2023).
SDS-PAGE and Western Blots: SDS-PAGE and western blots were performed as previously described (Tasmi et al., 2026). Western blots were visualized using the Azure 600 (Azure Biosystems) or iBright CL1500 (Invitrogen) imaging systems. Densitometry for western blots was performed using ImageJ (https://imagej.nih.gov/ij/). Antibodies used in this study are included in the accompanying table.
Yeast Viability Assay: Yeast growth assays were performed as previously described (Avogo et al., 2025).
RNA and Real-Time Quantitative PCR (RT-qPCR): RNA extraction and RT-qPCR was performed as previously described (Avogo et al., 2025). Relative gene expression was calculated using the 2−ΔΔCT method (Livak and Schmittgen 2001), normalized to UBC6 levels. RT-qPCR primers used in this study are listed in the accompanying table.
Statistical analysis: The two-tailed unpaired t test was used to determine statistical significance with GraphPad Prism (GraphPad Software, USA). For all figures, p values are as follows: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns indicates not significant. A p value < 0.05 was considered significant.
","reagents":"Saccharomyces cerevisiae strains used in this study are as follows: | ||
Strains | Genotype | Reference |
BY4741 | MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 | Horizon Discovery |
BY4742 | MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 | Horizon Discovery |
BY4742, rrp8Δ::KANMX | BY4742, rrp8Δ::KANMX | Horizon Discovery |
EDA291 | WLY176, CUP1p-GFP-ATG8(405)::LEU2 | This study |
EDA328 | JMY347, atg13Δ::HIS5 | (Tasmi et al., 2026) |
JMY347 | SEY6210, pho13Δ ZEO1p-pho8Δ60, CUP1p-GFP-ATG8(405)::LEU2 | (Wen et al., 2020) |
SBN03 | EDA291, rrp8Δ::URA3 | This study |
SBN08 | JMY347, rrp8Δ::HIS5 | This study |
SBN15 | BY4742, RRP8-PA::HIS3 | This study |
SBN21 | SBN15, sfp1Δ::URA3 | This study |
SEY6210 | MATα leu2-3,112 ura3-52 his3-Δ200 trp1-Δ901 suc2-Δ9 lys2-801; GAL | (Robinson et al., 1988) |
WLY176 | SEY6210, pho13∆ pho8::pho8∆60 | (Kanki et al., 2009) |
YAB369 | YTS158, atg8Δ::HIS5 | (Delorme-Axford et al., 2018) |
YTS158 | BY4742, pho13Δ::KANMX pho8::pho8Δ60 | (He et al., 2006) |
RT-qPCR primer sequences used in this study are as follows: | ||
Primer | Sequence (5' to 3') | Reference |
1-RRP8-qPCR-F | ACGCTTTGAAGCTGATGGGA | This study |
1-RRP8-qPCR-R | TAATCTCCGCAGGTGGCTTG | This study |
2-RRP8-qPCR-F | TTTAGCGCCAAGGGGTGAAT | This study |
2-RRP8-qPCR-R | CCCATCAGCTTCAAAGCGTC | This study |
SLD3-qPCR-F | CGCAACTTCAAAGCATCATTGAATCGC | (Bernard, Jin, Xu, et al., 2015) |
SLD3-qPCR-R | GGGGCTTATTAGTGGGAGTAGAGG | (Bernard, Jin, Xu, et al., 2015) |
UBC6-qPCR-F | GATACTTGGAATCCTGGCTGGTCTGTCTC | (Teste et al., 2009) |
UBC6-qPCR-R | AAAGGGTCTTCTGTTTCATCACCTGTATTTGC | (Teste et al., 2009) |
Antibodies used in this study are as follows: | ||
Name | Identifier (Source) | Concentration |
mouse monoclonal anti-GAPDH (1E6D9) | Cat# 60004-1-Ig (Proteintech) | 1:20,000 |
mouse monoclonal anti-GFP (JL-8) | 632381 (Clontech) | 1:3,000 |
rabbit polyclonal anti-peroxidase (anti-PA) antibody | 323-005-024 (Jackson Immunoresearch) | 1:30,000 |
mouse monoclonal anti-Pgk1 (22C5D8) | Cat# 459250 (Invitrogen) | 1:5,000 |
Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. Nonselective autophagy targets bulk cytoplasm; whereas selective forms of autophagy target specific intracellular cargo. Basal autophagy is low, but is markedly upregulated during stressful conditions such as nutrient deprivation. Canonically, autophagy is a catabolic process, breaking down cytoplasmic cargo within the vacuole (in yeast) to maintain cell survival. The autophagic cargo are degraded, and the resulting biomolecules are transported to the cytosol for reuse. The effluxed bioproducts of autophagic degradation can be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions.
The goal of this study was to investigate the role of the budding yeast Saccharomyces cerevisiae ribosomal RNA processing 8 (Rrp8) protein in autophagy. Rrp8 is a S-adenosylmethionine-dependent methyltransferase (Bousquet-Antonelli et al., 2000). Rrp8 methylates m1A645 of 25S rRNA (Peifer et al., 2013). The N1-methyladenosine (m1A) modification is important for regulating gene expression (Li et al., 2022). m1A is a reversible modification in tRNA, mRNA, rRNA and long non-coding RNA (lncRNA) and has impacts on RNA processing, structure, and functions of targets (Li et al., 2022). Nucleomethylin (the mammalian homolog of yeast Rrp8) is associated with metabolic disease, obesity, and nutrient availability signaling (Oie et al., 2014; Sharma et al., 2018). Additionally, there is a gap in our understanding of how autophagy contributes to cellular metabolism, and in return, how metabolism impacts autophagy activity.
Given the relationship between nucleomethylin and nutrient availability signaling, we examined whether Rrp8 (the yeast homolog of nucleomethylin) plays a role in autophagy in Saccharomyces cerevisiae. To the best of our knowledge, whether Rrp8 has any impact on autophagy– in any model system– has never been explored. We first investigated whether autophagy was affected in cells lacking RRP8 by performing the alkaline phosphatase (ALP) or Pho8Δ60 assay (Figure 1A). The ALP assay is a quantitative enzymatic measurement of autophagy (Noda & Klionsky, 2008), although some minimal degree of basal phosphatase activity is observed in cells under nutrient-rich conditions (Delorme-Axford et al., 2018). As expected, when cells were starved for nitrogen (4 h), robust autophagy activity is observed in the wild-type (WT) strain and little activity in the negative control atg13∆ strain (~35%; Figure 1A). Atg13 is essential for autophagy in yeast (Tsukada & Ohsumi, 1993). Pho8Δ60 activity is reduced in the rrp8∆ strain compared to WT (~63%; Figure 1A), supporting that autophagy flux decreases in cells lacking RRP8.
Based on these results, we next examined whether autophagy was impaired in rrp8Δ cells by performing the GFP-Atg8 processing assay (Figure 1B, C). The GFP-Atg8 assay is a method to monitor bulk autophagy progression based on the release of free GFP. Following autophagosome-vacuole fusion, Atg8 is rapidly hydrolyzed; the GFP moiety remains relatively stable within the vacuole (Cheong & Klionsky, 2008). The release of free GFP from the GFP-Atg8 fusion protein indicates autophagy flux following autophagosome-vacuole fusion (Delorme-Axford et al., 2015). Consistent with our Pho8Δ60 assay results (Figure 1A), we observed a significant decrease of free GFP release in the rrp8Δ cells compared to the WT at 1 and 2 h of nitrogen starvation (Figure 1B, C). To determine whether loss of RRP8 impacts cell survival, we examined WT and rrp8∆ cells under nutrient-rich and prolonged nitrogen starvation conditions (Figure 1D). Following 7 days of nitrogen starvation, rrp8Δ cells showed reduced survival compared to WT, suggesting that Rrp8 may play an important role in mediating cell survival under nutrient-stress conditions (Figure 1D). This is consistent with previous observations that cells deficient in autophagy display reduced viability under prolonged starvation (Bernard, Jin, González-Rodríguez, et al., 2015; Tsukada & Ohsumi, 1993). Taken together, these data support the idea that Rrp8 is a positive regulator of autophagy flux when cells are starved for nitrogen (Figure 1A–D).
To determine whether RRP8 expression changes during autophagy-inducing conditions, we assessed RRP8 mRNA levels using RT-qPCR (Figure 1E). Two pairs of independent primers (1-RRP8 and 2-RRP8) were used to ensure reliability (Figure 1E). Following nitrogen starvation, RRP8 expression markedly declines (Figure 1E). As a control, SLD3 (a gene with no known connection to autophagy) was also analyzed (Figure 1E). As expected, SLD3 expression did significantly change between nutrient-rich and starvation conditions (Figure 1E). To monitor Rrp8 protein levels, RRP8 was chromosomally tagged at the C-terminus with Protein A (PA), allowing detection of endogenous Rrp8-PA fusion protein during a time course of nitrogen starvation (0, 1, 2, and 3 h; Figure 1F, 1G). Western blot analysis revealed a noticeable decrease in Rrp8-PA protein levels during nitrogen starvation compared to nutrient-rich conditions, suggesting that Rrp8 is downregulated during nutrient stress (~50% by 3 h; Figure 1F, 1G).
The split-finger protein 1 (Sfp1) is a nutrient and stress sensitive transcription factor (Albert et al., 2019). Sfp1 is an activator of ribosomal protein and ribosome biogenesis gene transcription in yeast (Marion et al., 2004). Sfp1 is phosphorylated by the Target of Rapamycin Complex 1 (TORC1) kinase at multiple sites (Lempiäinen et al., 2009). Tor kinase is a negative regulator of autophagy (Noda & Ohsumi, 1998). Rapamycin treatment strongly inhibits the TORC1-Sfp1 interaction, leading to Sfp1 dephosphorylation (Lempiäinen et al., 2009). Rapamycin inhibits Tor, thereby activating autophagy (reviewed in (Delorme-Axford et al., 2015)). In addition, prior work by others suggests that Sfp1 may be a potential transcriptional activator of RRP8 (Cipollina et al., 2008). To investigate whether Sfp1 regulates RRP8, we compared Rrp8-PA fusion protein levels in WT and sfp1Δ cells by western blot analysis (Figure 1H, 1I). Under nutrient-rich conditions (+N), Rrp8-PA is well expressed in WT cells and decreases when cells are starved for nitrogen (-N; Figure 1H, 1I). In contrast, Rrp8-PA levels were reduced in sfp1Δ cells relative to WT under both nutrient-rich and starved conditions (Figure 1H, 1I). Taken together, these data suggest that Sfp1 may function as a positive regulator of Rrp8.
Here we characterize the yeast methyltransferase Rrp8 as a positive regulator of autophagy flux. We also found that loss of TORC1-regulated transcription factor SFP1 decreases Rrp8 levels under nutrient-rich and starved conditions, suggesting that Sfp1 may regulate Rrp8 expression. This work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation. Further elucidation of these mechanisms will advance our understanding of the molecular crosstalk between ribosome biogenesis, metabolism and autophagy.
","references":[{"reference":"Albert B, Tomassetti S, Gloor Y, Dilg D, Mattarocci S, Kubik S, Hafner L, Shore D. 2019. Sfp1 regulates transcriptional networks driving cell growth and division through multiple promoter-binding modes. Genes & Development 33: 288-293.
","pubmedId":"","doi":"10.1101/gad.322040.118"},{"reference":"Avogo EW, Burlingame NA, Badenahalli Narasimhaiah S, Delorme-Axford E. 2025. Bioinformatics analysis identifies Mot2 protein as a potential regulator of autophagy in Saccharomyces cerevisiae. MicroPubl Biol.
","pubmedId":"","doi":" 10.17912/micropub.biology.001698"},{"reference":"Bernard Al, Jin M, González-Rodríguez P, Füllgrabe J, Delorme-Axford E, Backues SK, Joseph B, Klionsky DJ. 2015. Rph1/KDM4 Mediates Nutrient-Limitation Signaling that Leads to the Transcriptional Induction of Autophagy. Current Biology 25: 546-555.
","pubmedId":"","doi":"10.1016/j.cub.2014.12.049"},{"reference":"Bernard Al, Jin M, Xu Z, Klionsky DJ. 2015. A large-scale analysis of autophagy-related gene expression identifies new regulators of autophagy. Autophagy 11: 2114-2122.
","pubmedId":"","doi":"10.1080/15548627.2015.1099796"},{"reference":"Bousquet-Antonelli C, Vanrobays E, Gélugne JP, Caizergues-Ferrer M, Henry Y. 2000. Rrp8p is a yeast nucleolar protein functionally linked to Gar1p and involved in pre-rRNA cleavage at site A2. RNA 6: 826-843.
","pubmedId":"","doi":" 10.1017/s1355838200992288"},{"reference":"Cheong H, Klionsky DJ. 2008. Chapter 1 Biochemical Methods to Monitor Autophagy‐Related Processes in Yeast. Methods in Enzymology,Autophagy: Lower Eukaryotes and Non-Mammalian Systems, Part A : 1-26.
","pubmedId":"","doi":"10.1016/s0076-6879(08)03201-1"},{"reference":"Cipollina C, van den Brink J, Daran-Lapujade P, Pronk JT, Porro D, de Winde JH. 2008. Saccharomyces cerevisiae SFP1: at the crossroads of central metabolism and ribosome biogenesis. Microbiology 154: 1686-1699.
","pubmedId":"","doi":"10.1099/mic.0.2008/017392-0"},{"reference":"Delorme-Axford E, Abernathy E, Lennemann NJ, Bernard Al, Ariosa A, Coyne CB, Kirkegaard K, Klionsky DJ. 2018. The exoribonuclease Xrn1 is a post-transcriptional negative regulator of autophagy. Autophagy 14: 898-912.
","pubmedId":"","doi":"10.1080/15548627.2018.1441648"},{"reference":"Delorme-Axford E, Guimaraes RS, Reggiori F, Klionsky DJ. 2015. The yeast Saccharomyces cerevisiae: An overview of methods to study autophagy progression. Methods 75: 3-12.
","pubmedId":"","doi":"10.1016/j.ymeth.2014.12.008"},{"reference":"Delorme-Axford E, Wen X, Klionsky DJ. 2023. The yeast transcription factor Stb5 acts as a negative regulator of autophagy by modulating cellular metabolism. Autophagy 19: 2719-2732.
","pubmedId":"","doi":"10.1080/15548627.2023.2228533"},{"reference":"Gueldener U, Heinisch J, Koehler GJ, Voss D, Hegemann JH. 2002. A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Research 30: 23e-23.
","pubmedId":"","doi":" 10.1093/nar/30.6.e23 "},{"reference":"He C, Song H, Yorimitsu T, Monastyrska I, Yen WL, Legakis JE, Klionsky DJ. 2006. Recruitment of Atg9 to the preautophagosomal structure by Atg11 is essential for selective autophagy in budding yeast. The Journal of Cell Biology 175: 925-935.
","pubmedId":"","doi":"10.1083/jcb.200606084"},{"reference":"Kanki T, Wang K, Baba M, Bartholomew CR, Lynch-Day MA, Du Z, et al., Klionsky DJ. 2009. A Genomic Screen for Yeast Mutants Defective in Selective Mitochondria Autophagy. Molecular Biology of the Cell 20: 4730-4738.
","pubmedId":"","doi":"10.1091/mbc.E09-03-0225"},{"reference":"Lempiäinen H, Uotila A, Urban Jr, Dohnal I, Ammerer G, Loewith R, Shore D. 2009. Sfp1 Interaction with TORC1 and Mrs6 Reveals Feedback Regulation on TOR Signaling. Molecular Cell 33: 704-716.
","pubmedId":"","doi":"10.1016/j.molcel.2009.01.034"},{"reference":"Li J, Zhang H, Wang H. 2022. N\n 1\n -methyladenosine modification in cancer biology: Current status and future perspectives. Computational and Structural Biotechnology Journal 20: 6578-6585.
","pubmedId":"","doi":"10.1016/j.csbj.2022.11.045"},{"reference":"Longtine MS, Mckenzie III A, Demarini DJ, Shah NG, Wach A, Brachat A, Philippsen P, Pringle JR. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14: 953-961.
","pubmedId":"","doi":"10.1002/(sici)1097-0061(199807)14:10%3C953::aid-yea293%3E3.0.co;2-u"},{"reference":"Marion RM, Regev A, Segal E, Barash Y, Koller D, Friedman N, O'Shea EK. 2004. Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene expression. Proceedings of the National Academy of Sciences 101: 14315-14322.
","pubmedId":"","doi":"10.1073/pnas.0405353101"},{"reference":"Noda T, Klionsky DJ. 2008. Chapter 3 The Quantitative Pho8Δ60 Assay of Nonspecific Autophagy. Methods in Enzymology,Autophagy: Lower Eukaryotes and Non-Mammalian Systems, Part A : 33-42.
","pubmedId":"","doi":"10.1016/s0076-6879(08)03203-5"},{"reference":"Noda T, Ohsumi Y. 1998. Tor, a Phosphatidylinositol Kinase Homologue, Controls Autophagy in Yeast. Journal of Biological Chemistry 273: 3963-3966.
","pubmedId":"","doi":"10.1074/jbc.273.7.3963"},{"reference":"Oie S, Matsuzaki K, Yokoyama W, Tokunaga S, Waku T, Han SI, et al., Murayama A. 2014. Hepatic rRNA Transcription Regulates High-Fat-Diet-Induced Obesity. Cell Reports 7: 807-820.
","pubmedId":"","doi":"10.1016/j.celrep.2014.03.038"},{"reference":"Peifer C, Sharma S, Watzinger P, Lamberth S, Kötter P, Entian KD. 2012. Yeast Rrp8p, a novel methyltransferase responsible for m1A 645 base modification of 25S rRNA. Nucleic Acids Research 41: 1151-1163.
","pubmedId":"","doi":"10.1093/nar/gks1102"},{"reference":"Robinson JS, Klionsky DJ, Banta LM, Emr SD. 1988. Protein Sorting in Saccharomyces cerevisiae: Isolation of Mutants Defective in the Delivery and Processing of Multiple Vacuolar Hydrolases. Molecular and Cellular Biology 8: 4936-4948.
","pubmedId":"","doi":"10.1128/mcb.8.11.4936-4948.1988"},{"reference":"Sharma S, Hartmann JD, Watzinger P, Klepper A, Peifer C, Kötter P, Lafontaine DLJ, Entian KD. 2018. A single N1-methyladenosine on the large ribosomal subunit rRNA impacts locally its structure and the translation of key metabolic enzymes. Scientific Reports 8: 10.1038/s41598-018-30383-z.
","pubmedId":"","doi":"10.1038/s41598-018-30383-z"},{"reference":"Tasmi TA, Solomon E, Avogo EW, Badenahalli Narasimhaiah S, Delorme-Axford E. 2026. The nonsense-mediated mRNA decay factor Upf3 negatively regulates bulk autophagy progression in\n Saccharomyces cerevisiae. Autophagy Reports 5: 10.1080/27694127.2026.2623730.
","pubmedId":"","doi":"10.1080/27694127.2026.2623730"},{"reference":"Teste MA, Duquenne M, François JM, Parrou JL. 2009. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Molecular Biology 10: 10.1186/1471-2199-10-99.
","pubmedId":"","doi":"10.1186/1471-2199-10-99"},{"reference":"Tsukada M, Ohsumi Y. 1993. Isolation and characterization of autophagy‐defective mutants of Saccharomyces cerevisiae. FEBS Letters 333: 169-174.
","pubmedId":"","doi":"10.1016/0014-5793(93)80398-e"},{"reference":"Wen X, Gatica Dn, Yin Z, Hu Z, Dengjel Jr, Klionsky DJ. 2019. The transcription factor Spt4-Spt5 complex regulates the expression of\n ATG8\n and\n ATG41. Autophagy 16: 1172-1185.
","pubmedId":"","doi":"10.1080/15548627.2019.1659573"}],"title":"The methyltransferase Rrp8 is a positive regulator of autophagy flux in Saccharomyces cerevisiae
","reviews":[{"reviewer":{"displayName":"Veronica Segarra"},"openAcknowledgement":true,"status":{"submitted":true}}],"curatorReviews":[]},{"id":"3c2d3074-8974-45dd-b4b1-c36e461571dc","decision":"edit","abstract":"Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. The products of autophagic degradation may be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions. However, the role of nucleolar proteins in autophagy remains largely unexplored. Here we identify Ribosomal RNA processing 8 (Rrp8) as a positive regulator of autophagy flux in the yeast Saccharomyces cerevisiae. Our work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation.
","acknowledgements":"","authors":[{"affiliations":["Oakland University, Rochester, MI, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","investigation","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"sbadenahallinar@oakland.edu","firstName":"Swaroopa","lastName":"Badenahalli Narasimhaiah","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Oakland University, Rochester, MI, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","dataCuration","formalAnalysis","fundingAcquisition","investigation","methodology","project","resources","supervision","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"delormeaxford@oakland.edu","firstName":"Elizabeth","lastName":"Delorme-Axford","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"https://orcid.org/0000-0002-7455-7616"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by grant funding from PCR Biosystems and Oakland University (OU) startup funds (to EDA). SBN was supported by a graduate teaching assistantship obtained through the OU Department of Biological Sciences. EDA is supported by funding from the National Institute of General Medical Sciences R15GM159346.
","image":{"url":"https://portal.micropublication.org/uploads/65f7450c99c25849abb78802fa212ce5.png"},"imageCaption":"(A) WT (JMY347), atg13Δ (EDA328), and rrp8Δ (SBN08) strains were grown to mid-log phase in YPD (+N), then starved for nitrogen (-N) in SD-N medium for 4 h. Pho8Δ60 activity was measured and normalized to the activity of starved WT cells, which was set at 100%. (B) WT (EDA291) and rrp8Δ (SBN03) strains expressing GFP-Atg8 were grown in nutrient-rich media, and then starved for nitrogen as indicated. Protein extracts were analyzed by SDS-PAGE and blotted using an antibody that recognizes GFP. GAPDH is the loading control. A representative blot is shown (n=3). (C) Densitometry of blots represented in (B). Processed GFP-Atg8 was calculated by determining the ratio of free GFP:total GFP (sum of free GFP and full-length GFP-Atg8). Results shown are relative to the WT strain during starvation (2 h SD-N), which was set to 1 (n=3). (D) Loss of RRP8 decreases cell survival after prolonged nitrogen starvation. WT (BY4742) and rrp8∆ cells were grown in nutrient-rich YPD medium (+N) until mid-log phase and then starved for nitrogen for 7 days (–N). Cells were serially diluted and spotted onto YPD plates, incubated for 2 days, and imaged. The image shown is representative of n=4 independent experiments. (E) RRP8 expression decreases during nitrogen starvation. WT (BY4741) cells were grown to mid-log phase in YPD (+N) and then shifted to nitrogen starved (-N) media for 1 hour. Total RNA was extracted, and RT-qPCR was performed. Results shown are relative to the level of expression in WT cells under rich conditions, which was set to 1 (n=3). (F) Rrp8-PA fusion protein levels decrease with nitrogen starvation. WT (SBN15) cells endogenously expressing Rrp8-PA fusion protein were grown to mid-log phase in YPD then starved for nitrogen for the time points indicated. Protein extracts were resolved by SDS-PAGE and blotted with anti-PA or anti-GAPDH (loading control) antibodies. A representative blot is shown (n=4). (G) Densitometry of blots represented in (F). The percentage of Rrp8-PA:GAPDH was quantified. (H) Loss of SFP1 decreases Rrp8-PA fusion protein levels. WT (SBN15) and sfp1Δ (SBN21) endogenously expressing Rrp8-PA were grown to mid-log phase in YPD (+N) starved for nitrogen for 2 h (-N). Protein extracts were analyzed as in (F). A representative blot is shown (n=3). (I) Densitometry of blots represented in (H). The percentage of Rrp8-PA:GAPDH was quantified. For (A), (C), (E), (G), and (I), results shown are the mean. Error bars indicate standard deviation.
","imageTitle":"Rrp8 positively regulates autophagy flux
","methods":"Yeast Strains, Media, and Cell Culture: Saccharomyces cerevisiae yeast strains used in this study are listed in the accompanying table. Yeast cells were grown in YPD (1% yeast extract, 2% peptone, and 2% glucose) medium (Gibco, A1374501). To induce autophagy, cells were grown to mid-log phase in YPD, then shifted to nitrogen starvation medium (SD-N; 0.17% yeast nitrogen base without ammonium sulfate or amino acids and 2% glucose) for the indicated time points. Chromosome tagging and gene deletions were performed using established methods (Gueldener et al., 2002; Longtine et al., 1998).
Pho8Δ60 Assay: The Pho8Δ60 assay was performed using the SmartReader 96 microplate absorbance reader (Accuris, MR9600) as previously described (Tasmi et al., 2026). Pho8Δ60 values were normalized to the protein content of each sample determined by the Pierce BCA Protein Assay kit (Thermo Scientific, 23227) as described (Delorme-Axford et al., 2023).
SDS-PAGE and Western Blots: SDS-PAGE and western blots were performed as previously described (Tasmi et al., 2026). Western blots were visualized using the Azure 600 (Azure Biosystems) or iBright CL1500 (Invitrogen) imaging systems. Densitometry for western blots was performed using ImageJ (https://imagej.nih.gov/ij/). Antibodies used in this study are included in the accompanying table.
Yeast Viability Assay: Yeast growth assays were performed as previously described (Avogo et al., 2025).
RNA and Real-Time Quantitative PCR (RT-qPCR): RNA extraction and RT-qPCR was performed as previously described (Avogo et al., 2025). Relative gene expression was calculated using the 2−ΔΔCT method (Livak and Schmittgen 2001), normalized to UBC6 levels. RT-qPCR primers used in this study are listed in the accompanying table.
Statistical analysis: The two-tailed unpaired t test was used to determine statistical significance with GraphPad Prism (GraphPad Software, USA). For all figures, p values are as follows: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns indicates not significant. A p value < 0.05 was considered significant.
","reagents":"Saccharomyces cerevisiae strains used in this study are as follows: | ||
Strains | Genotype | Reference |
BY4741 | MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 | Horizon Discovery |
BY4742 | MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 | Horizon Discovery |
BY4742, rrp8Δ::KANMX | BY4742, rrp8Δ::KANMX | Horizon Discovery |
EDA291 | WLY176, CUP1p-GFP-ATG8(405)::LEU2 | This study |
EDA328 | JMY347, atg13Δ::HIS5 | (Tasmi et al., 2026) |
JMY347 | SEY6210, pho13Δ ZEO1p-pho8Δ60, CUP1p-GFP-ATG8(405)::LEU2 | (Wen et al., 2020) |
SBN03 | EDA291, rrp8Δ::URA3 | This study |
SBN08 | JMY347, rrp8Δ::HIS5 | This study |
SBN15 | BY4742, RRP8-PA::HIS3 | This study |
SBN21 | SBN15, sfp1Δ::URA3 | This study |
SEY6210 | MATα leu2-3,112 ura3-52 his3-Δ200 trp1-Δ901 suc2-Δ9 lys2-801; GAL | (Robinson et al., 1988) |
WLY176 | SEY6210, pho13∆ pho8::pho8∆60 | (Kanki et al., 2009) |
RT-qPCR primer sequences used in this study are as follows: | ||
Primer | Sequence (5' to 3') | Reference |
1-RRP8-qPCR-F | ACGCTTTGAAGCTGATGGGA | This study |
1-RRP8-qPCR-R | TAATCTCCGCAGGTGGCTTG | This study |
2-RRP8-qPCR-F | TTTAGCGCCAAGGGGTGAAT | This study |
2-RRP8-qPCR-R | CCCATCAGCTTCAAAGCGTC | This study |
SLD3-qPCR-F | CGCAACTTCAAAGCATCATTGAATCGC | (Bernard, Jin, Xu, et al., 2015) |
SLD3-qPCR-R | GGGGCTTATTAGTGGGAGTAGAGG | (Bernard, Jin, Xu, et al., 2015) |
UBC6-qPCR-F | GATACTTGGAATCCTGGCTGGTCTGTCTC | (Teste et al., 2009) |
UBC6-qPCR-R | AAAGGGTCTTCTGTTTCATCACCTGTATTTGC | (Teste et al., 2009) |
Antibodies used in this study are as follows: | ||
Name | Identifier (Source) | Concentration |
mouse monoclonal anti-GAPDH (1E6D9) | Cat# 60004-1-Ig (Proteintech) | 1:20,000 |
mouse monoclonal anti-GFP (JL-8) | 632381 (Clontech) | 1:3,000 |
rabbit polyclonal anti-peroxidase (anti-PA) antibody | 323-005-024 (Jackson Immunoresearch) | 1:30,000 |
mouse monoclonal anti-Pgk1 (22C5D8) | Cat# 459250 (Invitrogen) | 1:5,000 |
Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. Nonselective autophagy targets bulk cytoplasm; whereas selective forms of autophagy target specific intracellular cargo. Basal autophagy is low, but is markedly upregulated during stressful conditions such as nutrient deprivation. Canonically, autophagy is a catabolic process, breaking down cytoplasmic cargo within the vacuole (in yeast) to maintain cell survival. The autophagic cargo are degraded, and the resulting biomolecules are transported to the cytosol for reuse. The effluxed bioproducts of autophagic degradation can be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions.
The goal of this study was to investigate the role of the budding yeast Saccharomyces cerevisiae ribosomal RNA processing 8 (Rrp8) protein in autophagy. Rrp8 is a S-adenosylmethionine-dependent methyltransferase (Bousquet-Antonelli et al., 2000). Rrp8 methylates m1A645 of 25S rRNA (Peifer et al., 2013). The N1-methyladenosine (m1A) modification is important for regulating gene expression (Li et al., 2022). m1A is a reversible modification in tRNA, mRNA, rRNA and long non-coding RNA (lncRNA) and has impacts on RNA processing, structure, and functions of targets (Li et al., 2022). Nucleomethylin (the mammalian homolog of yeast Rrp8) is associated with metabolic disease, obesity, and nutrient availability signaling (Oie et al., 2014; Sharma et al., 2018). Additionally, there is a gap in our understanding of how autophagy contributes to cellular metabolism, and in return, how metabolism impacts autophagy activity.
Given the relationship between nucleomethylin and nutrient availability signaling, we examined whether Rrp8 (the yeast homolog of nucleomethylin) plays a role in autophagy in Saccharomyces cerevisiae. To the best of our knowledge, whether Rrp8 has any impact on autophagy– in any model system– has never been explored. We first investigated whether autophagy was affected in cells lacking RRP8 by performing the alkaline phosphatase (ALP) or Pho8Δ60 assay (Figure 1A). The ALP assay is a quantitative enzymatic measurement of autophagy (Noda & Klionsky, 2008), although some minimal degree of basal phosphatase activity is observed in cells under nutrient-rich conditions (Delorme-Axford et al., 2018). As expected, when cells were starved for nitrogen (4 h), robust autophagy activity is observed in the wild-type (WT) strain and little activity in the negative control atg13∆ strain (~35%; Figure 1A). Atg13 is essential for autophagy in yeast (Tsukada & Ohsumi, 1993). Pho8Δ60 activity is reduced in the rrp8∆ strain compared to WT (~63%; Figure 1A), supporting that autophagy flux decreases in cells lacking RRP8.
Based on these results, we next examined whether autophagy was impaired in rrp8Δ cells by performing the GFP-Atg8 processing assay (Figure 1B, C). The GFP-Atg8 assay is a method to monitor bulk autophagy progression based on the release of free GFP. Following autophagosome-vacuole fusion, Atg8 is rapidly hydrolyzed; the GFP moiety remains relatively stable within the vacuole (Cheong & Klionsky, 2008). The release of free GFP from the GFP-Atg8 fusion protein indicates autophagy flux following autophagosome-vacuole fusion (Delorme-Axford et al., 2015). Consistent with our Pho8Δ60 assay results (Figure 1A), we observed a significant decrease of free GFP release in the rrp8Δ cells compared to the WT at 1 and 2 h of nitrogen starvation (Figure 1B, C). To determine whether loss of RRP8 impacts cell survival, we examined WT and rrp8∆ cells under nutrient-rich and prolonged nitrogen starvation conditions (Figure 1D). Following 7 days of nitrogen starvation, rrp8Δ cells showed reduced survival compared to WT, suggesting that Rrp8 may play an important role in mediating cell survival under nutrient-stress conditions (Figure 1D). This is consistent with previous observations that cells deficient in autophagy display reduced viability under prolonged starvation (Bernard, Jin, González-Rodríguez, et al., 2015; Tsukada & Ohsumi, 1993). Taken together, these data support the idea that Rrp8 is a positive regulator of autophagy flux when cells are starved for nitrogen (Figure 1A–D).
To determine whether RRP8 expression changes during autophagy-inducing conditions, we assessed RRP8 mRNA levels using RT-qPCR (Figure 1E). Two pairs of independent primers (1-RRP8 and 2-RRP8) were used to ensure reliability (Figure 1E). Following nitrogen starvation, RRP8 expression markedly declined by 1 hour of starvation (>90%; Figure 1E). As a control, SLD3 (a gene with no known connection to autophagy) was also analyzed (Figure 1E). As expected, SLD3 expression did not significantly change between nutrient-rich and starvation conditions (Figure 1E). To monitor Rrp8 protein levels, RRP8 was chromosomally tagged at the C-terminus with Protein A (PA), allowing detection of endogenous Rrp8-PA fusion protein during a time course of nitrogen starvation (0, 1, 2, and 3 h; Figure 1F, 1G). Western blot analysis revealed a noticeable decrease in Rrp8-PA protein levels during nitrogen starvation compared to nutrient-rich conditions, suggesting that Rrp8 is downregulated during nutrient stress (~50% by 3 h; Figure 1F, 1G).
The split-finger protein 1 (Sfp1) is a nutrient and stress sensitive transcription factor (Albert et al., 2019). Sfp1 is an activator of ribosomal protein and ribosome biogenesis gene transcription in yeast (Marion et al., 2004). Sfp1 is phosphorylated by the Target of Rapamycin Complex 1 (TORC1) kinase at multiple sites (Lempiäinen et al., 2009). Tor kinase is a negative regulator of autophagy (Noda & Ohsumi, 1998). Rapamycin treatment strongly inhibits the TORC1-Sfp1 interaction, leading to Sfp1 dephosphorylation (Lempiäinen et al., 2009). Rapamycin inhibits Tor, thereby activating autophagy (reviewed in (Delorme-Axford et al., 2015)). In addition, prior work by others suggests that Sfp1 may be a potential transcriptional activator of RRP8 (Cipollina et al., 2008). To investigate whether Sfp1 regulates RRP8, we compared Rrp8-PA fusion protein levels in WT and sfp1Δ cells by western blot analysis (Figure 1H, 1I). Under nutrient-rich conditions (+N), Rrp8-PA is well expressed in WT cells and decreases when cells are starved for nitrogen (-N; Figure 1H, 1I). In contrast, Rrp8-PA levels were reduced in sfp1Δ cells relative to WT under both nutrient-rich and starved conditions (Figure 1H, 1I). Taken together, these data suggest that Sfp1 may function as a positive regulator of Rrp8.
Here we characterize the yeast methyltransferase Rrp8 as a positive regulator of autophagy flux. Although we observed that RRP8/Rrp8 levels decline during nitrogen starvation, we do not currently know the mechanism(s) underlying our observations and/or what role the enzymatic activity of Rrp8 may have in this process. It is interesting to speculate that the observed decrease in RRP8/Rrp8 levels could serve as a mechanism to limit enzyme activity. We also found that loss of TORC1-regulated transcription factor SFP1 decreases Rrp8 levels under nutrient-rich and starved conditions, suggesting that Sfp1 may regulate Rrp8 expression. This work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation. Further elucidation of these mechanisms will advance our understanding of the molecular crosstalk between ribosome biogenesis, metabolism and autophagy.
","references":[{"reference":"Albert B, Tomassetti S, Gloor Y, Dilg D, Mattarocci S, Kubik S, Hafner L, Shore D. 2019. Sfp1 regulates transcriptional networks driving cell growth and division through multiple promoter-binding modes. Genes & Development 33: 288-293.
","pubmedId":"","doi":"10.1101/gad.322040.118"},{"reference":"Avogo EW, Burlingame NA, Badenahalli Narasimhaiah S, Delorme-Axford E. 2025. Bioinformatics analysis identifies Mot2 protein as a potential regulator of autophagy in Saccharomyces cerevisiae. MicroPubl Biol.
","pubmedId":"","doi":" 10.17912/micropub.biology.001698"},{"reference":"Bernard Al, Jin M, González-Rodríguez P, Füllgrabe J, Delorme-Axford E, Backues SK, Joseph B, Klionsky DJ. 2015. Rph1/KDM4 mediates nutrient-limitation signaling that leads to the transcriptional induction of autophagy. Current Biology 25: 546-555.
","pubmedId":"","doi":"10.1016/j.cub.2014.12.049"},{"reference":"Bernard Al, Jin M, Xu Z, Klionsky DJ. 2015. A large-scale analysis of autophagy-related gene expression identifies new regulators of autophagy. Autophagy 11: 2114-2122.
","pubmedId":"","doi":"10.1080/15548627.2015.1099796"},{"reference":"Bousquet-Antonelli C, Vanrobays E, Gélugne JP, Caizergues-Ferrer M, Henry Y. 2000. Rrp8p is a yeast nucleolar protein functionally linked to Gar1p and involved in pre-rRNA cleavage at site A2. RNA 6: 826-843.
","pubmedId":"","doi":" 10.1017/s1355838200992288"},{"reference":"Cheong H, Klionsky DJ. 2008. Biochemical methods to monitor autophagy‐related processes in yeast. Methods in Enzymology 451: 1-26.
","pubmedId":"","doi":"10.1016/s0076-6879(08)03201-1"},{"reference":"Cipollina C, van den Brink J, Daran-Lapujade P, Pronk JT, Porro D, de Winde JH. 2008. Saccharomyces cerevisiae SFP1: at the crossroads of central metabolism and ribosome biogenesis. Microbiology 154: 1686-1699.
","pubmedId":"","doi":"10.1099/mic.0.2008/017392-0"},{"reference":"Delorme-Axford E, Abernathy E, Lennemann NJ, Bernard Al, Ariosa A, Coyne CB, Kirkegaard K, Klionsky DJ. 2018. The exoribonuclease Xrn1 is a post-transcriptional negative regulator of autophagy. Autophagy 14: 898-912.
","pubmedId":"","doi":"10.1080/15548627.2018.1441648"},{"reference":"Delorme-Axford E, Guimaraes RS, Reggiori F, Klionsky DJ. 2015. The yeast Saccharomyces cerevisiae: An overview of methods to study autophagy progression. Methods 75: 3-12.
","pubmedId":"","doi":"10.1016/j.ymeth.2014.12.008"},{"reference":"Delorme-Axford E, Wen X, Klionsky DJ. 2023. The yeast transcription factor Stb5 acts as a negative regulator of autophagy by modulating cellular metabolism. Autophagy 19: 2719-2732.
","pubmedId":"","doi":"10.1080/15548627.2023.2228533"},{"reference":"Gueldener U, Heinisch J, Koehler GJ, Voss D, Hegemann JH. 2002. A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Research 30: 23e-23.
","pubmedId":"","doi":" 10.1093/nar/30.6.e23 "},{"reference":"He C, Song H, Yorimitsu T, Monastyrska I, Yen WL, Legakis JE, Klionsky DJ. 2006. Recruitment of Atg9 to the preautophagosomal structure by Atg11 is essential for selective autophagy in budding yeast. The Journal of Cell Biology 175: 925-935.
","pubmedId":"","doi":"10.1083/jcb.200606084"},{"reference":"Kanki T, Wang K, Baba M, Bartholomew CR, Lynch-Day MA, Du Z, et al., Klionsky DJ. 2009. A genomic screen for yeast mutants defective in selective mitochondria autophagy. Molecular Biology of the Cell 20: 4730-4738.
","pubmedId":"","doi":"10.1091/mbc.E09-03-0225"},{"reference":"Lempiäinen H, Uotila A, Urban Jr, Dohnal I, Ammerer G, Loewith R, Shore D. 2009. Sfp1 interaction with TORC1 and Mrs6 reveals feedback regulation on TOR signaling. Molecular Cell 33: 704-716.
","pubmedId":"","doi":"10.1016/j.molcel.2009.01.034"},{"reference":"Li J, Zhang H, Wang H. 2022. N1-methyladenosine modification in cancer biology: Current status and future perspectives. Computational and Structural Biotechnology Journal 20: 6578-6585.
","pubmedId":"","doi":"10.1016/j.csbj.2022.11.045"},{"reference":"Longtine MS, Mckenzie III A, Demarini DJ, Shah NG, Wach A, Brachat A, Philippsen P, Pringle JR. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14: 953-961.
","pubmedId":"","doi":"10.1002/(sici)1097-0061(199807)14:10%3C953::aid-yea293%3E3.0.co;2-u"},{"reference":"Marion RM, Regev A, Segal E, Barash Y, Koller D, Friedman N, O'Shea EK. 2004. Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene expression. Proceedings of the National Academy of Sciences 101: 14315-14322.
","pubmedId":"","doi":"10.1073/pnas.0405353101"},{"reference":"Noda T, Klionsky DJ. 2008. The quantitative Pho8Δ60 assay of nonspecific autophagy. Methods in Enzymology 451: 33-42.
","pubmedId":"","doi":"10.1016/s0076-6879(08)03203-5"},{"reference":"Noda T, Ohsumi Y. 1998. Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. Journal of Biological Chemistry 273: 3963-3966.
","pubmedId":"","doi":"10.1074/jbc.273.7.3963"},{"reference":"Oie S, Matsuzaki K, Yokoyama W, Tokunaga S, Waku T, Han SI, et al., Murayama A. 2014. Hepatic rRNA transcription regulates high-fat-diet-induced obesity. Cell Reports 7: 807-820.
","pubmedId":"","doi":"10.1016/j.celrep.2014.03.038"},{"reference":"Peifer C, Sharma S, Watzinger P, Lamberth S, Kötter P, Entian KD. 2012. Yeast Rrp8p, a novel methyltransferase responsible for m1A 645 base modification of 25S rRNA. Nucleic Acids Research 41: 1151-1163.
","pubmedId":"","doi":"10.1093/nar/gks1102"},{"reference":"Robinson JS, Klionsky DJ, Banta LM, Emr SD. 1988. Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Molecular and Cellular Biology 8: 4936-4948.
","pubmedId":"","doi":"10.1128/mcb.8.11.4936-4948.1988"},{"reference":"Sharma S, Hartmann JD, Watzinger P, Klepper A, Peifer C, Kötter P, Lafontaine DLJ, Entian KD. 2018. A single N1-methyladenosine on the large ribosomal subunit rRNA impacts locally its structure and the translation of key metabolic enzymes. Scientific Reports 8: 10.1038/s41598-018-30383-z.
","pubmedId":"","doi":"10.1038/s41598-018-30383-z"},{"reference":"Tasmi TA, Solomon E, Avogo EW, Badenahalli Narasimhaiah S, Delorme-Axford E. 2026. The nonsense-mediated mRNA decay factor Upf3 negatively regulates bulk autophagy progression in\n Saccharomyces cerevisiae. Autophagy Reports 5: 10.1080/27694127.2026.2623730.
","pubmedId":"","doi":"10.1080/27694127.2026.2623730"},{"reference":"Teste MA, Duquenne M, François JM, Parrou JL. 2009. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Molecular Biology 10: 10.1186/1471-2199-10-99.
","pubmedId":"","doi":"10.1186/1471-2199-10-99"},{"reference":"Tsukada M, Ohsumi Y. 1993. Isolation and characterization of autophagy‐defective mutants of Saccharomyces cerevisiae. FEBS Letters 333: 169-174.
","pubmedId":"","doi":"10.1016/0014-5793(93)80398-e"},{"reference":"Wen X, Gatica Dn, Yin Z, Hu Z, Dengjel Jr, Klionsky DJ. 2019. The transcription factor Spt4-Spt5 complex regulates the expression of\n ATG8\n and\n ATG41. Autophagy 16: 1172-1185.
","pubmedId":"","doi":"10.1080/15548627.2019.1659573"}],"title":"The methyltransferase Rrp8 is a positive regulator of autophagy flux in Saccharomyces cerevisiae
","reviews":[],"curatorReviews":[]},{"id":"71586935-9d37-4737-b288-5800607cf004","decision":"accept","abstract":"Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. The products of autophagic degradation may be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions. However, the role of nucleolar proteins in autophagy remains largely unexplored. Here we identify Ribosomal RNA processing 8 (Rrp8) as a positive regulator of autophagy flux in the yeast Saccharomyces cerevisiae. Our work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation.
","acknowledgements":"","authors":[{"affiliations":["Oakland University, Rochester, MI, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","investigation","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"sbadenahallinar@oakland.edu","firstName":"Swaroopa","lastName":"Badenahalli Narasimhaiah","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Oakland University, Rochester, MI, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","dataCuration","formalAnalysis","fundingAcquisition","investigation","methodology","project","resources","supervision","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"delormeaxford@oakland.edu","firstName":"Elizabeth","lastName":"Delorme-Axford","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"https://orcid.org/0000-0002-7455-7616"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by grant funding from PCR Biosystems and Oakland University (OU) startup funds (to EDA). SBN was supported by a graduate teaching assistantship obtained through the OU Department of Biological Sciences. EDA is supported by funding from the National Institute of General Medical Sciences R15GM159346.
","image":{"url":"https://portal.micropublication.org/uploads/65f7450c99c25849abb78802fa212ce5.png"},"imageCaption":"(A) WT (JMY347), atg13Δ (EDA328), and rrp8Δ (SBN08) strains were grown to mid-log phase in YPD (+N), then starved for nitrogen (-N) in SD-N medium for 4 h. Pho8Δ60 activity was measured and normalized to the activity of starved WT cells, which was set at 100%. (B) WT (EDA291) and rrp8Δ (SBN03) strains expressing GFP-Atg8 were grown in nutrient-rich media, and then starved for nitrogen as indicated. Protein extracts were analyzed by SDS-PAGE and blotted using an antibody that recognizes GFP. GAPDH is the loading control. A representative blot is shown (n=3). (C) Densitometry of blots represented in (B). Processed GFP-Atg8 was calculated by determining the ratio of free GFP:total GFP (sum of free GFP and full-length GFP-Atg8). Results shown are relative to the WT strain during starvation (2 h SD-N), which was set to 1 (n=3). (D) Loss of RRP8 decreases cell survival after prolonged nitrogen starvation. WT (BY4742) and rrp8∆ cells were grown in nutrient-rich YPD medium (+N) until mid-log phase and then starved for nitrogen for 7 days (–N). Cells were serially diluted and spotted onto YPD plates, incubated for 2 days, and imaged. The image shown is representative of n=4 independent experiments. (E) RRP8 expression decreases during nitrogen starvation. WT (BY4741) cells were grown to mid-log phase in YPD (+N) and then shifted to nitrogen starved (-N) media for 1 hour. Total RNA was extracted, and RT-qPCR was performed. Results shown are relative to the level of expression in WT cells under rich conditions, which was set to 1 (n=3). (F) Rrp8-PA fusion protein levels decrease with nitrogen starvation. WT (SBN15) cells endogenously expressing Rrp8-PA fusion protein were grown to mid-log phase in YPD then starved for nitrogen for the time points indicated. Protein extracts were resolved by SDS-PAGE and blotted with anti-PA or anti-GAPDH (loading control) antibodies. A representative blot is shown (n=4). (G) Densitometry of blots represented in (F). The percentage of Rrp8-PA:GAPDH was quantified. (H) Loss of SFP1 decreases Rrp8-PA fusion protein levels. WT (SBN15) and sfp1Δ (SBN21) endogenously expressing Rrp8-PA were grown to mid-log phase in YPD (+N) starved for nitrogen for 2 h (-N). Protein extracts were analyzed as in (F). A representative blot is shown (n=3). (I) Densitometry of blots represented in (H). The percentage of Rrp8-PA:GAPDH was quantified. For (A), (C), (E), (G), and (I), results shown are the mean. Error bars indicate standard deviation.
","imageTitle":"Rrp8 positively regulates autophagy flux
","methods":"Yeast Strains, Media, and Cell Culture: Saccharomyces cerevisiae yeast strains used in this study are listed in the accompanying table. Yeast cells were grown in YPD (1% yeast extract, 2% peptone, and 2% glucose) medium (Gibco, A1374501). To induce autophagy, cells were grown to mid-log phase in YPD, then shifted to nitrogen starvation medium (SD-N; 0.17% yeast nitrogen base without ammonium sulfate or amino acids and 2% glucose) for the indicated time points. Chromosome tagging and gene deletions were performed using established methods (Gueldener et al., 2002; Longtine et al., 1998).
Pho8Δ60 Assay: The Pho8Δ60 assay was performed using the SmartReader 96 microplate absorbance reader (Accuris, MR9600) as previously described (Tasmi et al., 2026). Pho8Δ60 values were normalized to the protein content of each sample determined by the Pierce BCA Protein Assay kit (Thermo Scientific, 23227) as described (Delorme-Axford et al., 2023).
SDS-PAGE and Western Blots: SDS-PAGE and western blots were performed as previously described (Tasmi et al., 2026). Western blots were visualized using the Azure 600 (Azure Biosystems) or iBright CL1500 (Invitrogen) imaging systems. Densitometry for western blots was performed using ImageJ (https://imagej.nih.gov/ij/). Antibodies used in this study are included in the accompanying table.
Yeast Viability Assay: Yeast growth assays were performed as previously described (Avogo et al., 2025).
RNA and Real-Time Quantitative PCR (RT-qPCR): RNA extraction and RT-qPCR was performed as previously described (Avogo et al., 2025). Relative gene expression was calculated using the 2−ΔΔCT method (Livak and Schmittgen 2001), normalized to UBC6 levels. RT-qPCR primers used in this study are listed in the accompanying table.
Statistical analysis: The two-tailed unpaired t test was used to determine statistical significance with GraphPad Prism (GraphPad Software, USA). For all figures, p values are as follows: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns indicates not significant. A p value < 0.05 was considered significant.
","reagents":"Saccharomyces cerevisiae strains used in this study are as follows: | ||
Strains | Genotype | Reference |
BY4741 | MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 | Horizon Discovery |
BY4742 | MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 | Horizon Discovery |
BY4742, rrp8Δ::KANMX | BY4742, rrp8Δ::KANMX | Horizon Discovery |
EDA291 | WLY176, CUP1p-GFP-ATG8(405)::LEU2 | This study |
EDA328 | JMY347, atg13Δ::HIS5 | (Tasmi et al., 2026) |
JMY347 | SEY6210, pho13Δ ZEO1p-pho8Δ60, CUP1p-GFP-ATG8(405)::LEU2 | (Wen et al., 2020) |
SBN03 | EDA291, rrp8Δ::URA3 | This study |
SBN08 | JMY347, rrp8Δ::HIS5 | This study |
SBN15 | BY4742, RRP8-PA::HIS3 | This study |
SBN21 | SBN15, sfp1Δ::URA3 | This study |
SEY6210 | MATα leu2-3,112 ura3-52 his3-Δ200 trp1-Δ901 suc2-Δ9 lys2-801; GAL | (Robinson et al., 1988) |
WLY176 | SEY6210, pho13∆ pho8::pho8∆60 | (Kanki et al., 2009) |
RT-qPCR primer sequences used in this study are as follows: | ||
Primer | Sequence (5' to 3') | Reference |
1-RRP8-qPCR-F | ACGCTTTGAAGCTGATGGGA | This study |
1-RRP8-qPCR-R | TAATCTCCGCAGGTGGCTTG | This study |
2-RRP8-qPCR-F | TTTAGCGCCAAGGGGTGAAT | This study |
2-RRP8-qPCR-R | CCCATCAGCTTCAAAGCGTC | This study |
SLD3-qPCR-F | CGCAACTTCAAAGCATCATTGAATCGC | (Bernard, Jin, Xu, et al., 2015) |
SLD3-qPCR-R | GGGGCTTATTAGTGGGAGTAGAGG | (Bernard, Jin, Xu, et al., 2015) |
UBC6-qPCR-F | GATACTTGGAATCCTGGCTGGTCTGTCTC | (Teste et al., 2009) |
UBC6-qPCR-R | AAAGGGTCTTCTGTTTCATCACCTGTATTTGC | (Teste et al., 2009) |
Antibodies used in this study are as follows: | ||
Name | Identifier (Source) | Concentration |
mouse monoclonal anti-GAPDH (1E6D9) | Cat# 60004-1-Ig (Proteintech) | 1:20,000 |
mouse monoclonal anti-GFP (JL-8) | 632381 (Clontech) | 1:3,000 |
rabbit polyclonal anti-peroxidase (anti-PA) antibody | 323-005-024 (Jackson Immunoresearch) | 1:30,000 |
mouse monoclonal anti-Pgk1 (22C5D8) | Cat# 459250 (Invitrogen) | 1:5,000 |
Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. Nonselective autophagy targets bulk cytoplasm; whereas selective forms of autophagy target specific intracellular cargo. Basal autophagy is low, but is markedly upregulated during stressful conditions such as nutrient deprivation. Canonically, autophagy is a catabolic process, breaking down cytoplasmic cargo within the vacuole (in yeast) to maintain cell survival. The autophagic cargo are degraded, and the resulting biomolecules are transported to the cytosol for reuse. The effluxed bioproducts of autophagic degradation can be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions.
The goal of this study was to investigate the role of the budding yeast Saccharomyces cerevisiae ribosomal RNA processing 8 (Rrp8) protein in autophagy. Rrp8 is a S-adenosylmethionine-dependent methyltransferase (Bousquet-Antonelli et al., 2000). Rrp8 methylates m1A645 of 25S rRNA (Peifer et al., 2013). The N1-methyladenosine (m1A) modification is important for regulating gene expression (Li et al., 2022). m1A is a reversible modification in tRNA, mRNA, rRNA and long non-coding RNA (lncRNA) and has impacts on RNA processing, structure, and functions of targets (Li et al., 2022). Nucleomethylin (the mammalian homolog of yeast Rrp8) is associated with metabolic disease, obesity, and nutrient availability signaling (Oie et al., 2014; Sharma et al., 2018). Additionally, there is a gap in our understanding of how autophagy contributes to cellular metabolism, and in return, how metabolism impacts autophagy activity.
Given the relationship between nucleomethylin and nutrient availability signaling, we examined whether Rrp8 (the yeast homolog of nucleomethylin) plays a role in autophagy in Saccharomyces cerevisiae. To the best of our knowledge, whether Rrp8 has any impact on autophagy– in any model system– has never been explored. We first investigated whether autophagy was affected in cells lacking RRP8 by performing the alkaline phosphatase (ALP) or Pho8Δ60 assay (Figure 1A). The ALP assay is a quantitative enzymatic measurement of autophagy (Noda & Klionsky, 2008), although some minimal degree of basal phosphatase activity is observed in cells under nutrient-rich conditions (Delorme-Axford et al., 2018). As expected, when cells were starved for nitrogen (4 h), robust autophagy activity is observed in the wild-type (WT) strain and little activity in the negative control atg13∆ strain (~35%; Figure 1A). Atg13 is essential for autophagy in yeast (Tsukada & Ohsumi, 1993). Pho8Δ60 activity is reduced in the rrp8∆ strain compared to WT (~63%; Figure 1A), supporting that autophagy flux decreases in cells lacking RRP8.
Based on these results, we next examined whether autophagy was impaired in rrp8Δ cells by performing the GFP-Atg8 processing assay (Figure 1B, C). The GFP-Atg8 assay is a method to monitor bulk autophagy progression based on the release of free GFP. Following autophagosome-vacuole fusion, Atg8 is rapidly hydrolyzed; the GFP moiety remains relatively stable within the vacuole (Cheong & Klionsky, 2008). The release of free GFP from the GFP-Atg8 fusion protein indicates autophagy flux following autophagosome-vacuole fusion (Delorme-Axford et al., 2015). Consistent with our Pho8Δ60 assay results (Figure 1A), we observed a significant decrease of free GFP release in the rrp8Δ cells compared to the WT at 1 and 2 h of nitrogen starvation (Figure 1B, C). To determine whether loss of RRP8 impacts cell survival, we examined WT and rrp8∆ cells under nutrient-rich and prolonged nitrogen starvation conditions (Figure 1D). Following 7 days of nitrogen starvation, rrp8Δ cells showed reduced survival compared to WT, suggesting that Rrp8 may play an important role in mediating cell survival under nutrient-stress conditions (Figure 1D). This is consistent with previous observations that cells deficient in autophagy display reduced viability under prolonged starvation (Bernard, Jin, González-Rodríguez, et al., 2015; Tsukada & Ohsumi, 1993). Taken together, these data support the idea that Rrp8 is a positive regulator of autophagy flux when cells are starved for nitrogen (Figure 1A–D).
To determine whether RRP8 expression changes during autophagy-inducing conditions, we assessed RRP8 mRNA levels using RT-qPCR (Figure 1E). Two pairs of independent primers (1-RRP8 and 2-RRP8) were used to ensure reliability (Figure 1E). Following nitrogen starvation, RRP8 expression markedly declined by 1 hour of starvation (>90%; Figure 1E). As a control, SLD3 (a gene with no known connection to autophagy) was also analyzed (Figure 1E). As expected, SLD3 expression did not significantly change between nutrient-rich and starvation conditions (Figure 1E). To monitor Rrp8 protein levels, RRP8 was chromosomally tagged at the C-terminus with Protein A (PA), allowing detection of endogenous Rrp8-PA fusion protein during a time course of nitrogen starvation (0, 1, 2, and 3 h; Figure 1F, 1G). Western blot analysis revealed a noticeable decrease in Rrp8-PA protein levels during nitrogen starvation compared to nutrient-rich conditions, suggesting that Rrp8 is downregulated during nutrient stress (~50% by 3 h; Figure 1F, 1G).
The split-finger protein 1 (Sfp1) is a nutrient and stress sensitive transcription factor (Albert et al., 2019). Sfp1 is an activator of ribosomal protein and ribosome biogenesis gene transcription in yeast (Marion et al., 2004). Sfp1 is phosphorylated by the Target of Rapamycin Complex 1 (TORC1) kinase at multiple sites (Lempiäinen et al., 2009). Tor kinase is a negative regulator of autophagy (Noda & Ohsumi, 1998). Rapamycin treatment strongly inhibits the TORC1-Sfp1 interaction, leading to Sfp1 dephosphorylation (Lempiäinen et al., 2009). Rapamycin inhibits Tor, thereby activating autophagy (reviewed in (Delorme-Axford et al., 2015)). In addition, prior work by others suggests that Sfp1 may be a potential transcriptional activator of RRP8 (Cipollina et al., 2008). To investigate whether Sfp1 regulates RRP8, we compared Rrp8-PA fusion protein levels in WT and sfp1Δ cells by western blot analysis (Figure 1H, 1I). Under nutrient-rich conditions (+N), Rrp8-PA is well expressed in WT cells and decreases when cells are starved for nitrogen (-N; Figure 1H, 1I). In contrast, Rrp8-PA levels were reduced in sfp1Δ cells relative to WT under both nutrient-rich and starved conditions (Figure 1H, 1I). Taken together, these data suggest that Sfp1 may function as a positive regulator of Rrp8.
Here we characterize the yeast methyltransferase Rrp8 as a positive regulator of autophagy flux. Although we observed that RRP8/Rrp8 levels decline during nitrogen starvation, we do not currently know the mechanism(s) underlying our observations and/or what role the enzymatic activity of Rrp8 may have in this process. It is interesting to speculate that the observed decrease in RRP8/Rrp8 levels could serve as a mechanism to limit enzyme activity. We also found that loss of TORC1-regulated transcription factor SFP1 decreases Rrp8 levels under nutrient-rich and starved conditions, suggesting that Sfp1 may regulate Rrp8 expression. This work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation. Further elucidation of these mechanisms will advance our understanding of the molecular crosstalk between ribosome biogenesis, metabolism and autophagy.
","references":[{"reference":"Albert B, Tomassetti S, Gloor Y, Dilg D, Mattarocci S, Kubik S, Hafner L, Shore D. 2019. Sfp1 regulates transcriptional networks driving cell growth and division through multiple promoter-binding modes. Genes & Development 33: 288-293.
","pubmedId":"","doi":"10.1101/gad.322040.118"},{"reference":"Avogo EW, Burlingame NA, Badenahalli Narasimhaiah S, Delorme-Axford E. 2025. Bioinformatics analysis identifies Mot2 protein as a potential regulator of autophagy in Saccharomyces cerevisiae. MicroPubl Biol.
","pubmedId":"","doi":" 10.17912/micropub.biology.001698"},{"reference":"Bernard Al, Jin M, González-Rodríguez P, Füllgrabe J, Delorme-Axford E, Backues SK, Joseph B, Klionsky DJ. 2015. Rph1/KDM4 mediates nutrient-limitation signaling that leads to the transcriptional induction of autophagy. Current Biology 25: 546-555.
","pubmedId":"","doi":"10.1016/j.cub.2014.12.049"},{"reference":"Bernard Al, Jin M, Xu Z, Klionsky DJ. 2015. A large-scale analysis of autophagy-related gene expression identifies new regulators of autophagy. Autophagy 11: 2114-2122.
","pubmedId":"","doi":"10.1080/15548627.2015.1099796"},{"reference":"Bousquet-Antonelli C, Vanrobays E, Gélugne JP, Caizergues-Ferrer M, Henry Y. 2000. Rrp8p is a yeast nucleolar protein functionally linked to Gar1p and involved in pre-rRNA cleavage at site A2. RNA 6: 826-843.
","pubmedId":"","doi":" 10.1017/s1355838200992288"},{"reference":"Cheong H, Klionsky DJ. 2008. Biochemical methods to monitor autophagy‐related processes in yeast. Methods in Enzymology 451: 1-26.
","pubmedId":"","doi":"10.1016/s0076-6879(08)03201-1"},{"reference":"Cipollina C, van den Brink J, Daran-Lapujade P, Pronk JT, Porro D, de Winde JH. 2008. Saccharomyces cerevisiae SFP1: at the crossroads of central metabolism and ribosome biogenesis. Microbiology 154: 1686-1699.
","pubmedId":"","doi":"10.1099/mic.0.2008/017392-0"},{"reference":"Delorme-Axford E, Abernathy E, Lennemann NJ, Bernard Al, Ariosa A, Coyne CB, Kirkegaard K, Klionsky DJ. 2018. The exoribonuclease Xrn1 is a post-transcriptional negative regulator of autophagy. Autophagy 14: 898-912.
","pubmedId":"","doi":"10.1080/15548627.2018.1441648"},{"reference":"Delorme-Axford E, Guimaraes RS, Reggiori F, Klionsky DJ. 2015. The yeast Saccharomyces cerevisiae: An overview of methods to study autophagy progression. Methods 75: 3-12.
","pubmedId":"","doi":"10.1016/j.ymeth.2014.12.008"},{"reference":"Delorme-Axford E, Wen X, Klionsky DJ. 2023. The yeast transcription factor Stb5 acts as a negative regulator of autophagy by modulating cellular metabolism. Autophagy 19: 2719-2732.
","pubmedId":"","doi":"10.1080/15548627.2023.2228533"},{"reference":"Gueldener U, Heinisch J, Koehler GJ, Voss D, Hegemann JH. 2002. A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Research 30: 23e-23.
","pubmedId":"","doi":" 10.1093/nar/30.6.e23 "},{"reference":"He C, Song H, Yorimitsu T, Monastyrska I, Yen WL, Legakis JE, Klionsky DJ. 2006. Recruitment of Atg9 to the preautophagosomal structure by Atg11 is essential for selective autophagy in budding yeast. The Journal of Cell Biology 175: 925-935.
","pubmedId":"","doi":"10.1083/jcb.200606084"},{"reference":"Kanki T, Wang K, Baba M, Bartholomew CR, Lynch-Day MA, Du Z, et al., Klionsky DJ. 2009. A genomic screen for yeast mutants defective in selective mitochondria autophagy. Molecular Biology of the Cell 20: 4730-4738.
","pubmedId":"","doi":"10.1091/mbc.E09-03-0225"},{"reference":"Lempiäinen H, Uotila A, Urban Jr, Dohnal I, Ammerer G, Loewith R, Shore D. 2009. Sfp1 interaction with TORC1 and Mrs6 reveals feedback regulation on TOR signaling. Molecular Cell 33: 704-716.
","pubmedId":"","doi":"10.1016/j.molcel.2009.01.034"},{"reference":"Li J, Zhang H, Wang H. 2022. N1-methyladenosine modification in cancer biology: Current status and future perspectives. Computational and Structural Biotechnology Journal 20: 6578-6585.
","pubmedId":"","doi":"10.1016/j.csbj.2022.11.045"},{"reference":"Longtine MS, Mckenzie III A, Demarini DJ, Shah NG, Wach A, Brachat A, Philippsen P, Pringle JR. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14: 953-961.
","pubmedId":"","doi":"10.1002/(sici)1097-0061(199807)14:10%3C953::aid-yea293%3E3.0.co;2-u"},{"reference":"Marion RM, Regev A, Segal E, Barash Y, Koller D, Friedman N, O'Shea EK. 2004. Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene expression. Proceedings of the National Academy of Sciences 101: 14315-14322.
","pubmedId":"","doi":"10.1073/pnas.0405353101"},{"reference":"Noda T, Klionsky DJ. 2008. The quantitative Pho8Δ60 assay of nonspecific autophagy. Methods in Enzymology 451: 33-42.
","pubmedId":"","doi":"10.1016/s0076-6879(08)03203-5"},{"reference":"Noda T, Ohsumi Y. 1998. Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. Journal of Biological Chemistry 273: 3963-3966.
","pubmedId":"","doi":"10.1074/jbc.273.7.3963"},{"reference":"Oie S, Matsuzaki K, Yokoyama W, Tokunaga S, Waku T, Han SI, et al., Murayama A. 2014. Hepatic rRNA transcription regulates high-fat-diet-induced obesity. Cell Reports 7: 807-820.
","pubmedId":"","doi":"10.1016/j.celrep.2014.03.038"},{"reference":"Peifer C, Sharma S, Watzinger P, Lamberth S, Kötter P, Entian KD. 2012. Yeast Rrp8p, a novel methyltransferase responsible for m1A 645 base modification of 25S rRNA. Nucleic Acids Research 41: 1151-1163.
","pubmedId":"","doi":"10.1093/nar/gks1102"},{"reference":"Robinson JS, Klionsky DJ, Banta LM, Emr SD. 1988. Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Molecular and Cellular Biology 8: 4936-4948.
","pubmedId":"","doi":"10.1128/mcb.8.11.4936-4948.1988"},{"reference":"Sharma S, Hartmann JD, Watzinger P, Klepper A, Peifer C, Kötter P, Lafontaine DLJ, Entian KD. 2018. A single N1-methyladenosine on the large ribosomal subunit rRNA impacts locally its structure and the translation of key metabolic enzymes. Scientific Reports 8: 10.1038/s41598-018-30383-z.
","pubmedId":"","doi":"10.1038/s41598-018-30383-z"},{"reference":"Tasmi TA, Solomon E, Avogo EW, Badenahalli Narasimhaiah S, Delorme-Axford E. 2026. The nonsense-mediated mRNA decay factor Upf3 negatively regulates bulk autophagy progression in\n Saccharomyces cerevisiae. Autophagy Reports 5: 10.1080/27694127.2026.2623730.
","pubmedId":"","doi":"10.1080/27694127.2026.2623730"},{"reference":"Teste MA, Duquenne M, François JM, Parrou JL. 2009. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Molecular Biology 10: 10.1186/1471-2199-10-99.
","pubmedId":"","doi":"10.1186/1471-2199-10-99"},{"reference":"Tsukada M, Ohsumi Y. 1993. Isolation and characterization of autophagy‐defective mutants of Saccharomyces cerevisiae. FEBS Letters 333: 169-174.
","pubmedId":"","doi":"10.1016/0014-5793(93)80398-e"},{"reference":"Wen X, Gatica Dn, Yin Z, Hu Z, Dengjel Jr, Klionsky DJ. 2019. The transcription factor Spt4-Spt5 complex regulates the expression of\n ATG8\n and\n ATG41. Autophagy 16: 1172-1185.
","pubmedId":"","doi":"10.1080/15548627.2019.1659573"}],"title":"The methyltransferase Rrp8 is a positive regulator of autophagy flux in Saccharomyces cerevisiae
","reviews":[],"curatorReviews":[]},{"id":"df828b75-9c54-4f59-b102-e3937eddef73","decision":"publish","abstract":"Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. The products of autophagic degradation may be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions. However, the role of nucleolar proteins in autophagy remains largely unexplored. Here we identify Ribosomal RNA processing 8 (Rrp8) as a positive regulator of autophagy flux in the yeast Saccharomyces cerevisiae. Our work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation.
","acknowledgements":"","authors":[{"affiliations":["Oakland University, Rochester, MI, United States"],"departments":["Biological Sciences"],"credit":["dataCuration","formalAnalysis","investigation","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"sbadenahallinar@oakland.edu","firstName":"Swaroopa","lastName":"Badenahalli Narasimhaiah","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Oakland University, Rochester, MI, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","dataCuration","formalAnalysis","fundingAcquisition","investigation","methodology","project","resources","supervision","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"delormeaxford@oakland.edu","firstName":"Elizabeth","lastName":"Delorme-Axford","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"https://orcid.org/0000-0002-7455-7616"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by grant funding from PCR Biosystems and Oakland University (OU) startup funds (to EDA). SBN was supported by a graduate teaching assistantship obtained through the OU Department of Biological Sciences. EDA is supported by funding from the National Institute of General Medical Sciences R15GM159346.
","image":{"url":"https://portal.micropublication.org/uploads/65f7450c99c25849abb78802fa212ce5.png"},"imageCaption":"(A) WT (JMY347), atg13Δ (EDA328), and rrp8Δ (SBN08) strains were grown to mid-log phase in YPD (+N), then starved for nitrogen (-N) in SD-N medium for 4 h. Pho8Δ60 activity was measured and normalized to the activity of starved WT cells, which was set at 100%. (B) WT (EDA291) and rrp8Δ (SBN03) strains expressing GFP-Atg8 were grown in nutrient-rich media, and then starved for nitrogen as indicated. Protein extracts were analyzed by SDS-PAGE and blotted using an antibody that recognizes GFP. GAPDH is the loading control. A representative blot is shown (n=3). (C) Densitometry of blots represented in (B). Processed GFP-Atg8 was calculated by determining the ratio of free GFP:total GFP (sum of free GFP and full-length GFP-Atg8). Results shown are relative to the WT strain during starvation (2 h SD-N), which was set to 1 (n=3). (D) Loss of RRP8 decreases cell survival after prolonged nitrogen starvation. WT (BY4742) and rrp8∆ cells were grown in nutrient-rich YPD medium (+N) until mid-log phase and then starved for nitrogen for 7 days (–N). Cells were serially diluted and spotted onto YPD plates, incubated for 2 days, and imaged. The image shown is representative of n=4 independent experiments. (E) RRP8 expression decreases during nitrogen starvation. WT (BY4741) cells were grown to mid-log phase in YPD (+N) and then shifted to nitrogen starved (-N) media for 1 hour. Total RNA was extracted, and RT-qPCR was performed. Results shown are relative to the level of expression in WT cells under rich conditions, which was set to 1 (n=3). (F) Rrp8-PA fusion protein levels decrease with nitrogen starvation. WT (SBN15) cells endogenously expressing Rrp8-PA fusion protein were grown to mid-log phase in YPD then starved for nitrogen for the time points indicated. Protein extracts were resolved by SDS-PAGE and blotted with anti-PA or anti-GAPDH (loading control) antibodies. A representative blot is shown (n=4). (G) Densitometry of blots represented in (F). The percentage of Rrp8-PA:GAPDH was quantified. (H) Loss of SFP1 decreases Rrp8-PA fusion protein levels. WT (SBN15) and sfp1Δ (SBN21) endogenously expressing Rrp8-PA were grown to mid-log phase in YPD (+N) starved for nitrogen for 2 h (-N). Protein extracts were analyzed as in (F). A representative blot is shown (n=3). (I) Densitometry of blots represented in (H). The percentage of Rrp8-PA:GAPDH was quantified. For (A), (C), (E), (G), and (I), results shown are the mean. Error bars indicate standard deviation.
","imageTitle":"Rrp8 positively regulates autophagy flux
","methods":"Yeast Strains, Media, and Cell Culture: Saccharomyces cerevisiae yeast strains used in this study are listed in the accompanying table. Yeast cells were grown in YPD (1% yeast extract, 2% peptone, and 2% glucose) medium (Gibco, A1374501). To induce autophagy, cells were grown to mid-log phase in YPD, then shifted to nitrogen starvation medium (SD-N; 0.17% yeast nitrogen base without ammonium sulfate or amino acids and 2% glucose) for the indicated time points. Chromosome tagging and gene deletions were performed using established methods (Gueldener et al., 2002; Longtine et al., 1998).
Pho8Δ60 Assay: The Pho8Δ60 assay was performed using the SmartReader 96 microplate absorbance reader (Accuris, MR9600) as previously described (Tasmi et al., 2026). Pho8Δ60 values were normalized to the protein content of each sample determined by the Pierce BCA Protein Assay kit (Thermo Scientific, 23227) as described (Delorme-Axford et al., 2023).
SDS-PAGE and Western Blots: SDS-PAGE and western blots were performed as previously described (Tasmi et al., 2026). Western blots were visualized using the Azure 600 (Azure Biosystems) or iBright CL1500 (Invitrogen) imaging systems. Densitometry for western blots was performed using ImageJ (https://imagej.nih.gov/ij/). Antibodies used in this study are included in the accompanying table.
Yeast Viability Assay: Yeast growth assays were performed as previously described (Avogo et al., 2025).
RNA and Real-Time Quantitative PCR (RT-qPCR): RNA extraction and RT-qPCR was performed as previously described (Avogo et al., 2025). Relative gene expression was calculated using the 2−ΔΔCT method (Livak and Schmittgen 2001), normalized to UBC6 levels. RT-qPCR primers used in this study are listed in the accompanying table.
Statistical analysis: The two-tailed unpaired t test was used to determine statistical significance with GraphPad Prism (GraphPad Software, USA). For Figure 1, p values are as follows: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns indicates not significant. A p value < 0.05 was considered significant.
","reagents":"Saccharomyces cerevisiae strains used in this study are as follows: | ||
Strains | Genotype | Reference |
BY4741 | MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 | Horizon Discovery |
BY4742 | MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 | Horizon Discovery |
BY4742, rrp8Δ::KANMX | BY4742, rrp8Δ::KANMX | Horizon Discovery |
EDA291 | WLY176, CUP1p-GFP-ATG8(405)::LEU2 | This study |
EDA328 | JMY347, atg13Δ::HIS5 | (Tasmi et al., 2026) |
JMY347 | SEY6210, pho13Δ ZEO1p-pho8Δ60, CUP1p-GFP-ATG8(405)::LEU2 | (Wen et al., 2020) |
SBN03 | EDA291, rrp8Δ::URA3 | This study |
SBN08 | JMY347, rrp8Δ::HIS5 | This study |
SBN15 | BY4742, RRP8-PA::HIS3 | This study |
SBN21 | SBN15, sfp1Δ::URA3 | This study |
SEY6210 | MATα leu2-3,112 ura3-52 his3-Δ200 trp1-Δ901 suc2-Δ9 lys2-801; GAL | (Robinson et al., 1988) |
WLY176 | SEY6210, pho13∆ pho8::pho8∆60 | (Kanki et al., 2009) |
RT-qPCR primer sequences used in this study are as follows: | ||
Primer | Sequence (5' to 3') | Reference |
1-RRP8-qPCR-F | ACGCTTTGAAGCTGATGGGA | This study |
1-RRP8-qPCR-R | TAATCTCCGCAGGTGGCTTG | This study |
2-RRP8-qPCR-F | TTTAGCGCCAAGGGGTGAAT | This study |
2-RRP8-qPCR-R | CCCATCAGCTTCAAAGCGTC | This study |
SLD3-qPCR-F | CGCAACTTCAAAGCATCATTGAATCGC | (Bernard, Jin, Xu, et al., 2015) |
SLD3-qPCR-R | GGGGCTTATTAGTGGGAGTAGAGG | (Bernard, Jin, Xu, et al., 2015) |
UBC6-qPCR-F | GATACTTGGAATCCTGGCTGGTCTGTCTC | (Teste et al., 2009) |
UBC6-qPCR-R | AAAGGGTCTTCTGTTTCATCACCTGTATTTGC | (Teste et al., 2009) |
Antibodies used in this study are as follows: | ||
Name | Identifier (Source) | Concentration |
mouse monoclonal anti-GAPDH (1E6D9) | Cat# 60004-1-Ig (Proteintech) | 1:20,000 |
mouse monoclonal anti-GFP (JL-8) | Cat# 632381 (Clontech) | 1:3,000 |
rabbit polyclonal anti-peroxidase (anti-PA) antibody | Cat# 323-005-024 (Jackson Immunoresearch) | 1:30,000 |
mouse monoclonal anti-Pgk1 (22C5D8) | Cat# 459250 (Invitrogen) | 1:5,000 |
Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. Nonselective autophagy targets bulk cytoplasm; whereas selective forms of autophagy target specific intracellular cargo. Basal autophagy is low, but is markedly upregulated during stressful conditions such as nutrient deprivation. Canonically, autophagy is a catabolic process, breaking down cytoplasmic cargo within the vacuole (in yeast) to maintain cell survival. The autophagic cargo are degraded, and the resulting biomolecules are transported to the cytosol for reuse. The effluxed bioproducts of autophagic degradation can be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions.
The goal of this study was to investigate the role of the budding yeast Saccharomyces cerevisiae ribosomal RNA processing 8 (Rrp8) protein in autophagy. Rrp8 is a S-adenosylmethionine-dependent methyltransferase (Bousquet-Antonelli et al., 2000). Rrp8 methylates m1A645 of 25S rRNA (Peifer et al., 2013). The N1-methyladenosine (m1A) modification is important for regulating gene expression (Li et al., 2022). m1A is a reversible modification in tRNA, mRNA, rRNA and long non-coding RNA (lncRNA) and has impacts on RNA processing, structure, and functions of targets (Li et al., 2022). Nucleomethylin (the mammalian homolog of yeast Rrp8) is associated with metabolic disease, obesity, and nutrient availability signaling (Oie et al., 2014; Sharma et al., 2018). Additionally, there is a gap in our understanding of how autophagy contributes to cellular metabolism, and in return, how metabolism impacts autophagy activity.
Given the relationship between nucleomethylin and nutrient availability signaling, we examined whether Rrp8 (the yeast homolog of nucleomethylin) plays a role in autophagy in Saccharomyces cerevisiae. To the best of our knowledge, whether Rrp8 has any impact on autophagy– in any model system– has never been explored. We first investigated whether autophagy was affected in cells lacking RRP8 by performing the alkaline phosphatase (ALP) or Pho8Δ60 assay (Figure 1A). The ALP assay is a quantitative enzymatic measurement of autophagy (Noda & Klionsky, 2008), although some minimal degree of basal phosphatase activity is observed in cells under nutrient-rich conditions (Delorme-Axford et al., 2018). As expected, when cells were starved for nitrogen (4 h), robust autophagy activity is observed in the wild-type (WT) strain and little activity in the negative control atg13∆ strain (~35%; Figure 1A). Atg13 is essential for autophagy in yeast (Tsukada & Ohsumi, 1993). Pho8Δ60 activity is reduced in the rrp8∆ strain compared to WT (~63%; Figure 1A), supporting that autophagy flux decreases in cells lacking RRP8.
Based on these results, we next examined whether autophagy was impaired in rrp8Δ cells by performing the GFP-Atg8 processing assay (Figure 1B, C). The GFP-Atg8 assay is a method to monitor bulk autophagy progression based on the release of free GFP. Following autophagosome-vacuole fusion, Atg8 is rapidly hydrolyzed; the GFP moiety remains relatively stable within the vacuole (Cheong & Klionsky, 2008). The release of free GFP from the GFP-Atg8 fusion protein indicates autophagy flux following autophagosome-vacuole fusion (Delorme-Axford et al., 2015). Consistent with our Pho8Δ60 assay results (Figure 1A), we observed a significant decrease of free GFP release in the rrp8Δ cells compared to the WT at 1 and 2 h of nitrogen starvation (Figure 1B, C). To determine whether loss of RRP8 impacts cell survival, we examined WT and rrp8∆ cells under nutrient-rich and prolonged nitrogen starvation conditions (Figure 1D). Following 7 days of nitrogen starvation, rrp8Δ cells showed reduced survival compared to WT, suggesting that Rrp8 may play an important role in mediating cell survival under nutrient-stress conditions (Figure 1D). This is consistent with previous observations that cells deficient in autophagy display reduced viability under prolonged starvation (Bernard, Jin, González-Rodríguez, et al., 2015; Tsukada & Ohsumi, 1993). Taken together, these data support the idea that Rrp8 is a positive regulator of autophagy flux when cells are starved for nitrogen (Figure 1A–D).
To determine whether RRP8 expression changes during autophagy-inducing conditions, we assessed RRP8 mRNA levels using RT-qPCR (Figure 1E). Two pairs of independent primers (1-RRP8 and 2-RRP8) were used to ensure reliability (Figure 1E). Following nitrogen starvation, RRP8 expression markedly declined by 1 hour of starvation (>90%; Figure 1E). As a control, SLD3 (a gene with no known connection to autophagy) was also analyzed (Figure 1E). As expected, SLD3 expression did not significantly change between nutrient-rich and starvation conditions (Figure 1E). To monitor Rrp8 protein levels, RRP8 was chromosomally tagged at the C-terminus with Protein A (PA), allowing detection of endogenous Rrp8-PA fusion protein during a time course of nitrogen starvation (0, 1, 2, and 3 h; Figure 1F, 1G). Western blot analysis revealed a noticeable decrease in Rrp8-PA protein levels during nitrogen starvation compared to nutrient-rich conditions, suggesting that Rrp8 is downregulated during nutrient stress (~50% by 3 h; Figure 1F, 1G).
The split-finger protein 1 (Sfp1) is a nutrient and stress sensitive transcription factor (Albert et al., 2019). Sfp1 is an activator of ribosomal protein and ribosome biogenesis gene transcription in yeast (Marion et al., 2004). Sfp1 is phosphorylated by the Target of Rapamycin Complex 1 (TORC1) kinase at multiple sites (Lempiäinen et al., 2009). Tor kinase is a negative regulator of autophagy (Noda & Ohsumi, 1998). Rapamycin treatment strongly inhibits the TORC1-Sfp1 interaction, leading to Sfp1 dephosphorylation (Lempiäinen et al., 2009). Rapamycin inhibits Tor, thereby activating autophagy (reviewed in (Delorme-Axford et al., 2015)). In addition, prior work by others suggests that Sfp1 may be a potential transcriptional activator of RRP8 (Cipollina et al., 2008). To investigate whether Sfp1 regulates RRP8, we compared Rrp8-PA fusion protein levels in WT and sfp1Δ cells by western blot analysis (Figure 1H, 1I). Under nutrient-rich conditions (+N), Rrp8-PA is well expressed in WT cells and decreases when cells are starved for nitrogen (-N; Figure 1H, 1I). In contrast, Rrp8-PA levels were reduced in sfp1Δ cells relative to WT under both nutrient-rich and starved conditions (Figure 1H, 1I). Taken together, these data suggest that Sfp1 may function as a positive regulator of Rrp8.
Here we characterize the yeast methyltransferase Rrp8 as a positive regulator of autophagy flux. Although we observed that RRP8/Rrp8 levels decline during nitrogen starvation, we do not currently know the mechanism(s) underlying our observations and/or what role the enzymatic activity of Rrp8 may have in this process. It is interesting to speculate that the observed decrease in RRP8/Rrp8 levels could serve as a mechanism to limit enzyme activity. We also found that loss of TORC1-regulated transcription factor SFP1 decreases Rrp8 levels under nutrient-rich and starved conditions, suggesting that Sfp1 may regulate Rrp8 expression. This work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation. Further elucidation of these mechanisms will advance our understanding of the molecular crosstalk between ribosome biogenesis, metabolism, and autophagy.
","references":[{"reference":"Albert B, Tomassetti S, Gloor Y, Dilg D, Mattarocci S, Kubik S, Hafner L, Shore D. 2019. Sfp1 regulates transcriptional networks driving cell growth and division through multiple promoter-binding modes. Genes & Development 33: 288-293.
","pubmedId":"","doi":"10.1101/gad.322040.118"},{"reference":"Avogo EW, Burlingame NA, Badenahalli Narasimhaiah S, Delorme-Axford E. 2025. Bioinformatics analysis identifies Mot2 protein as a potential regulator of autophagy in Saccharomyces cerevisiae. MicroPubl Biol.
","pubmedId":"","doi":" 10.17912/micropub.biology.001698"},{"reference":"Bernard Al, Jin M, González-Rodríguez P, Füllgrabe J, Delorme-Axford E, Backues SK, Joseph B, Klionsky DJ. 2015. Rph1/KDM4 mediates nutrient-limitation signaling that leads to the transcriptional induction of autophagy. Current Biology 25: 546-555.
","pubmedId":"","doi":"10.1016/j.cub.2014.12.049"},{"reference":"Bernard Al, Jin M, Xu Z, Klionsky DJ. 2015. A large-scale analysis of autophagy-related gene expression identifies new regulators of autophagy. Autophagy 11: 2114-2122.
","pubmedId":"","doi":"10.1080/15548627.2015.1099796"},{"reference":"Bousquet-Antonelli C, Vanrobays E, Gélugne JP, Caizergues-Ferrer M, Henry Y. 2000. Rrp8p is a yeast nucleolar protein functionally linked to Gar1p and involved in pre-rRNA cleavage at site A2. RNA 6: 826-843.
","pubmedId":"","doi":" 10.1017/s1355838200992288"},{"reference":"Cheong H, Klionsky DJ. 2008. Biochemical methods to monitor autophagy‐related processes in yeast. Methods in Enzymology 451: 1-26.
","pubmedId":"","doi":"10.1016/s0076-6879(08)03201-1"},{"reference":"Cipollina C, van den Brink J, Daran-Lapujade P, Pronk JT, Porro D, de Winde JH. 2008. Saccharomyces cerevisiae SFP1: at the crossroads of central metabolism and ribosome biogenesis. Microbiology 154: 1686-1699.
","pubmedId":"","doi":"10.1099/mic.0.2008/017392-0"},{"reference":"Delorme-Axford E, Abernathy E, Lennemann NJ, Bernard Al, Ariosa A, Coyne CB, Kirkegaard K, Klionsky DJ. 2018. The exoribonuclease Xrn1 is a post-transcriptional negative regulator of autophagy. Autophagy 14: 898-912.
","pubmedId":"","doi":"10.1080/15548627.2018.1441648"},{"reference":"Delorme-Axford E, Guimaraes RS, Reggiori F, Klionsky DJ. 2015. The yeast Saccharomyces cerevisiae: An overview of methods to study autophagy progression. Methods 75: 3-12.
","pubmedId":"","doi":"10.1016/j.ymeth.2014.12.008"},{"reference":"Delorme-Axford E, Wen X, Klionsky DJ. 2023. The yeast transcription factor Stb5 acts as a negative regulator of autophagy by modulating cellular metabolism. Autophagy 19: 2719-2732.
","pubmedId":"","doi":"10.1080/15548627.2023.2228533"},{"reference":"Gueldener U, Heinisch J, Koehler GJ, Voss D, Hegemann JH. 2002. A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Research 30: 23e-23.
","pubmedId":"","doi":" 10.1093/nar/30.6.e23 "},{"reference":"He C, Song H, Yorimitsu T, Monastyrska I, Yen WL, Legakis JE, Klionsky DJ. 2006. Recruitment of Atg9 to the preautophagosomal structure by Atg11 is essential for selective autophagy in budding yeast. The Journal of Cell Biology 175: 925-935.
","pubmedId":"","doi":"10.1083/jcb.200606084"},{"reference":"Kanki T, Wang K, Baba M, Bartholomew CR, Lynch-Day MA, Du Z, et al., Klionsky DJ. 2009. A genomic screen for yeast mutants defective in selective mitochondria autophagy. Molecular Biology of the Cell 20: 4730-4738.
","pubmedId":"","doi":"10.1091/mbc.E09-03-0225"},{"reference":"Lempiäinen H, Uotila A, Urban Jr, Dohnal I, Ammerer G, Loewith R, Shore D. 2009. Sfp1 interaction with TORC1 and Mrs6 reveals feedback regulation on TOR signaling. Molecular Cell 33: 704-716.
","pubmedId":"","doi":"10.1016/j.molcel.2009.01.034"},{"reference":"Li J, Zhang H, Wang H. 2022. N1-methyladenosine modification in cancer biology: Current status and future perspectives. Computational and Structural Biotechnology Journal 20: 6578-6585.
","pubmedId":"","doi":"10.1016/j.csbj.2022.11.045"},{"reference":"Longtine MS, Mckenzie III A, Demarini DJ, Shah NG, Wach A, Brachat A, Philippsen P, Pringle JR. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14: 953-961.
","pubmedId":"","doi":"10.1002/(sici)1097-0061(199807)14:10%3C953::aid-yea293%3E3.0.co;2-u"},{"reference":"Marion RM, Regev A, Segal E, Barash Y, Koller D, Friedman N, O'Shea EK. 2004. Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene expression. Proceedings of the National Academy of Sciences 101: 14315-14322.
","pubmedId":"","doi":"10.1073/pnas.0405353101"},{"reference":"Noda T, Klionsky DJ. 2008. The quantitative Pho8Δ60 assay of nonspecific autophagy. Methods in Enzymology 451: 33-42.
","pubmedId":"","doi":"10.1016/s0076-6879(08)03203-5"},{"reference":"Noda T, Ohsumi Y. 1998. Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. Journal of Biological Chemistry 273: 3963-3966.
","pubmedId":"","doi":"10.1074/jbc.273.7.3963"},{"reference":"Oie S, Matsuzaki K, Yokoyama W, Tokunaga S, Waku T, Han SI, et al., Murayama A. 2014. Hepatic rRNA transcription regulates high-fat-diet-induced obesity. Cell Reports 7: 807-820.
","pubmedId":"","doi":"10.1016/j.celrep.2014.03.038"},{"reference":"Peifer C, Sharma S, Watzinger P, Lamberth S, Kötter P, Entian KD. 2012. Yeast Rrp8p, a novel methyltransferase responsible for m1A 645 base modification of 25S rRNA. Nucleic Acids Research 41: 1151-1163.
","pubmedId":"","doi":"10.1093/nar/gks1102"},{"reference":"Robinson JS, Klionsky DJ, Banta LM, Emr SD. 1988. Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Molecular and Cellular Biology 8: 4936-4948.
","pubmedId":"","doi":"10.1128/mcb.8.11.4936-4948.1988"},{"reference":"Sharma S, Hartmann JD, Watzinger P, Klepper A, Peifer C, Kötter P, Lafontaine DLJ, Entian KD. 2018. A single N1-methyladenosine on the large ribosomal subunit rRNA impacts locally its structure and the translation of key metabolic enzymes. Scientific Reports 8: 10.1038/s41598-018-30383-z.
","pubmedId":"","doi":"10.1038/s41598-018-30383-z"},{"reference":"Tasmi TA, Solomon E, Avogo EW, Badenahalli Narasimhaiah S, Delorme-Axford E. 2026. The nonsense-mediated mRNA decay factor Upf3 negatively regulates bulk autophagy progression in\n Saccharomyces cerevisiae. Autophagy Reports 5: 10.1080/27694127.2026.2623730.
","pubmedId":"","doi":"10.1080/27694127.2026.2623730"},{"reference":"Teste MA, Duquenne M, François JM, Parrou JL. 2009. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Molecular Biology 10: 10.1186/1471-2199-10-99.
","pubmedId":"","doi":"10.1186/1471-2199-10-99"},{"reference":"Tsukada M, Ohsumi Y. 1993. Isolation and characterization of autophagy‐defective mutants of Saccharomyces cerevisiae. FEBS Letters 333: 169-174.
","pubmedId":"","doi":"10.1016/0014-5793(93)80398-e"},{"reference":"Wen X, Gatica Dn, Yin Z, Hu Z, Dengjel Jr, Klionsky DJ. 2019. The transcription factor Spt4-Spt5 complex regulates the expression of\n ATG8\n and\n ATG41. Autophagy 16: 1172-1185.
","pubmedId":"","doi":"10.1080/15548627.2019.1659573"}],"title":"The methyltransferase Rrp8 is a positive regulator of autophagy flux in Saccharomyces cerevisiae
","reviews":[],"curatorReviews":[]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"315d4b62-cde5-4f1c-95fd-05caca8a56a4","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}