Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, which results in progressive motor defects in C. elegans, and demonstrate this is largely independent of mitotic defects. Our experiments suggest that this VRK-1 mutant can be utilized to further research towards the etiology of VRK1-related neurological disorders. On the side, we report the discovery of dynamic late anaphase/early metaphase VRK-1 “bridges” in C. elegans embryos and present high temporal resolution videos of VRK-1 localisation during mitosis.
","acknowledgements":"","authors":[{"affiliations":["University of Bern"],"departments":["Institute of Cell Biology",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Supplementary videos of VRK-1::eGFP during mitosis and trashing movement of vrk-1 and vrk-1 4RA animals showing seizure-like behaviour for the latter
","doi":null,"resourceType":"Audiovisual","name":"Supplementary_videos.pptx","url":"https://portal.micropublication.org/uploads/215c41a29933aaf15072c0b6b06778bd.pptx"}],"funding":"This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
(a) Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1). The conserved basic-acidic-basic (BAB) patch is also indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the between the same timepoint (Students t-test).
VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans.
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedure, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments were performed in the his-72::gfp background.
Strain generation
Mutagenesis CRISPR-Cas9 was performed using co-CRISPR, as we described previously (Smith et al., n.d.). For VRK-1::eGFP, eGFP was amplified with either 5’ or 3’ VRK-1 homology using primers rPM2149-rPM2152 and PCR products were annealed together at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 3’ and 5’ homology between C-terminus insert site.
Confocal microscopy
Embryos or L3 larvae worms were added to 2% agarose pads for imaging. Mitotic embryos were imaged at approx. the 50-100 cell stage. For larvae, levamisole was added to agarose for final concentration of 5mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements denoising AI software.
Brood size assay
L3 Worms synchronized by egg lay were added to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistics was performed using Students-t test in Prism Graphpad.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated lifestage were added to wells, before waiting for approx. 10 minutes to allow for acclimatization in the new environment. Worms were censored if they failed to properly thrash after this period, as this indicates damage from the transfer. The number of thrashes was manually counted over a period of 30 seconds, with one thrash being considered a full left to right to left cycle. For older adults (d3 and d5), mother worms were transferred every two days after reaching adulthood to differentiate mothers from progeny. Statistics was performed using Students-t test in Prism Graphpad between genotypes, and one-way ANOVA was performed for the same genotype over time.
","reagents":"Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III. | |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127 [vrk-1(K371A) (K372A) (R376A) (R378A)::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Name | Sequence (5’-3’) | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5’ homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3’ homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests 4R/KA PCR product twice, WT digests once | NEB |
VRK1 is a serine/threonine chromatin binding kinase with a range of biological functions including mitosis and cell cycle progression, DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localised in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminus region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminus region in C. elegans result in impairments in animal motor function without mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in the nucleus, which becomes highly enriched at the nuclear periphery in hypodermal nuclei - a phenotype suppressed by depletion of BAF-1, a crucial VRK-1 nuclear envelope substrate (Smith et al., n.d.). Several other reports suggest the VRK-1/BAF-1 signalling axis is critical to detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone modifying enzymes as well as histones themselves, namely H3 and H2A (Lazo, 2024). hVRK1 was previously demonstrated to bind to the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved, arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 to mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show reduced H3 threonine 3 phosphorylation in VRK14RA mutants (by approximately 50%), whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). To investigate how VRK-1 might contribute to chromatin architecture independent of the BAF-1 signalling axis, we used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b).
To assess whether the VRK-1::wrmScarlet4R/KA mutant affects chromatin binding, we compared its localization with GFP-tagged histone H3 (HIS-72::GFP) used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::mScarlet associates with the nuclear envelope during prophase and early metaphase. Later during metaphase WT VRK-1::mScarlet does no longer strongly associate with chromatin while it reassociates during anaphase, often becoming more enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence reports of VRK-1 localisation during mitosis in C. elegans using immunofluorescence, suggesting that VRK-1::wrmScarlet is functional (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet, and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 second temporal resolution, we observed the same pattern of VRK-1 localisation as described above, although we note the remarkably dynamic nature of VRK-1 between frames during all stages of mitosis (supplementary videos 1-6). During anaphase, VRK-1::eGFP bridges are present and dynamic, forming during mid-anaphase before disappearing, likely in the anaphase to telophase transition. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in worms expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are not artifacts of live-imaging or tagging.
To our surprise and unlike hVRK14RA, the localisation of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Since WT VRK-1::eGFP localisation during mitosis showed dynamic, rapid changes (supplementary videos 1-6), and that VRK-1::wrmScarlet photobleached rapidly, we were unable to make a quantitative analysis and therefore cannot rule out subtle defects in localisation or morphology. Because mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function is overall unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA was severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localisation was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wildtype, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localisation, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, suggesting that nucleosome/chromatin binding might be regulated by multiple regions. Alternatively, VRK-1 recruitment into foci could be mediated by cofactors absent in mammalian systems. Because we did not perform bleaching experiments, VRK-1 dynamics could still be affected and a more detailed examination will be required. For example, histone phosphorylation at H3 T3 or H3 S10 could still be affected in these mutants even if overall VRK-1 localisation appears unchanged.
Visual inspection of animal locomotion revealed that vrk-14R/KA animals appeared lethargic. We performed thrashing assays to quantify changes in locomotion behaviour, counting the number of thrashes per animal over 30 seconds in liquid. We found a significant reduction (34%) in L4 larvae for VRK-14R/KA compared to WT (Fig. 1f), indicating impaired motor function. Because the vast majority of disease-causing variants of VRK1 become progressively more severe over time in human patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans, measuring thrashing over 30 seconds on days 1,3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutants showed a progressive and significant decline over time, with movement significantly reduced compared to WT (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviours, coiling for several seconds before resuming movement (approx. every 30 seconds to one minute) (supplementary videos 7-8). Notably, we never observed seizure-like behaviour after VRK-1 depletion or in VRK-1KD mutants. Strikingly, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; International League Against Epilepsy Consortium on Complex Epilepsies. Electronic address: epilepsy-austin@unimelb.edu.au, 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no impact on mitosis. To our knowledge, this is the first analysis of human disease relevant VRK1 coding variants in a model organism, beyond knockdown or null mutants. Therefore, we propose VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic function of VRK-1 and 2) further understanding the etiology of VRK1-associated distal moto-neuron diseases and VRK-1 related epilepsy. Future studies should pursue a more systematic analysis of behaviour in these mutants, coupled with the examination of the muscle apparatus and the nervous system as well as motor-neuronal morphology and function to identify the perturbed molecular pathways.
","references":[{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villasenor R, Sankar DS, Stumpe M, et al., Meister P. . Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin. bioRxiv","pubmedId":"","doi":""},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"}],"title":"Human disease relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[{"reviewer":{"displayName":"Peter Askjaer"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"b6a737e9-233b-4b7d-b150-21533bf2703d","decision":"revise","abstract":"Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, and show that these cause progressive motor defects in C. elegans that are largely independent of mitotic issues. Our experiments suggest that this VRK-1 mutant will be a useful tool for dissecting the aetiology of VRK1-related neurological disorders. In addition, we report the discovery of dynamic late anaphase/early telophase VRK-1 “bridges” in C. elegans embryos and present high temporal resolution videos of VRK-1 localisation during mitosis.
","acknowledgements":"","authors":[{"affiliations":["University of Bern"],"departments":["Institute of Cell Biology",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Supplementary videos of VRK-1::eGFP during mitosis and trashing movement of vrk-1 and vrk-1 4RA animals showing seizure-like behaviour for the latter
","doi":null,"resourceType":"Audiovisual","name":"Supplementary_videos.pptx","url":"https://portal.micropublication.org/uploads/215c41a29933aaf15072c0b6b06778bd.pptx"}],"funding":"This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
(a) Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1), showing the kinase domain and the C-terminal intrinsically disordered region (IDR). The conserved basic-acidic-basic (BAB) patch is indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet animals. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the same timepoint (Students t-test).
","imageTitle":"VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedures, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments were performed in the his-72::gfp background.
Strain generation
CRISPR-Cas9 mutagenesis was performed using co-CRISPR, as described previously (Smith et al., n.d.). For VRK-1::eGFP, eGFP was amplified with either 5’ or 3’ VRK-1 homology using primers rPM2149/rPM2152 and PCR products were annealed at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 5’ and 3’ sides of the C-terminal insertion site.
Confocal microscopy
Embryos or L3 larvae were mounted on 2% agarose pads for imaging. Mitotic embryos were imaged at approximately the 50-100 cell stage. For larvae, levamisole was added to agarose at a final concentration of 5 mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements Denoise.ai software.
Brood size assay
L3 worms synchronized by egg lay were transferred to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistical analyes were performed using Students-t test in Graphpad Prism.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated life stage were added to the wells and allowed to acclimatise for approximately 10 minutes. Worms were censored if they failed to thrash properly after this period, as this indicates damage from the transfer. The number of thrashes was counted manually over a period of 30 s, one thrash was defined as a complete left-right-left cycle. For older adults (d3 and d5), mothers were transferred to fresh plates every two days after reaching adulthood to separate them from their progeny. Statistical analyses were performed using Students-t test in Graphpad Prism between genotypes, and one-way ANOVA within the same genotype over time.
Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III. | |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127[vrk-1(K371A) (K372A) (R376A) (R378A)::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Name | Sequence (5’-3’) | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5’ homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3’ homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests the 4R/KA PCR product twice, the WT product once | NEB |
VRK1 is a serine/threonine chromatin-binding kinase with roles in a range of biological processes, including mitosis and cell cycle progression, the DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localised in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminal region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants in or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminal region of C. elegans VRK-1 impair animal motor function without causing detectable mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in hypodermal nuclei, where chromatin becomes highly enriched at the nuclear periphery - a phenotype suppressed by depletion of BAF-1, a key nuclear envelope substrate of VRK-1 (Smith et al., n.d.). Several other reports suggest the VRK-1/BAF-1 signalling axis is critical for detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone-modifying enzymes as well as histones H3 and H2A themselves (Lazo, 2024). hVRK1 has been shown to bind the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 with mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show that H3 threonine 3 phosphorylation is reduced by approximately 50% in VRK14RA mutants, whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). Because these substitutions abolish nucleosome binding while leaving BAF phosphorylation intact in vitro, they offer a way to probe the contribution of VRK-1 to chromatin architecture independently of the BAF-1 signalling axis. We therefore used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b). We note that these substitutions were designed to abolish nucleosome binding rather than to mimic a specific patient variant: mutation of the first arginine of the human BAB patch (R387H) is linked to distal hereditary motor neuropathy, whereas the remaining three residues have not been associated with disease.
To assess whether the 4R/KA substitutions affect chromatin binding, we compared the localization of the mutant VRK-1 with that of GFP-tagged histone H3 (HIS-72::GFP), used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::mScarlet associates with the nuclear envelope during prophase and early metaphase. Later in metaphase, WT VRK-1::mScarlet no longer strongly associates with chromatin, but reassociates during anaphase, often becoming enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence studies of VRK-1 localisation during mitosis in C. elegans, indicating that VRK-1::wrmScarlet recapitulates the locaclisation of the endogenous protein (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 s temporal resolution, we observed the same pattern of VRK-1 localisation as described above, although we noted that VRK-1 was remarkably dynamic between frames at all stages of mitosis (supplementary videos 1-6). During anaphase, VRK-1::eGFP bridges are present and dynamic, forming during mid-anaphase before disappearing, likely in the anaphase to telophase transition. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in nematodes expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are unlikely artifacts of live-imaging or tagging.
In contrast to hVRK14RA and to our surprise, the localisation of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to that of WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Because WT VRK-1::eGFP localisation changed rapidly and dynamically during mitosis (supplementary videos 1-6), and because VRK-1::wrmScarlet photobleached rapidly, we were unable to perform a quantitative analysis and therefore cannot rule out subtle defects in localisation or morphology. Because mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function are broadly unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA were severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localisation was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wild type, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localisation, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, raising the possibility that nucleosome binding is mediated by multiple regions of the protein. Alternatively, VRK-1 recruitment to chromatin could be mediated by cofactors absent in mammalian systems. Because we did not perform bleaching experiments, we cannot exclude changes in VRK-1 dynamics, and a more detailed examination will be required. For example, histone phosphorylation at H3T3 or H3S10 could still be affected in these mutants even if overall VRK-1 localisation appears unchanged.
Visual inspection of animal locomotion suggested that vrk-14R/KA animals appeared lethargic. We therefore performed thrashing assays to quantify locomotion behaviour, counting the number of thrashes per animal in liquid over 30 s. We found a significant reduction (34%) in VRK-14R/KA L4 larvae compared to WT ones (Fig. 1f), indicating impaired motor function. Because the phenotypes caused by the vast majority of disease-causing VRK1 variants become progressively more severe over time in patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans. We measured thrashing over 30 s on days 1, 3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutant animals showed a progressive and significant decline over time, and moved significantly less than WT ones (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviours, coiling for several seconds every 30 s to 1 min before resuming movement (supplementary videos 7-8). Notably, we never observed seizure-like behaviour after VRK-1 depletion or in VRK-1KD mutants. Of note, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no detectable impact on mitosis. To our knowledge, this is the first analysis of mutations in the disease-associated BAB patch of VRK1 in a model organism, beyond knockdown or null mutants. Therefore, we propose that the VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic functions of VRK-1 and 2) further understanding the aetiology of VRK1-associated distal motor neuron diseases and VRK-related epilepsy. Future studies should pursue a more systematic analysis of behaviour in these mutants, coupled with the examination of muscle and nervous system architectures, including motor neuron morphology and function, to identify the perturbed molecular pathways.
","references":[{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villasenor R, Sankar DS, Stumpe M, et al., Meister P. . Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin. bioRxiv","pubmedId":"","doi":""},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"}],"title":"Human disease-relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"3c3ae8c9-f254-40ff-a30a-c1767a04b69f","decision":"edit","abstract":"Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, and show that these cause progressive motor defects in C. elegans that are largely independent of mitotic issues. Our experiments suggest that this VRK-1 mutant will be a useful tool for dissecting the etiology of VRK1-related neurological disorders. In addition, we report the discovery of dynamic late anaphase/early telophase VRK-1 “bridges” in C. elegans embryos and present high temporal resolution videos of VRK-1 localization during mitosis.
","acknowledgements":"","authors":[{"affiliations":["University of Bern"],"departments":["Institute of Cell Biology",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Videos 1/2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
Extended Data Videos 3/4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80 frames, 1.6 s interval, 126 s total.
Extended Data Stills from Videos 1 to 6
Contact sheets of the six VRK-1::eGFP timelapse movies, videos 1–6 top to bottom (labelled on the right side of the images). Each block of twelve panels is drawn from one movie by sampling twelve frame indices spaced evenly across the full acquired sequence, including the first and last frames; panels read left to right, top to bottom. Mitotic stage is labelled on the left side of the images. Sampling interval and elapsed time per block: videos 1 and 5, every 7th frame of 80 (0–126 s); video 2, every 7th–8th frame of 81 (0–128 s); videos 3 and 4, every 5th–6th frame of 60 (0–94 s); video 6, every 9th frame of 100 (0–158 s). All six movies were acquired at a common 1.6 s interval. Scale bar 2 µm.
This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
(a) Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1), showing the kinase domain and the C-terminal intrinsically disordered region (IDR). The conserved basic-acidic-basic (BAB) patch is indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet animals. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the same timepoint (Students t-test).
","imageTitle":"VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedures, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments were performed in the his-72::gfp background.
Strain generation
CRISPR-Cas9 mutagenesis was performed using co-CRISPR, as described previously (Smith et al., n.d.). For VRK-1::eGFP, eGFP was amplified with either 5’ or 3’ VRK-1 homology using primers rPM2149/rPM2152 and PCR products were annealed at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 5’ and 3’ sides of the C-terminal insertion site.
Confocal microscopy
Embryos or L3 larvae were mounted on 2% agarose pads for imaging. Mitotic embryos were imaged at approximately the 50-100 cell stage. For larvae, levamisole was added to agarose at a final concentration of 5 mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements Denoise.ai software.
Brood size assay
L3 worms synchronized by egg lay were transferred to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistical analyes were performed using Students-t test in Graphpad Prism.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated life stage were added to the wells and allowed to acclimatise for approximately 10 minutes. Worms were censored if they failed to thrash properly after this period, as this indicates damage from the transfer. The number of thrashes was counted manually over a period of 30 s, one thrash was defined as a complete left-right-left cycle. For older adults (d3 and d5), mothers were transferred to fresh plates every two days after reaching adulthood to separate them from their progeny. Statistical analyses were performed using Students-t test in Graphpad Prism between genotypes, and one-way ANOVA within the same genotype over time.
Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III. | |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127[vrk-1(K371A) (K372A) (R376A) (R378A)::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Name | Sequence (5’-3’) | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5’ homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3’ homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests the 4R/KA PCR product twice, the WT product once | NEB |
VRK1 is a serine/threonine chromatin-binding kinase with roles in a range of biological processes, including mitosis and cell cycle progression, the DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localized in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminal region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants in or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminal region of C. elegans VRK-1 impair animal motor function without causing detectable mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in hypodermal nuclei, where chromatin becomes highly enriched at the nuclear periphery - a phenotype suppressed by depletion of BAF-1, a key nuclear envelope substrate of VRK-1 (Smith et al., n.d.). Several other reports suggest the VRK-1/BAF-1 signaling axis is critical for detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone-modifying enzymes as well as histones H3 and H2A themselves (Lazo, 2024). hVRK1 has been shown to bind the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 with mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show that H3 threonine 3 phosphorylation is reduced by approximately 50% in VRK14RA mutants, whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). Because these substitutions abolish nucleosome binding while leaving BAF phosphorylation intact in vitro, they offer a way to probe the contribution of VRK-1 to chromatin architecture independently of the BAF-1 signaling axis. We therefore used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b). We note that these substitutions were designed to abolish nucleosome binding rather than to mimic a specific patient variant: mutation of the first arginine of the human BAB patch (R387H) is linked to distal hereditary motor neuropathy, whereas the remaining three residues have not been associated with disease.
To assess whether the 4R/KA substitutions affect chromatin binding, we compared the localization of the mutant VRK-1 with that of GFP-tagged histone H3 (HIS-72::GFP), used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::mScarlet associates with the nuclear envelope during prophase and early metaphase. Later in metaphase, WT VRK-1::mScarlet no longer strongly associates with chromatin, but reassociates during anaphase, often becoming enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence studies of VRK-1 localization during mitosis in C. elegans, indicating that VRK-1::wrmScarlet recapitulates the localization of the endogenous protein (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 s temporal resolution, we observed the same pattern of VRK-1 localization as described above, although we noted that the localization pattern of VRK-1 during each of the four main stages of mitosis, and also across these stages, is highly dynamic (extended data videos 1-6). During anaphase, VRK-1::eGFP bridges are present and dynamic, forming during mid-anaphase before disappearing, likely in the anaphase to telophase transition. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in nematodes expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are unlikely artifacts of live-imaging or tagging.
In contrast to hVRK14RA and to our surprise, the localization of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to that of WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Because WT VRK-1::eGFP localization changed rapidly and dynamically during mitosis (extended data videos 1-6), and because VRK-1::wrmScarlet photobleached rapidly, we were unable to perform a quantitative analysis and therefore cannot rule out subtle defects in localization or morphology. Because mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function are broadly unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA were severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localization was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wild type, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localization, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, raising the possibility that nucleosome binding is mediated by multiple regions of the protein. Alternatively, VRK-1 recruitment to chromatin could be mediated by cofactors absent in mammalian systems. Because we limited our study largely to VRK-1 localisation experiments, we cannot rule out other aspects such as kinase activity or protein turnover are affected in this mutant and a more detailed examination will be required in the future. For example, histone phosphorylation at H3T3 or H3S10 could still be affected in these mutants even if overall VRK-1 localization appears unchanged.
Visual inspection of animal locomotion suggested that vrk-14R/KA animals appeared lethargic. We therefore performed thrashing assays to quantify locomotion behavior, counting the number of thrashes per animal in liquid over 30 s. We found a significant reduction (34%) in VRK-14R/KA L4 larvae compared to WT ones (Fig. 1f), indicating impaired motor function. Because the phenotypes caused by the vast majority of disease-causing VRK1 variants become progressively more severe over time in patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans. We measured thrashing over 30 s on days 1, 3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutant animals showed a progressive and significant decline over time, and moved significantly less than WT ones (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviors, coiling for several seconds every 30 s to 1 min before resuming movement (extended data videos 7-8). Notably, we never observed seizure-like behavior after VRK-1 depletion or in VRK-1KD mutants. Of note, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no detectable impact on mitosis. To our knowledge, this is the first analysis of mutations in the disease-associated BAB patch of VRK1 in a model organism, beyond knockdown or null mutants. Therefore, we propose that the VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic functions of VRK-1 and 2) further understanding the etiology of VRK1-associated distal motor neuron diseases and VRK-related epilepsy. Future studies should pursue a more systematic analysis of behavior in these mutants, coupled with the examination of muscle and nervous system architectures, including motor neuron morphology and function, to identify the perturbed molecular pathways.
","references":[{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villasenor R, Sankar DS, Stumpe M, et al., Meister P. . Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin. bioRxiv","pubmedId":"","doi":""},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"}],"title":"Human disease-relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"1f93599d-f927-442b-8a07-6be77df5e107","decision":"revise","abstract":"Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, and show that these cause progressive motor defects in C. elegans that are largely independent of mitotic issues. Our experiments suggest that this VRK-1 mutant will be a useful tool for dissecting the etiology of VRK1-related neurological disorders. In addition, we report the discovery of dynamic late anaphase/early telophase VRK-1 “bridges” in C. elegans embryos and present high temporal resolution videos of VRK-1 localization during mitosis.
","acknowledgements":"","authors":[{"affiliations":["University of Bern"],"departments":["Institute of Cell Biology",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Videos 1/2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
Extended Data Videos 3/4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80 frames, 1.6 s interval, 126 s total.
Extended Data Stills from Videos 1 to 6
Contact sheets of the six VRK-1::eGFP timelapse movies, videos 1–6 top to bottom (labelled on the right side of the images). Each block of twelve panels is drawn from one movie by sampling twelve frame indices spaced evenly across the full acquired sequence, including the first and last frames; panels read left to right, top to bottom. Mitotic stage is labelled on the left side of the images. Sampling interval and elapsed time per block: videos 1 and 5, every 7th frame of 80 (0–126 s); video 2, every 7th–8th frame of 81 (0–128 s); videos 3 and 4, every 5th–6th frame of 60 (0–94 s); video 6, every 9th frame of 100 (0–158 s). All six movies were acquired at a common 1.6 s interval. Scale bar 2 µm.
This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
(a) Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1), showing the kinase domain and the C-terminal intrinsically disordered region (IDR). The conserved basic-acidic-basic (BAB) patch is indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet animals. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the same timepoint (Students t-test).
","imageTitle":"VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedures, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments were performed in the his-72::gfp background.
Strain generation
CRISPR-Cas9 mutagenesis was performed using co-CRISPR, as described previously (Smith et al., n.d.). For VRK-1::eGFP, eGFP was amplified with either 5’ or 3’ VRK-1 homology using primers rPM2149/rPM2152 and PCR products were annealed at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 5’ and 3’ sides of the C-terminal insertion site.
Confocal microscopy
Embryos or L3 larvae were mounted on 2% agarose pads for imaging. Mitotic embryos were imaged at approximately the 50-100 cell stage. For larvae, levamisole was added to agarose at a final concentration of 5 mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements Denoise.ai software.
Brood size assay
L3 worms synchronized by egg lay were transferred to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistical analyes were performed using Students-t test in Graphpad Prism.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated life stage were added to the wells and allowed to acclimatise for approximately 10 minutes. Worms were censored if they failed to thrash properly after this period, as this indicates damage from the transfer. The number of thrashes was counted manually over a period of 30 s, one thrash was defined as a complete left-right-left cycle. For older adults (d3 and d5), mothers were transferred to fresh plates every two days after reaching adulthood to separate them from their progeny. Statistical analyses were performed using Students-t test in Graphpad Prism between genotypes, and one-way ANOVA within the same genotype over time.
Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III. | |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127[vrk-1(K371A) (K372A) (R376A) (R378A)::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Primers, CRISPR guides and restriction enzymes used in this study
Name | Sequence (5’-3’) | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5’ homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3’ homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests the 4R/KA PCR product twice, the WT product once | NEB |
VRK1 is a serine/threonine chromatin-binding kinase with roles in a range of biological processes, including mitosis and cell cycle progression, the DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localized in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminal region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants in or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminal region of C. elegans VRK-1 impair animal motor function without causing detectable mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in hypodermal nuclei, where chromatin becomes highly enriched at the nuclear periphery - a phenotype suppressed by depletion of BAF-1, a key nuclear envelope substrate of VRK-1 (Smith et al., n.d.). Several other reports suggest the VRK-1/BAF-1 signaling axis is critical for detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone-modifying enzymes as well as histones H3 and H2A themselves (Lazo, 2024). hVRK1 has been shown to bind the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 with mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show that H3 threonine 3 phosphorylation is reduced by approximately 50% in VRK14RA mutants, whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). Because these substitutions abolish nucleosome binding while leaving BAF phosphorylation intact in vitro, they offer a way to probe the contribution of VRK-1 to chromatin architecture independently of the BAF-1 signaling axis. We therefore used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b). We note that these substitutions were designed to abolish nucleosome binding rather than to mimic a specific patient variant: mutation of the first arginine of the human BAB patch (R387H) is linked to distal hereditary motor neuropathy, whereas the remaining three residues have not been associated with disease.
To assess whether the 4R/KA substitutions affect chromatin binding, we compared the localization of the mutant VRK-1 with that of GFP-tagged histone H3 (HIS-72::GFP), used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::mScarlet associates with the nuclear envelope during prophase and early metaphase. Later in metaphase, WT VRK-1::mScarlet no longer strongly associates with chromatin, but reassociates during anaphase, often becoming enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence studies of VRK-1 localization during mitosis in C. elegans, indicating that VRK-1::wrmScarlet recapitulates the localization of the endogenous protein (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 s temporal resolution, we observed the same pattern of VRK-1 localization as described above, although we noted that the localization pattern of VRK-1 during each of the four main stages of mitosis, and also across these stages, is highly dynamic (extended data videos 1-6). During anaphase, VRK-1::eGFP bridges are present and dynamic, forming during mid-anaphase before disappearing, likely in the anaphase to telophase transition. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in nematodes expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are unlikely artifacts of live-imaging or tagging.
In contrast to hVRK14RA and to our surprise, the localization of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to that of WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Because WT VRK-1::eGFP localization changed rapidly and dynamically during mitosis (extended data videos 1-6), and because VRK-1::wrmScarlet photobleached rapidly, we were unable to perform a quantitative analysis and therefore cannot rule out subtle defects in localization or morphology. Because mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function are broadly unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA were severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localization was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wild type, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localization, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, raising the possibility that nucleosome binding is mediated by multiple regions of the protein. Alternatively, VRK-1 recruitment to chromatin could be mediated by cofactors absent in mammalian systems. Because we limited our study largely to VRK-1 localisation experiments, we cannot rule out other aspects such as kinase activity or protein turnover are affected in this mutant and a more detailed examination will be required in the future. For example, histone phosphorylation at H3T3 or H3S10 could still be affected in these mutants even if overall VRK-1 localization appears unchanged.
Visual inspection of animal locomotion suggested that vrk-14R/KA animals appeared lethargic. We therefore performed thrashing assays to quantify locomotion behavior, counting the number of thrashes per animal in liquid over 30 s. We found a significant reduction (34%) in VRK-14R/KA L4 larvae compared to WT ones (Fig. 1f), indicating impaired motor function. Because the phenotypes caused by the vast majority of disease-causing VRK1 variants become progressively more severe over time in patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans. We measured thrashing over 30 s on days 1, 3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutant animals showed a progressive and significant decline over time, and moved significantly less than WT ones (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviors, coiling for several seconds every 30 s to 1 min before resuming movement (extended data videos 7-8). Notably, we never observed seizure-like behavior after VRK-1 depletion or in VRK-1KD mutants. Of note, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no detectable impact on mitosis. To our knowledge, this is the first analysis of mutations in the disease-associated BAB patch of VRK1 in a model organism, beyond knockdown or null mutants. Therefore, we propose that the VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic functions of VRK-1 and 2) further understanding the etiology of VRK1-associated distal motor neuron diseases and VRK-related epilepsy. Future studies should pursue a more systematic analysis of behavior in these mutants, coupled with the examination of muscle and nervous system architectures, including motor neuron morphology and function, to identify the perturbed molecular pathways.
","references":[{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villasenor R, Sankar DS, Stumpe M, et al., Meister P. . Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin. bioRxiv","pubmedId":"","doi":""},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"}],"title":"Human disease-relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"c3f942ac-5f0f-405a-a259-2b7dd360523a","decision":"revise","abstract":"Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, and show that these cause progressive motor defects in C. elegans that are largely independent of mitotic issues. Our experiments suggest that this VRK-1 mutant will be a useful tool for dissecting the etiology of VRK1-related neurological disorders. In addition, we report the discovery of dynamic late anaphase/early telophase VRK-1 “bridges” in C. elegans embryos and present high temporal resolution videos of VRK-1 localization during mitosis.
","acknowledgements":"","authors":[{"affiliations":["University of Bern"],"departments":["Institute of Cell Biology",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Videos 1/2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
Extended Data Videos 3/4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80 frames, 1.6 s interval, 126 s total.
Extended Data Stills from Videos 1 to 6
Contact sheets of the six VRK-1::eGFP timelapse movies, videos 1–6 top to bottom (labelled on the right side of the images). Each block of twelve panels is drawn from one movie by sampling twelve frame indices spaced evenly across the full acquired sequence, including the first and last frames; panels read left to right, top to bottom. Mitotic stage is labelled on the left side of the images. Sampling interval and elapsed time per block: videos 1 and 5, every 7th frame of 80 (0–126 s); video 2, every 7th–8th frame of 81 (0–128 s); videos 3 and 4, every 5th–6th frame of 60 (0–94 s); video 6, every 9th frame of 100 (0–158 s). All six movies were acquired at a common 1.6 s interval. Scale bar 2 µm.
This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
(a) Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1), showing the kinase domain and the C-terminal intrinsically disordered region (IDR). The conserved basic-acidic-basic (BAB) patch is indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet animals. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the same timepoint (Students t-test).
","imageTitle":"VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedures, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments with vrk-1::mScarlet were performed in the his-72::gfp background. Strains and reagents for strain generation are described in extended data tables.
Strain generation
CRISPR-Cas9 mutagenesis was performed using co-CRISPR, as described previously (Smith et al., n.d.). For VRK-1::eGFP, eGFP was amplified with either 5’ or 3’ VRK-1 homology using primers rPM2149/rPM2152 and PCR products were annealed at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 5’ and 3’ sides of the C-terminal insertion site.
Confocal microscopy
Embryos or L3 larvae were mounted on 2% agarose pads for imaging. Mitotic embryos were imaged at approximately the 50-100 cell stage. For larvae, levamisole was added to agarose at a final concentration of 5 mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements Denoise.ai software.
Brood size assay
L3 worms synchronized by egg lay were transferred to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistical analyes were performed using Students-t test in Graphpad Prism.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated life stage were added to the wells and allowed to acclimatise for approximately 10 minutes. Worms were censored if they failed to thrash properly after this period, as this indicates damage from the transfer. The number of thrashes was counted manually over a period of 30 s, one thrash was defined as a complete left-right-left cycle. For older adults (d3 and d5), mothers were transferred to fresh plates every two days after reaching adulthood to separate them from their progeny. Statistical analyses were performed using Students-t test in Graphpad Prism between genotypes, and one-way ANOVA within the same genotype over time.
Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III. | |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127[vrk-1(K371A) (K372A) (R376A) (R378A)::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Primers, CRISPR guides and restriction enzymes used in this study
Name | Sequence (5’-3’) | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5’ homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3’ homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests the 4R/KA PCR product twice, the WT product once | NEB |
VRK1 is a serine/threonine chromatin-binding kinase with roles in a range of biological processes, including mitosis and cell cycle progression, the DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localized in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminal region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants in or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminal region of C. elegans VRK-1 impair animal motor function without causing detectable mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in hypodermal nuclei, where chromatin becomes highly enriched at the nuclear periphery - a phenotype suppressed by depletion of BAF-1, a key nuclear envelope substrate of VRK-1 (Smith et al., n.d.). Several other reports suggest the VRK-1/BAF-1 signaling axis is critical for detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone-modifying enzymes as well as histones H3 and H2A themselves (Lazo, 2024). hVRK1 has been shown to bind the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 with mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show that H3 threonine 3 phosphorylation is reduced by approximately 50% in VRK14RA mutants, whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). Because these substitutions abolish nucleosome binding while leaving BAF phosphorylation intact in vitro, they offer a way to probe the contribution of VRK-1 to chromatin architecture independently of the BAF-1 signaling axis. We therefore used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b). We note that these substitutions were designed to abolish nucleosome binding rather than to mimic a specific patient variant: mutation of the first arginine of the human BAB patch (R387H) is linked to distal hereditary motor neuropathy, whereas the remaining three residues have not been associated with disease.
To assess whether the 4R/KA substitutions affect chromatin binding, we compared the localization of the mutant VRK-1 with that of GFP-tagged histone H3 (HIS-72::GFP), used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::mScarlet associates with the nuclear envelope during prophase and early metaphase. Later in metaphase, WT VRK-1::mScarlet no longer strongly associates with chromatin, but reassociates during anaphase, often becoming enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence studies of VRK-1 localization during mitosis in C. elegans, indicating that VRK-1::wrmScarlet recapitulates the localization of the endogenous protein (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 s temporal resolution, we observed the same pattern of VRK-1 localization as described above, although we noted that the localization pattern of VRK-1 during each of the four main stages of mitosis, and also across these stages, is highly dynamic (extended data videos 1-6). During anaphase, VRK-1::eGFP bridges are present and dynamic, forming during mid-anaphase before disappearing, likely in the anaphase to telophase transition. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in nematodes expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are unlikely artifacts of live-imaging or tagging.
In contrast to hVRK14RA and to our surprise, the localization of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to that of WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Because WT VRK-1::eGFP localization changed rapidly and dynamically during mitosis (extended data videos 1-6), and because VRK-1::wrmScarlet photobleached rapidly, we were unable to perform a quantitative analysis and therefore cannot rule out subtle defects in localization or morphology. Because mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function are broadly unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA were severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localization was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wild type, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localization, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, raising the possibility that nucleosome binding is mediated by multiple regions of the protein. Alternatively, VRK-1 recruitment to chromatin could be mediated by cofactors absent in mammalian systems. Because we limited our study largely to VRK-1 localisation experiments, we cannot rule out other aspects such as kinase activity or protein turnover are affected in this mutant and a more detailed examination will be required in the future. For example, histone phosphorylation at H3T3 or H3S10 could still be affected in these mutants even if overall VRK-1 localization appears unchanged.
Visual inspection of animal locomotion suggested that vrk-14R/KA animals appeared lethargic. We therefore performed thrashing assays to quantify locomotion behavior, counting the number of thrashes per animal in liquid over 30 s. We found a significant reduction (34%) in VRK-14R/KA L4 larvae compared to WT ones (Fig. 1f), indicating impaired motor function. Because the phenotypes caused by the vast majority of disease-causing VRK1 variants become progressively more severe over time in patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans. We measured thrashing over 30 s on days 1, 3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutant animals showed a progressive and significant decline over time, and moved significantly less than WT ones (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviors, coiling for several seconds every 30 s to 1 min before resuming movement (extended data videos 7-8). Notably, we never observed seizure-like behavior after VRK-1 depletion or in VRK-1KD mutants. Of note, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no detectable impact on mitosis. To our knowledge, this is the first analysis of mutations in the disease-associated BAB patch of VRK1 in a model organism, beyond knockdown or null mutants. Therefore, we propose that the VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic functions of VRK-1 and 2) further understanding the etiology of VRK1-associated distal motor neuron diseases and VRK-related epilepsy. Future studies should pursue a more systematic analysis of behavior in these mutants, coupled with the examination of muscle and nervous system architectures, including motor neuron morphology and function, to identify the perturbed molecular pathways.
","references":[{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villasenor R, Sankar DS, Stumpe M, et al., Meister P. . Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin. bioRxiv","pubmedId":"","doi":""},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"}],"title":"Human disease-relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"9f747527-66fa-4a1a-8986-f2a32c6bcbcc","decision":"revise","abstract":"Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, and show that these cause progressive motor defects in C. elegans that are largely independent of mitotic issues. Our experiments suggest that this VRK-1 mutant will be a useful tool for dissecting the etiology of VRK1-related neurological disorders. In addition, we report VRK-1-positive strands that span the separating chromosome masses during anaphase in C. elegans embryos, and present high temporal resolution videos of VRK-1 localization during mitosis.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["University of Bern"],"departments":["Institute of Cell Biology",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Videos 3.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_3.avi","url":"https://portal.micropublication.org/uploads/bb1bd280cf4342053a5272a3f62b696b.avi"},{"description":"Extended Data Videos 1.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_1.avi","url":"https://portal.micropublication.org/uploads/a6fc3c1cb4efb141e0547caa58a7a19c.avi"},{"description":"Extended Data Videos 2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_2.avi","url":"https://portal.micropublication.org/uploads/cc7f63445ca0d8a966e949ba958e0d7d.avi"},{"description":"Extended Data Videos 4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_4.avi","url":"https://portal.micropublication.org/uploads/f74447ceb993fabb6b527725591dbe68.avi"},{"description":"Extended Data Videos 5.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80 frames, 1.6 s interval, 126 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_5.avi","url":"https://portal.micropublication.org/uploads/457c5b1df8b413a1a3d6751087f79ec3.avi"},{"description":"Extended Data Videos 6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80 frames, 1.6 s interval, 126 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_6.avi","url":"https://portal.micropublication.org/uploads/a8844df1c46c5ae1efc26a9e5ec5ee8f.avi"},{"description":"Extended Data Video 7.
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
Extended Data Video 8.
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
Extended Data Videos 1/2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
Extended Data Videos 3/4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80/100 frames, 126/158 s total, both at 1.6 s interval.
Extended Data Stills from Videos 1 to 6
Contact sheets of the six VRK-1::eGFP timelapse movies, videos 1–6 top to bottom (labelled on the left side of the images). Each block of twelve panels is drawn from one movie by sampling twelve frame indices spaced evenly across the full acquired sequence, including the first and last frames; panels read left to right, top to bottom. Mitotic stage is labelled on the left side of the images. Sampling interval and elapsed time per block: videos 1 and 5, every 7th frame of 80 (0–126 s); video 2, every 7th–8th frame of 81 (0–128 s); videos 3 and 4, every 5th–6th frame of 60 (0–94 s); video 6, every 9th frame of 100 (0–158 s). All six movies were acquired at a common 1.6 s interval. Scale bar 2 µm (bottom right).
Extended Data Stills from Videos 1 to 6 (all frames)
Contact sheets of the six VRK-1::eGFP timelapse movies showing all frames (panels read left to right, top to bottom).
Extended Data Videos 7/8 (nematode behaviour)
Extended Data Video 7
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
Extended Data Video 8
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1), showing the kinase domain and the C-terminal intrinsically disordered region (IDR). The conserved basic-acidic-basic (BAB) patch is indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet animals. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the same timepoint (Students t-test).
","imageTitle":"VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedures, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments with vrk-1::mScarlet were performed in the his-72::gfp background. Strains and reagents for strain generation are described in extended data tables.
Strain generation
CRISPR-Cas9 mutagenesis was performed using co-CRISPR, as described previously (Smith et al., n.d.). For VRK-1::eGFP, eGFP was amplified with either 5’ or 3’ VRK-1 homology using primers rPM2149/rPM2152 and PCR products were annealed at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 5’ and 3’ sides of the C-terminal insertion site.
Confocal microscopy
Embryos or L3 larvae were mounted on 2% agarose pads for imaging. Mitotic embryos were imaged at approximately the 50-100 cell stage. For larvae, levamisole was added to agarose at a final concentration of 5 mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements Denoise.ai software.
Brood size assay
L3 worms synchronized by egg lay were transferred to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistical analyses were performed using Students-t test in Graphpad Prism.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated life stage were added to the wells and allowed to acclimatise for approximately 10 minutes. Worms were censored if they failed to thrash properly after this period, as this indicates damage from the transfer. The number of thrashes was counted manually over a period of 30 s, one thrash was defined as a complete left-right-left cycle. For older adults (d3 and d5), mothers were transferred to fresh plates every two days after reaching adulthood to separate them from their progeny. Statistical analyses were performed using Students-t test in Graphpad Prism between genotypes, and one-way ANOVA within the same genotype over time.
Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III. | |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127[vrk-1(K371A) (K372A) (R376A) (R378A)::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Primers, CRISPR guides and restriction enzymes used in this study
Name | Sequence (5’-3’) | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5’ homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3’ homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests the 4R/KA PCR product twice, the WT product once | NEB |
VRK1 is a serine/threonine chromatin-binding kinase with roles in a range of biological processes, including mitosis and cell cycle progression, the DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localized in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminal region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants in or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminal region of C. elegans VRK-1 impair animal motor function without causing detectable mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in hypodermal nuclei, where chromatin becomes highly enriched at the nuclear periphery - a phenotype suppressed by depletion of BAF-1, a key nuclear envelope substrate of VRK-1 (Smith et al., n.d.). Several other reports suggest the VRK-1/BAF-1 signaling axis is critical for detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone-modifying enzymes as well as histones H3 and H2A themselves (Lazo, 2024). hVRK1 has been shown to bind the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 with mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show that H3 threonine 3 phosphorylation is reduced by approximately 50% in VRK14RA mutants, whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). Because these substitutions abolish nucleosome binding while leaving BAF phosphorylation intact in vitro, they offer a way to probe the contribution of VRK-1 to chromatin architecture independently of the BAF-1 signaling axis. We therefore used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b). We note that these substitutions were designed to abolish nucleosome binding rather than to mimic a specific patient variant: mutation of the first arginine of the human BAB patch (R387H) is linked to distal hereditary motor neuropathy, whereas the remaining three residues have not been associated with disease.
To assess whether the 4R/KA substitutions affect chromatin binding, we compared the localization of the mutant VRK-1 with that of GFP-tagged histone H3 (HIS-72::GFP), used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::mScarlet associates with the nuclear envelope during prophase and early metaphase. Later in metaphase, WT VRK-1::mScarlet no longer strongly associates with chromatin, but reassociates during anaphase, often becoming enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence studies of VRK-1 localization during mitosis in C. elegans, indicating that VRK-1::wrmScarlet recapitulates the localization of the endogenous protein (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). In the two-colour images in Fig. 1c, HIS-72::GFP was not detectable above the local background along these VRK-1-positive strands in either VRK-1::wrmScarlet or VRK-14R/KA::wrmScarlet embryos, with histone signal there below approximately 10% and 2% respectively of that over the adjacent chromosome masses, whereas VRK-1::wrmScarlet along the same pixels reached roughly one third to two thirds of its own level over chromosome masses. As these are single optical sections of denoised images, we cannot exclude a histone-containing structure below our detection limit; however, our quantifications suggest that the strands are largely histone-negative. Histone-depleted connections between separating chromosomes have been described as ultrafine DNA bridges in other systems, and we note this as one possible interpretation of the structures we report. To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 s temporal resolution, VRK-1::eGFP showed the same overall distribution described above, and resolved changes in localization that are not apparent in fixed material (extended data videos 1-6). During prophase, VRK-1::eGFP redistributes from the nucleoplasm to the nuclear periphery over approximately one minute, and transient VRK-1::eGFP foci appear and disappear at the nuclear periphery between consecutive frames (extended data videos 1/2). On entry into metaphase, the peripheral signal weakens and becomes discontinuous, and VRK-1::eGFP-positive structures are transiently detected across the nuclear space (extended data videos 3/4). During anaphase, a VRK-1::eGFP-positive strand spans the separating chromosome masses (extended data videos 5/6). In both timelapses this strand was present over several consecutive frames, on the order of 40 to 60 s, thinning and changing shape as the masses moved apart, and was no longer detectable while the masses continued to separate. Because these timelapses were acquired in a single channel, we cannot assign these events relative to anaphase onset or to the anaphase-to-telophase transition, and we therefore describe them relative to chromosome separation only. Establishing it would require additional markers, which we have not examined here. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in nematodes expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are unlikely artifacts of live-imaging or tagging.
In contrast to hVRK14RA and to our surprise, the localization of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to that of WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Because WT VRK-1::eGFP localization changed rapidly between frames (extended data videos 1-6), and because VRK-1::wrmScarlet photobleached rapidly, we were unable to perform a quantitative analysis and therefore cannot rule out subtle defects in localization or morphology. Because mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function are broadly unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA were severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localization was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wild type, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localization, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, raising the possibility that nucleosome binding is mediated by multiple regions of the protein. Alternatively, VRK-1 recruitment to chromatin could be mediated by cofactors absent in mammalian systems. Because we limited our study largely to VRK-1 localisation experiments, we cannot rule out other aspects such as kinase activity or protein turnover are affected in this mutant and a more detailed examination will be required in the future. For example, histone phosphorylation at H3T3 or H3S10 could still be affected in these mutants even if overall VRK-1 localization appears unchanged.
Visual inspection of animal locomotion suggested that vrk-14R/KA animals appeared lethargic. We therefore performed thrashing assays to quantify locomotion behavior, counting the number of thrashes per animal in liquid over 30 s. We found a significant reduction (34%) in VRK-14R/KA L4 larvae compared to WT ones (Fig. 1f), indicating impaired motor function. Because the phenotypes caused by the vast majority of disease-causing VRK1 variants become progressively more severe over time in patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans. We measured thrashing over 30 s on days 1, 3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutant animals showed a progressive and significant decline over time, and moved significantly less than WT ones (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviors, coiling for several seconds every 30 s to 1 min before resuming movement (extended data videos 7-8). Notably, we never observed seizure-like behavior after VRK-1 depletion or in VRK-1KD mutants. Of note, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no detectable impact on mitosis. To our knowledge, this is the first analysis of mutations in the disease-associated BAB patch of VRK1 in a model organism, beyond knockdown or null mutants. Therefore, we propose that the VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic functions of VRK-1 and 2) further understanding the etiology of VRK1-associated distal motor neuron diseases and VRK-related epilepsy. Future studies should pursue a more systematic analysis of behavior in these mutants, coupled with the examination of muscle and nervous system architectures, including motor neuron morphology and function, to identify the perturbed molecular pathways.
","references":[{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villasenor R, Sankar DS, Stumpe M, et al., Meister P. . Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin. bioRxiv","pubmedId":"","doi":""},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"}],"title":"Human disease-relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"ecfd31d1-ee05-43e9-a2f6-e9cbbb353cc7","decision":"edit","abstract":"Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, and show that these cause progressive motor defects in C. elegans that are largely independent of mitotic issues. Our experiments suggest that this VRK-1 mutant will be a useful tool for dissecting the etiology of VRK1-related neurological disorders. In addition, we report VRK-1-positive strands that span the separating chromosome masses during anaphase in C. elegans embryos, and present high temporal resolution videos of VRK-1 localization during mitosis.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["University of Bern"],"departments":["Institute of Cell Biology",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Videos 1/2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
Extended Data Videos 3/4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80/100 frames, 126/158 s total, both at 1.6 s interval.
Extended Data Stills from Videos 1 to 6
Contact sheets of the six VRK-1::eGFP timelapse movies, videos 1–6 top to bottom (labelled on the left side of the images). Each block of twelve panels is drawn from one movie by sampling twelve frame indices spaced evenly across the full acquired sequence, including the first and last frames; panels read left to right, top to bottom. Mitotic stage is labelled on the left side of the images. Sampling interval and elapsed time per block: videos 1 and 5, every 7th frame of 80 (0–126 s); video 2, every 7th–8th frame of 81 (0–128 s); videos 3 and 4, every 5th–6th frame of 60 (0–94 s); video 6, every 9th frame of 100 (0–158 s). All six movies were acquired at a common 1.6 s interval. Scale bar 2 µm (bottom right).
Extended Data Stills from Videos 1 to 6 (all frames)
Contact sheets of the six VRK-1::eGFP timelapse movies showing all frames (panels read left to right, top to bottom).
Extended Data Videos 7/8 (nematode behaviour)
Extended Data Video 7
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
Extended Data Video 8
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
Extended Data Videos 1.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_1.mp4","url":"https://portal.micropublication.org/uploads/68f42a5e7ac987dc43d11f97c752cd46.mp4"},{"description":"Extended Data Videos 2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_2.mp4","url":"https://portal.micropublication.org/uploads/85491ae53688b26da2ac87df9595ee78.mp4"},{"description":"Extended Data Videos 3.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_3.mp4","url":"https://portal.micropublication.org/uploads/d265d72c980121f2a3c1be4d9357f8e1.mp4"},{"description":"Extended Data Videos 4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_4.mp4","url":"https://portal.micropublication.org/uploads/70f26a2f0cf284f8c45409d7b1e83a1c.mp4"},{"description":"Extended Data Videos 5.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80 frames, 126 s total, both at 1.6 s interval.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_5.mp4","url":"https://portal.micropublication.org/uploads/da3cac7b06469602d79ff68d804935b8.mp4"},{"description":"Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 100 frames, 158 s total, both at 1.6 s interval.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_6.mp4","url":"https://portal.micropublication.org/uploads/062d982c6687f3b3345bc7408799ff77.mp4"},{"description":"Extended Data Video 7
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_7.mp4","url":"https://portal.micropublication.org/uploads/89b7400353c9342615c8cb00297afcd0.mp4"},{"description":"Extended Data Video 8
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_8.mp4","url":"https://portal.micropublication.org/uploads/1a242982cc3983beda7ccd304f2e4ce6.mp4"}],"funding":"This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1), showing the kinase domain and the C-terminal intrinsically disordered region (IDR). The conserved basic-acidic-basic (BAB) patch is indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet animals. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the same timepoint (Students t-test).
","imageTitle":"VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedures, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments with vrk-1::mScarlet were performed in the his-72::gfp background. Strains and reagents for strain generation are described in extended data tables.
Strain generation
CRISPR-Cas9 mutagenesis was performed using co-CRISPR, as described previously (Smith et al., n.d.). For VRK-1::eGFP, eGFP was amplified with either 5' or 3' VRK-1 homology using primers rPM2149/rPM2152 and PCR products were annealed at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 5' and 3' sides of the C-terminal insertion site.
Confocal microscopy
Embryos or L3 larvae were mounted on 2% agarose pads for imaging. Mitotic embryos were imaged at approximately the 50-100 cell stage. For larvae, levamisole was added to agarose at a final concentration of 5 mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements Denoise.ai software.
Brood size assay
L3 worms synchronized by egg lay were transferred to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistical analyses were performed using Students-t test in Graphpad Prism.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated life stage were added to the wells and allowed to acclimatise for approximately 10 minutes. Worms were censored if they failed to thrash properly after this period, as this indicates damage from the transfer. The number of thrashes was counted manually over a period of 30 s, one thrash was defined as a complete left-right-left cycle. For older adults (d3 and d5), mothers were transferred to fresh plates every two days after reaching adulthood to separate them from their progeny. Statistical analyses were performed using Students-t test in Graphpad Prism between genotypes, and one-way ANOVA within the same genotype over time.
Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III. | |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127[vrk-1(K371A) (K372A) (R376A) (R378A)::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Primers, CRISPR guides and restriction enzymes used in this study
Name | Sequence (5'-3') | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5' homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3' homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests the 4R/KA PCR product twice, the WT product once | NEB |
VRK1 is a serine/threonine chromatin-binding kinase with roles in a range of biological processes, including mitosis and cell cycle progression, the DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localized in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminal region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants in or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminal region of C. elegans VRK-1 impair animal motor function without causing detectable mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in hypodermal nuclei, where chromatin becomes highly enriched at the nuclear periphery - a phenotype suppressed by depletion of BAF-1, a key nuclear envelope substrate of VRK-1 (Smith et al., n.d.). Several other reports suggest the VRK-1/BAF-1 signaling axis is critical for detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone-modifying enzymes as well as histones H3 and H2A themselves (Lazo, 2024). hVRK1 has been shown to bind the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 with mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show that H3 threonine 3 phosphorylation is reduced by approximately 50% in VRK14RA mutants, whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). Because these substitutions abolish nucleosome binding while leaving BAF phosphorylation intact in vitro, they offer a way to probe the contribution of VRK-1 to chromatin architecture independently of the BAF-1 signaling axis. We therefore used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b). We note that these substitutions were designed to abolish nucleosome binding rather than to mimic a specific patient variant: mutation of the first arginine of the human BAB patch (R387H) is linked to distal hereditary motor neuropathy, whereas the remaining three residues have not been associated with disease.
To assess whether the 4R/KA substitutions affect chromatin binding, we compared the localization of the mutant VRK-1 with that of GFP-tagged histone H3 (HIS-72::GFP), used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::mScarlet associates with the nuclear envelope during prophase and early metaphase. Later in metaphase, WT VRK-1::mScarlet no longer strongly associates with chromatin, but reassociates during anaphase, often becoming enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence studies of VRK-1 localization during mitosis in C. elegans, indicating that VRK-1::wrmScarlet recapitulates the localization of the endogenous protein (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). In the two-colour images in Fig. 1c, HIS-72::GFP was not detectable above the local background along these VRK-1-positive strands in either VRK-1::wrmScarlet or VRK-14R/KA::wrmScarlet embryos, with histone signal there below approximately 10% and 2% respectively of that over the adjacent chromosome masses, whereas VRK-1::wrmScarlet along the same pixels reached roughly one third to two thirds of its own level over chromosome masses. As these are single optical sections of denoised images, we cannot exclude a histone-containing structure below our detection limit; however, our quantifications suggest that the strands are largely histone-negative. Histone-depleted connections between separating chromosomes have been described as ultrafine DNA bridges in other systems, and we note this as one possible interpretation of the structures we report. To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 s temporal resolution, VRK-1::eGFP showed the same overall distribution described above, and resolved changes in localization that are not apparent in fixed material (extended data videos 1-6). During prophase, VRK-1::eGFP redistributes from the nucleoplasm to the nuclear periphery over approximately one minute, and transient VRK-1::eGFP foci appear and disappear at the nuclear periphery between consecutive frames (extended data videos 1/2). On entry into metaphase, the peripheral signal weakens and becomes discontinuous, and VRK-1::eGFP-positive structures are transiently detected across the nuclear space (extended data videos 3/4). During anaphase, a VRK-1::eGFP-positive strand spans the separating chromosome masses (extended data videos 5/6). In both timelapses this strand was present over several consecutive frames, on the order of 40 to 60 s, thinning and changing shape as the masses moved apart, and was no longer detectable while the masses continued to separate. Because these timelapses were acquired in a single channel, we cannot assign these events relative to anaphase onset or to the anaphase-to-telophase transition, and we therefore describe them relative to chromosome separation only. Establishing it would require additional markers, which we have not examined here. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in nematodes expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are unlikely artifacts of live-imaging or tagging. Our preliminary observations of VRK-1-positive bridge-like connections between chromosome masses, in animals that show no embryonic lethality, are provocative and will require further investigation to document their frequency and to understand their nature and significance.
In contrast to hVRK14RA and to our surprise, the localization of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to that of WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Because WT VRK-1::eGFP localization changed rapidly between frames (extended data videos 1-6), and because VRK-1::wrmScarlet photobleached rapidly, we were unable to perform a quantitative analysis and therefore cannot rule out subtle defects in localization or morphology. Because mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function are broadly unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA were severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localization was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wild type, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localization, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, raising the possibility that nucleosome binding is mediated by multiple regions of the protein. Alternatively, VRK-1 recruitment to chromatin could be mediated by cofactors absent in mammalian systems. Because we limited our study largely to VRK-1 localisation experiments, we cannot rule out other aspects such as kinase activity or protein turnover are affected in this mutant and a more detailed examination will be required in the future. For example, histone phosphorylation at H3T3 or H3S10 could still be affected in these mutants even if overall VRK-1 localization appears unchanged.
Visual inspection of animal locomotion suggested that vrk-14R/KA animals appeared lethargic. We therefore performed thrashing assays to quantify locomotion behavior, counting the number of thrashes per animal in liquid over 30 s. We found a significant reduction (34%) in VRK-14R/KA L4 larvae compared to WT ones (Fig. 1f), indicating impaired motor function. Because the phenotypes caused by the vast majority of disease-causing VRK1 variants become progressively more severe over time in patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans. We measured thrashing over 30 s on days 1, 3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutant animals showed a progressive and significant decline over time, and moved significantly less than WT ones (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviors, coiling for several seconds every 30 s to 1 min before resuming movement (extended data videos 7-8). Notably, we never observed seizure-like behavior after VRK-1 depletion or in VRK-1KD mutants. Of note, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no detectable impact on mitosis. To our knowledge, this is the first analysis of mutations in the disease-associated BAB patch of VRK1 in a model organism, beyond knockdown or null mutants. Therefore, we propose that the VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic functions of VRK-1 and 2) further understanding the etiology of VRK1-associated distal motor neuron diseases and VRK-related epilepsy. Future studies should pursue a more systematic analysis of behavior in these mutants, coupled with the examination of muscle and nervous system architectures, including motor neuron morphology and function, to identify the perturbed molecular pathways.
","references":[{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villasenor R, Sankar DS, Stumpe M, et al., Meister P. . Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin. bioRxiv","pubmedId":"","doi":""},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"}],"title":"Human disease-relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1793065638978"},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":"1792976991433"}]},{"id":"34dc91fd-7815-4253-a99a-b68aa7b49041","decision":"accept","abstract":"Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, and show that these cause progressive motor defects in C. elegans that are largely independent of mitotic issues. Our experiments suggest that this VRK-1 mutant will be a useful tool for dissecting the etiology of VRK1-related neurological disorders. In addition, we report VRK-1-positive strands that span the separating chromosome masses during anaphase in C. elegans embryos, and present high temporal resolution videos of VRK-1 localization during mitosis.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["University of Bern"],"departments":["Institute of Cell Biology",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Videos 1/2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
Extended Data Videos 3/4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80/100 frames, 126/158 s total, both at 1.6 s interval.
Extended Data Stills from Videos 1 to 6
Contact sheets of the six VRK-1::eGFP timelapse movies, videos 1–6 top to bottom (labelled on the left side of the images). Each block of twelve panels is drawn from one movie by sampling twelve frame indices spaced evenly across the full acquired sequence, including the first and last frames; panels read left to right, top to bottom. Mitotic stage is labelled on the left side of the images. Sampling interval and elapsed time per block: videos 1 and 5, every 7th frame of 80 (0–126 s); video 2, every 7th–8th frame of 81 (0–128 s); videos 3 and 4, every 5th–6th frame of 60 (0–94 s); video 6, every 9th frame of 100 (0–158 s). All six movies were acquired at a common 1.6 s interval. Scale bar 2 µm (bottom right).
Extended Data Stills from Videos 1 to 6 (all frames)
Contact sheets of the six VRK-1::eGFP timelapse movies showing all frames (panels read left to right, top to bottom).
Extended Data Videos 7/8 (nematode behaviour)
Extended Data Video 7
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
Extended Data Video 8
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
Extended Data Videos 1.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_1.mp4","url":"https://portal.micropublication.org/uploads/68f42a5e7ac987dc43d11f97c752cd46.mp4"},{"description":"Extended Data Videos 2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_2.mp4","url":"https://portal.micropublication.org/uploads/85491ae53688b26da2ac87df9595ee78.mp4"},{"description":"Extended Data Videos 3.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_3.mp4","url":"https://portal.micropublication.org/uploads/d265d72c980121f2a3c1be4d9357f8e1.mp4"},{"description":"Extended Data Videos 4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_4.mp4","url":"https://portal.micropublication.org/uploads/70f26a2f0cf284f8c45409d7b1e83a1c.mp4"},{"description":"Extended Data Videos 5.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80 frames, 126 s total, both at 1.6 s interval.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_5.mp4","url":"https://portal.micropublication.org/uploads/da3cac7b06469602d79ff68d804935b8.mp4"},{"description":"Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 100 frames, 158 s total, both at 1.6 s interval.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_6.mp4","url":"https://portal.micropublication.org/uploads/062d982c6687f3b3345bc7408799ff77.mp4"},{"description":"Extended Data Video 7
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_7.mp4","url":"https://portal.micropublication.org/uploads/89b7400353c9342615c8cb00297afcd0.mp4"},{"description":"Extended Data Video 8
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
","doi":null,"resourceType":"Audiovisual","name":"Extended_Data_Video_8.mp4","url":"https://portal.micropublication.org/uploads/1a242982cc3983beda7ccd304f2e4ce6.mp4"}],"funding":"This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1), showing the kinase domain and the C-terminal intrinsically disordered region (IDR). The conserved basic-acidic-basic (BAB) patch is indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet animals. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the same timepoint (Students t-test).
","imageTitle":"VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedures, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments with vrk-1::mScarlet were performed in the his-72::gfp background. Strains and reagents for strain generation are described in extended data tables.
Strain generation
CRISPR-Cas9 mutagenesis was performed using co-CRISPR, as described previously (Smith et al., n.d.). For VRK-1::eGFP, eGFP was amplified with either 5' or 3' VRK-1 homology using primers rPM2149/rPM2152 and PCR products were annealed at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 5' and 3' sides of the C-terminal insertion site.
Confocal microscopy
Embryos or L3 larvae were mounted on 2% agarose pads for imaging. Mitotic embryos were imaged at approximately the 50-100 cell stage. For larvae, levamisole was added to agarose at a final concentration of 5 mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements Denoise.ai software.
Brood size assay
L3 worms synchronized by egg lay were transferred to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistical analyses were performed using Students-t test in Graphpad Prism.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated life stage were added to the wells and allowed to acclimatise for approximately 10 minutes. Worms were censored if they failed to thrash properly after this period, as this indicates damage from the transfer. The number of thrashes was counted manually over a period of 30 s, one thrash was defined as a complete left-right-left cycle. For older adults (d3 and d5), mothers were transferred to fresh plates every two days after reaching adulthood to separate them from their progeny. Statistical analyses were performed using Students-t test in Graphpad Prism between genotypes, and one-way ANOVA within the same genotype over time.
Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III. | |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127[vrk-1(K371A) (K372A) (R376A) (R378A)::w>Scar>let]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Primers, CRISPR guides and restriction enzymes used in this study
Name | Sequence (5'-3') | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5' homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3' homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests the 4R/KA PCR product twice, the WT product once | NEB |
VRK1 is a serine/threonine chromatin-binding kinase with roles in a range of biological processes, including mitosis and cell cycle progression, the DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localized in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminal region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants in or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminal region of C. elegans VRK-1 impair animal motor function without causing detectable mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in hypodermal nuclei, where chromatin becomes highly enriched at the nuclear periphery - a phenotype suppressed by depletion of BAF-1, a key nuclear envelope substrate of VRK-1 (Smith et al., n.d.). Several other reports suggest the VRK-1/BAF-1 signaling axis is critical for detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone-modifying enzymes as well as histones H3 and H2A themselves (Lazo, 2024). hVRK1 has been shown to bind the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 with mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show that H3 threonine 3 phosphorylation is reduced by approximately 50% in VRK14RA mutants, whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). Because these substitutions abolish nucleosome binding while leaving BAF phosphorylation intact in vitro, they offer a way to probe the contribution of VRK-1 to chromatin architecture independently of the BAF-1 signaling axis. We therefore used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b). We note that these substitutions were designed to abolish nucleosome binding rather than to mimic a specific patient variant: mutation of the first arginine of the human BAB patch (R387H) is linked to distal hereditary motor neuropathy, whereas the remaining three residues have not been associated with disease.
To assess whether the 4R/KA substitutions affect chromatin binding, we compared the localization of the mutant VRK-1 with that of GFP-tagged histone H3 (HIS-72::GFP), used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::mScarlet associates with the nuclear envelope during prophase and early metaphase. Later in metaphase, WT VRK-1::mScarlet no longer strongly associates with chromatin, but reassociates during anaphase, often becoming enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence studies of VRK-1 localization during mitosis in C. elegans, indicating that VRK-1::wrmScarlet recapitulates the localization of the endogenous protein (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). In the two-colour images in Fig. 1c, HIS-72::GFP was not detectable above the local background along these VRK-1-positive strands in either VRK-1::wrmScarlet or VRK-14R/KA::wrmScarlet embryos, with histone signal there below approximately 10% and 2% respectively of that over the adjacent chromosome masses, whereas VRK-1::wrmScarlet along the same pixels reached roughly one third to two thirds of its own level over chromosome masses. As these are single optical sections of denoised images, we cannot exclude a histone-containing structure below our detection limit; however, our quantifications suggest that the strands are largely histone-negative. Histone-depleted connections between separating chromosomes have been described as ultrafine DNA bridges in other systems, and we note this as one possible interpretation of the structures we report. To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 s temporal resolution, VRK-1::eGFP showed the same overall distribution described above, and resolved changes in localization that are not apparent in fixed material (extended data videos 1-6). During prophase, VRK-1::eGFP redistributes from the nucleoplasm to the nuclear periphery over approximately one minute, and transient VRK-1::eGFP foci appear and disappear at the nuclear periphery between consecutive frames (extended data videos 1/2). On entry into metaphase, the peripheral signal weakens and becomes discontinuous, and VRK-1::eGFP-positive structures are transiently detected across the nuclear space (extended data videos 3/4). During anaphase, a VRK-1::eGFP-positive strand spans the separating chromosome masses (extended data videos 5/6). In both timelapses this strand was present over several consecutive frames, on the order of 40 to 60 s, thinning and changing shape as the masses moved apart, and was no longer detectable while the masses continued to separate. Because these timelapses were acquired in a single channel, we cannot assign these events relative to anaphase onset or to the anaphase-to-telophase transition, and we therefore describe them relative to chromosome separation only. Establishing it would require additional markers, which we have not examined here. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in nematodes expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are unlikely artifacts of live-imaging or tagging. Our preliminary observations of VRK-1-positive bridge-like connections between chromosome masses, in animals that show no embryonic lethality, are provocative and will require further investigation to document their frequency and to understand their nature and significance.
In contrast to hVRK14RA and to our surprise, the localization of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to that of WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Because WT VRK-1::eGFP localization changed rapidly between frames (extended data videos 1-6), and because VRK-1::wrmScarlet photobleached rapidly, we were unable to perform a quantitative analysis and therefore cannot rule out subtle defects in localization or morphology. Because mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function are broadly unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA were severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localization was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wild type, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localization, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, raising the possibility that nucleosome binding is mediated by multiple regions of the protein. Alternatively, VRK-1 recruitment to chromatin could be mediated by cofactors absent in mammalian systems. Because we limited our study largely to VRK-1 localisation experiments, we cannot rule out other aspects such as kinase activity or protein turnover are affected in this mutant and a more detailed examination will be required in the future. For example, histone phosphorylation at H3T3 or H3S10 could still be affected in these mutants even if overall VRK-1 localization appears unchanged.
Visual inspection of animal locomotion suggested that vrk-14R/KA animals appeared lethargic. We therefore performed thrashing assays to quantify locomotion behavior, counting the number of thrashes per animal in liquid over 30 s. We found a significant reduction (34%) in VRK-14R/KA L4 larvae compared to WT ones (Fig. 1f), indicating impaired motor function. Because the phenotypes caused by the vast majority of disease-causing VRK1 variants become progressively more severe over time in patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans. We measured thrashing over 30 s on days 1, 3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutant animals showed a progressive and significant decline over time, and moved significantly less than WT ones (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviors, coiling for several seconds every 30 s to 1 min before resuming movement (extended data videos 7-8). Notably, we never observed seizure-like behavior after VRK-1 depletion or in VRK-1KD mutants. Of note, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no detectable impact on mitosis. To our knowledge, this is the first analysis of mutations in the disease-associated BAB patch of VRK1 in a model organism, beyond knockdown or null mutants. Therefore, we propose that the VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic functions of VRK-1 and 2) further understanding the etiology of VRK1-associated distal motor neuron diseases and VRK-related epilepsy. Future studies should pursue a more systematic analysis of behavior in these mutants, coupled with the examination of muscle and nervous system architectures, including motor neuron morphology and function, to identify the perturbed molecular pathways.
","references":[{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villaseñor R, Sankar DS, Stumpe M, et al., Meister P. 2026. Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin distribution in C. elegans. bioRxiv: pii: 2026.07.07.737140. 10.64898/2026.07.07.737140.
","pubmedId":"42465445","doi":""},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"}],"title":"Human disease-relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":true,"submitted":"1793138923059"},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"c959cc47-52d8-4051-88e2-282651db507c","decision":"edit","abstract":"Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, and show that these cause progressive motor defects in C. elegans that are largely independent of mitotic issues. Our experiments suggest that this VRK-1 mutant will be a useful tool for dissecting the etiology of VRK1-related neurological disorders. In addition, we report VRK-1-positive strands that span the separating chromosome masses during anaphase in C. elegans embryos, and present high temporal resolution videos of VRK-1 localization during mitosis.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Institute of Cell Biology, University of Bern, Bern, Switzerland"],"departments":["",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern, Bern, Switzerland"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Videos 1/2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
Extended Data Videos 3/4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80/100 frames, 126/158 s total, both at 1.6 s interval.
Extended Data Stills from Videos 1 to 6
Contact sheets of the six VRK-1::eGFP timelapse movies, videos 1–6 top to bottom (labelled on the left side of the images). Each block of twelve panels is drawn from one movie by sampling twelve frame indices spaced evenly across the full acquired sequence, including the first and last frames; panels read left to right, top to bottom. Mitotic stage is labelled on the left side of the images. Sampling interval and elapsed time per block: videos 1 and 5, every 7th frame of 80 (0–126 s); video 2, every 7th–8th frame of 81 (0–128 s); videos 3 and 4, every 5th–6th frame of 60 (0–94 s); video 6, every 9th frame of 100 (0–158 s). All six movies were acquired at a common 1.6 s interval. Scale bar 2 µm (bottom right).
Extended Data Stills from Videos 1 to 6 (all frames)
Contact sheets of the six VRK-1::eGFP timelapse movies showing all frames (panels read left to right, top to bottom).
Extended Data Videos 7/8 (nematode behaviour)
Extended Data Video 7
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
Extended Data Video 8
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
Extended Data Videos 1.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":"10.22002/1tfx3-1ss82","resourceType":"Audiovisual","name":"Extended_Data_Video_1.mp4","url":"https://portal.micropublication.org/uploads/68f42a5e7ac987dc43d11f97c752cd46.mp4"},{"description":"Extended Data Videos 2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":"10.22002/31rsw-30915","resourceType":"Audiovisual","name":"Extended_Data_Video_2.mp4","url":"https://portal.micropublication.org/uploads/85491ae53688b26da2ac87df9595ee78.mp4"},{"description":"Extended Data Videos 3.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":"10.22002/yg5kz-57b30","resourceType":"Audiovisual","name":"Extended_Data_Video_3.mp4","url":"https://portal.micropublication.org/uploads/d265d72c980121f2a3c1be4d9357f8e1.mp4"},{"description":"Extended Data Videos 4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":"10.22002/vxbp3-7m813","resourceType":"Audiovisual","name":"Extended_Data_Video_4.mp4","url":"https://portal.micropublication.org/uploads/70f26a2f0cf284f8c45409d7b1e83a1c.mp4"},{"description":"Extended Data Videos 5.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80 frames, 126 s total, both at 1.6 s interval.
","doi":"10.22002/36kxd-p4605","resourceType":"Audiovisual","name":"Extended_Data_Video_5.mp4","url":"https://portal.micropublication.org/uploads/da3cac7b06469602d79ff68d804935b8.mp4"},{"description":"Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 100 frames, 158 s total, both at 1.6 s interval.
","doi":"10.22002/93p2j-02w17","resourceType":"Audiovisual","name":"Extended_Data_Video_6.mp4","url":"https://portal.micropublication.org/uploads/062d982c6687f3b3345bc7408799ff77.mp4"},{"description":"Extended Data Video 7
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
","doi":"10.22002/ft1x6-aet23","resourceType":"Audiovisual","name":"Extended_Data_Video_7.mp4","url":"https://portal.micropublication.org/uploads/89b7400353c9342615c8cb00297afcd0.mp4"},{"description":"Extended Data Video 8
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
","doi":"10.22002/985j1-jnd18","resourceType":"Audiovisual","name":"Extended_Data_Video_8.mp4","url":"https://portal.micropublication.org/uploads/1a242982cc3983beda7ccd304f2e4ce6.mp4"}],"funding":"This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1), showing the kinase domain and the C-terminal intrinsically disordered region (IDR). The conserved basic-acidic-basic (BAB) patch is indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet animals. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the same timepoint (Students t-test).
","imageTitle":"VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedures, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments with vrk-1::wrmScarlet were performed in the his-72::gfp background. Strains and reagents for strain generation are described in extended data tables.
Strain generation
CRISPR-Cas9 mutagenesis was performed using co-CRISPR, as described previously (Smith et al., 2026 bioRxiv). For VRK-1::eGFP, eGFP was amplified with either 5' or 3' VRK-1 homology using primers rPM2149/rPM2152 and PCR products were annealed at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 5' and 3' sides of the C-terminal insertion site.
Confocal microscopy
Embryos or L3 larvae were mounted on 2% agarose pads for imaging. Mitotic embryos were imaged at approximately the 50-100 cell stage. For larvae, levamisole was added to agarose at a final concentration of 5 mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements Denoise.ai software.
Brood size assay
L3 worms synchronized by egg lay were transferred to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistical analyses were performed using Students-t test in Graphpad Prism.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated life stage were added to the wells and allowed to acclimatise for approximately 10 minutes. Worms were censored if they failed to thrash properly after this period, as this indicates damage from the transfer. The number of thrashes was counted manually over a period of 30 s, one thrash was defined as a complete left-right-left cycle. For older adults (d3 and d5), mothers were transferred to fresh plates every two days after reaching adulthood to separate them from their progeny. Statistical analyses were performed using Students-t test in Graphpad Prism between genotypes, and one-way ANOVA within the same genotype over time.
Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::wrmScarlet]) II; his-72 (uge30[gfp::his-72]) III. | |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127[vrk-1(K371A) (K372A) (R376A) (R378A)::wrmScarlet]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Primers, CRISPR guides and restriction enzymes used in this study
Name | Sequence (5'-3') | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5' homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3' homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests the 4R/KA PCR product twice, the WT product once | NEB |
VRK1 is a serine/threonine chromatin-binding kinase with roles in a range of biological processes, including mitosis and cell cycle progression, the DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localized in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminal region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants in or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminal region of C. elegans VRK-1 impair animal motor function without causing detectable mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in hypodermal nuclei, where chromatin becomes highly enriched at the nuclear periphery - a phenotype suppressed by depletion of BAF-1, a key nuclear envelope substrate of VRK-1 (Smith et al., 2026 bioRxiv). Several other reports suggest the VRK-1/BAF-1 signaling axis is critical for detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone-modifying enzymes as well as histones H3 and H2A themselves (Lazo, 2024). hVRK1 has been shown to bind the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 with mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show that H3 threonine 3 phosphorylation is reduced by approximately 50% in VRK14RA mutants, whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). Because these substitutions abolish nucleosome binding while leaving BAF phosphorylation intact in vitro, they offer a way to probe the contribution of VRK-1 to chromatin architecture independently of the BAF-1 signaling axis. We therefore used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b). We note that these substitutions were designed to abolish nucleosome binding rather than to mimic a specific patient variant: mutation of the first arginine of the human BAB patch (R387H) is linked to distal hereditary motor neuropathy, whereas the remaining three residues have not been associated with disease.
To assess whether the 4R/KA substitutions affect chromatin binding, we compared the localization of the mutant VRK-1 with that of GFP-tagged histone H3 (HIS-72::GFP), used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::wrmScarlet associates with the nuclear envelope during prophase and early metaphase. Later in metaphase, WT VRK-1::wrmScarlet no longer strongly associates with chromatin, but reassociates during anaphase, often becoming enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence studies of VRK-1 localization during mitosis in C. elegans, indicating that VRK-1::wrmScarlet recapitulates the localization of the endogenous protein (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). In the two-colour images in Fig. 1c, HIS-72::GFP was not detectable above the local background along these VRK-1-positive strands in either VRK-1::wrmScarlet or VRK-14R/KA::wrmScarlet embryos, with histone signal there below approximately 10% and 2%, respectively, of that over the adjacent chromosome masses, whereas VRK-1::wrmScarlet along the same pixels reached roughly one third to two thirds of its own level over chromosome masses. As these are single optical sections of denoised images, we cannot exclude a histone-containing structure below our detection limit; however, our quantifications suggest that the strands are largely histone-negative. Histone-depleted connections between separating chromosomes have been described as ultrafine DNA bridges in other systems, and we note this as one possible interpretation of the structures we report. To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 s temporal resolution, VRK-1::eGFP showed the same overall distribution described above, and resolved changes in localization that are not apparent in single snapshots (extended data videos 1-6). During prophase, VRK-1::eGFP redistributes from the nucleoplasm to the nuclear periphery over approximately one minute, and transient VRK-1::eGFP foci appear and disappear at the nuclear periphery between consecutive frames (extended data videos 1/2). On entry into metaphase, the peripheral signal weakens and becomes discontinuous, and VRK-1::eGFP-positive structures are transiently detected across the nuclear space (extended data videos 3/4). During anaphase, a VRK-1::eGFP-positive strand spans the separating chromosome masses (extended data videos 5/6). In both timelapses this strand was present over several consecutive frames, on the order of 40 to 60 s, thinning and changing shape as the masses moved apart, and was no longer detectable while the masses continued to separate. Because these timelapses were acquired in a single channel, we cannot assign these events relative to anaphase onset or to the anaphase-to-telophase transition, and we therefore describe them relative to chromosome separation only. Establishing it would require additional markers, which we have not examined here. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in nematodes expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are unlikely artifacts of live-imaging or tagging. Our preliminary observations of VRK-1-positive bridge-like connections between chromosome masses, in animals that show no embryonic lethality, are provocative and will require further investigation to document their frequency and to understand their nature and significance.
In contrast to hVRK14RA and to our surprise, the localization of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to that of WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Because WT VRK-1::eGFP localization changed rapidly between frames (extended data videos 1-6), and because VRK-1::wrmScarlet photobleached rapidly, we were unable to perform a quantitative analysis and therefore cannot rule out subtle defects in localization or morphology. As mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function are broadly unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA were severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localization was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wild type, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localization, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, raising the possibility that nucleosome binding is mediated by multiple regions of the protein. Alternatively, VRK-1 recruitment to chromatin could be mediated by cofactors absent in mammalian systems. Because we limited our study largely to VRK-1 localisation experiments, we cannot rule out other aspects such as kinase activity or protein turnover are affected in this mutant and a more detailed examination will be required in the future. For example, histone phosphorylation at H3T3 or H3S10 could still be affected in these mutants even if overall VRK-1 localization appears unchanged.
Visual inspection of animal locomotion suggested that vrk-14R/KA animals appeared lethargic. We therefore performed thrashing assays to quantify locomotion behavior, counting the number of thrashes per animal in liquid over 30 s. We found a significant reduction (34%) in VRK-14R/KA L4 larvae compared to WT ones (Fig. 1f), indicating impaired motor function. Because the phenotypes caused by the vast majority of disease-causing VRK1 variants become progressively more severe over time in patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans. We measured thrashing over 30 s on days 1, 3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutant animals showed a progressive and significant decline over time, and moved significantly less than WT ones (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviors, coiling for several seconds every 30 s to 1 min before resuming movement (extended data videos 7-8). Notably, we never observed seizure-like behavior after VRK-1 depletion or in VRK-1KD mutants. Of note, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no detectable impact on mitosis. To our knowledge, this is the first analysis of mutations in the disease-associated BAB patch of VRK1 in a model organism, beyond knockdown or null mutants. Therefore, we propose that the VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic functions of VRK-1 and 2) further understanding the etiology of VRK1-associated distal motor neuron diseases and VRK-related epilepsy. Future studies should pursue a more systematic analysis of behavior in these mutants, coupled with the examination of muscle and nervous system architectures, including motor neuron morphology and function, to identify the perturbed molecular pathways.
","references":[{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villaseñor R, Sankar DS, Stumpe M, et al., Meister P. 2026. Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin distribution in C. elegans. bioRxiv: pii: 2026.07.07.737140. 10.64898/2026.07.07.737140.
","pubmedId":"42465445","doi":""},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"}],"title":"Human disease-relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"90eb0c05-1647-43a4-8daa-09e4aa53117d","decision":"publish","abstract":"Mutations in Vaccinia Related Kinase 1 (VRK1) are associated with distal neuropathies in humans. Here, we report the first example of disease relevant VRK1 mutations in a model organism, and show that these cause progressive motor defects in C. elegans that are largely independent of mitotic issues. Our experiments suggest that this VRK-1 mutant will be a useful tool for dissecting the etiology of VRK1-related neurological disorders. In addition, we report VRK-1-positive strands that span the separating chromosome masses during anaphase in C. elegans embryos, and present high temporal resolution videos of VRK-1 localization during mitosis.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Institute of Cell Biology, University of Bern, Bern, Switzerland"],"departments":["",""],"credit":["investigation","formalAnalysis","dataCuration","writing_originalDraft"],"email":"william.smith@unibe.ch","firstName":"William","lastName":"Smith","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Institute of Cell Biology, University of Bern, Bern, Switzerland"],"departments":[""],"credit":["conceptualization","fundingAcquisition","methodology","investigation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"peter.meister@izb.unibe.ch","firstName":"Peter","lastName":"Meister","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0002-6230-4216"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Videos 1/2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
Extended Data Videos 3/4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80/100 frames, 126/158 s total, both at 1.6 s interval.
Extended Data Stills from Videos 1 to 6
Contact sheets of the six VRK-1::eGFP timelapse movies, videos 1–6 top to bottom (labelled on the left side of the images). Each block of twelve panels is drawn from one movie by sampling twelve frame indices spaced evenly across the full acquired sequence, including the first and last frames; panels read left to right, top to bottom. Mitotic stage is labelled on the left side of the images. Sampling interval and elapsed time per block: videos 1 and 5, every 7th frame of 80 (0–126 s); video 2, every 7th–8th frame of 81 (0–128 s); videos 3 and 4, every 5th–6th frame of 60 (0–94 s); video 6, every 9th frame of 100 (0–158 s). All six movies were acquired at a common 1.6 s interval. Scale bar 2 µm (bottom right).
Extended Data Stills from Videos 1 to 6 (all frames)
Contact sheets of the six VRK-1::eGFP timelapse movies showing all frames (panels read left to right, top to bottom).
Extended Data Videos 7/8 (nematode behaviour)
Extended Data Video 7
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
Extended Data Video 8
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
Extended Data Videos 1.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":"10.22002/1tfx3-1ss82","resourceType":"Audiovisual","name":"Extended_Data_Video_1.mp4","url":"https://portal.micropublication.org/uploads/68f42a5e7ac987dc43d11f97c752cd46.mp4"},{"description":"Extended Data Videos 2.
VRK-1::eGFP relocalizes from the nucleoplasm to the nuclear periphery during prophase. A single nucleus followed through prophase. At the start of the movie VRK-1::eGFP fills the nucleus, with brighter patches over the chromatin and a faint peripheral rim. Over the subsequent ~1 min the nucleoplasmic and chromatin-associated signal declines while the peripheral rim intensifies, so that by the end of the movie VRK-1::eGFP is concentrated almost entirely at the nuclear periphery. 80 frames, 1.6 s interval, 126 s total.
","doi":"10.22002/31rsw-30915","resourceType":"Audiovisual","name":"Extended_Data_Video_2.mp4","url":"https://portal.micropublication.org/uploads/85491ae53688b26da2ac87df9595ee78.mp4"},{"description":"Extended Data Videos 3.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":"10.22002/yg5kz-57b30","resourceType":"Audiovisual","name":"Extended_Data_Video_3.mp4","url":"https://portal.micropublication.org/uploads/d265d72c980121f2a3c1be4d9357f8e1.mp4"},{"description":"Extended Data Videos 4.
Loss and reorganization of peripheral VRK-1::eGFP on entry into metaphase. The bright VRK-1::eGFP rim present at the start of the movie (metaphase) becomes progressively fainter and discontinuous. Internal VRK-1::eGFP-positive structures appear transiently across the nuclear space, the peripheral outline deforms and loses its circular profile, and by the end of the movie only weak, dispersed signal remains. 60 frames, 1.6 s interval, 94 s total.
","doi":"10.22002/vxbp3-7m813","resourceType":"Audiovisual","name":"Extended_Data_Video_4.mp4","url":"https://portal.micropublication.org/uploads/70f26a2f0cf284f8c45409d7b1e83a1c.mp4"},{"description":"Extended Data Videos 5.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 80 frames, 126 s total, both at 1.6 s interval.
","doi":"10.22002/36kxd-p4605","resourceType":"Audiovisual","name":"Extended_Data_Video_5.mp4","url":"https://portal.micropublication.org/uploads/da3cac7b06469602d79ff68d804935b8.mp4"},{"description":"Extended Data Videos 5/6.
VRK-1::eGFP on separating chromosome masses (anaphase), with a transient connecting structure. Two VRK-1::eGFP-positive masses separate progressively over the course of the movie. A thin VRK-1::eGFP-positive strand is transiently visible spanning the two masses while they move apart, and is no longer detectable by the end of the movie. 100 frames, 158 s total, both at 1.6 s interval.
","doi":"10.22002/93p2j-02w17","resourceType":"Audiovisual","name":"Extended_Data_Video_6.mp4","url":"https://portal.micropublication.org/uploads/062d982c6687f3b3345bc7408799ff77.mp4"},{"description":"Extended Data Video 7
Wild-type vrk-1::wrmScarlet animals. [Bright-field] movies of three 1-day old young adult vrk-1::wrmScarlet animals in M9 medium. Movies were recorded at 0.625 frames/s and play at about 14 frames/s. Representative videos of 3 animals out of 21.
","doi":"10.22002/ft1x6-aet23","resourceType":"Audiovisual","name":"Extended_Data_Video_7.mp4","url":"https://portal.micropublication.org/uploads/89b7400353c9342615c8cb00297afcd0.mp4"},{"description":"Extended Data Video 8
vrk-1::wrmScarlet (4R/KA) mutants show seizure-like behavior. Movies of three 1-day old young adult animals carrying the 4R/KA mutation in vrk-1::wrmScarlet, recorded as in Extended Data Video 7. Mutant animals show seizure-like behavior. Representative videos of 3 animals out of 20.
","doi":"10.22002/985j1-jnd18","resourceType":"Audiovisual","name":"Extended_Data_Video_8.mp4","url":"https://portal.micropublication.org/uploads/1a242982cc3983beda7ccd304f2e4ce6.mp4"}],"funding":"This work was funded by the Swiss National Science Foundation 31003A_176226/310030_212472, IZCOZ0_189884, the Uniscientia foundation, the University of Bern and the Novartis Foundation for Medical/Biological Research.
Schematic domain map of human VRK1 (hVRK1) and C. elegans VRK-1 (ceVRK-1), showing the kinase domain and the C-terminal intrinsically disordered region (IDR). The conserved basic-acidic-basic (BAB) patch is indicated in green, as predicted by alignment from (Budziszewski et al., 2022). (b) Amino acid sequence of the BAB in hVRK1 and ceVRK-1, with wildtype residues in green, and mutated residues in red. (c) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (left) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (right) during interphase, prophase, metaphase and anaphase in embryos. (d) Brood size of VRK-1::wrmScarlet (n=7) or VRK-14R/KA::wrmScarlet (n=8), with each point representing the number of progeny from an individual mother. (e) Representative confocal images of VRK-1::wrmScarlet/HIS-72::GFP (upper) or VRK-14R/KA::wrmScarlet/HIS-72::GFP (lower) in hypodermal nuclei of L3 worms. (f) Thrashing assay of WT VRK-1 (n=11) or VRK-14R/KA (n=8) in L4 larvae where each point indicates number of thrashes in 30 seconds for an individual worm. p<0.0001, Students t-test. (g) Thrashing assay in adult animals as described in f, at d1 (n=21, 20), d3 (n=17, 21) and d5 (n=20, 20) of adulthood for WT VRK-1::wrmScarlet or VRK-14R/KAwrmScarlet animals. Indicated p-values are from one-way ANOVA statistical tests comparing d1, d3 and d5 within the same genotype. **** indicates p<0.0001 when comparing VRK-1::wrmScarlet with VRK-14R/KA::wrmScarlet at the same timepoint (Students t-test).
","imageTitle":"VRK-14R/KA mutations result in motor but not mitotic impairment in C. elegans
","methods":"C. elegans maintenance
C. elegans were maintained at 20oC on NGM plates using standard laboratory procedures, as described previously (Brenner, 1974). Worms were maintained for at least three generations in non-starvation conditions before performing experiments. All experiments with vrk-1::wrmScarlet were performed in the his-72::gfp background. Strains and reagents for strain generation are described in extended data tables.
Strain generation
CRISPR-Cas9 mutagenesis was performed using co-CRISPR, as described previously (Smith et al., 2026 bioRxiv). For VRK-1::eGFP, eGFP was amplified with either 5' or 3' VRK-1 homology using primers rPM2149/rPM2152 and PCR products were annealed at equimolar concentrations to obtain eGFP DNA molecules with single stranded homology for both 5' and 3' sides of the C-terminal insertion site.
Confocal microscopy
Embryos or L3 larvae were mounted on 2% agarose pads for imaging. Mitotic embryos were imaged at approximately the 50-100 cell stage. For larvae, levamisole was added to agarose at a final concentration of 5 mM for immobilisation. Images were obtained using Nikon Ti2 Crest v3 spinning disk microscope. Representative images were denoised using NIS elements Denoise.ai software.
Brood size assay
L3 worms synchronized by egg lay were transferred to individual NGM plates. Every two days the mother was moved to a fresh NGM plate. After one day, plates were checked for unhatched embryos. Two to three days after the mother was transferred, the number of progeny was scored. This was repeated until mothers had stopped laying eggs. If mothers disappeared, or were found on the side of the petri dish, they were censored from the assay. Statistical analyses were performed using Students-t test in Graphpad Prism.
Thrashing assay
Animals were synchronized by egg lay. 500 μl of M9 buffer was added to individual wells of a 96-well plate. Individual worms at the indicated life stage were added to the wells and allowed to acclimatise for approximately 10 minutes. Worms were censored if they failed to thrash properly after this period, as this indicates damage from the transfer. The number of thrashes was counted manually over a period of 30 s, one thrash was defined as a complete left-right-left cycle. For older adults (d3 and d5), mothers were transferred to fresh plates every two days after reaching adulthood to separate them from their progeny. Statistical analyses were performed using Students-t test in Graphpad Prism between genotypes, and one-way ANOVA within the same genotype over time.
Supplementary table 1 - C. elegans strains and genotypes used in this study | ||
Strain | Genotype | Source |
PMW1341 | vrk-1(bq28[vrk-1::wrmScarlet]) II; his-72 (uge30[gfp::his-72]) III. | (Smith et al., 2026 bioRxiv) |
PMW1380 | vrk-1(ubs126[vrk-1::eGFP]) II. | This study |
PMW1481 | vrk-1(bq28 ubs127[vrk-1(K371A) (K372A) (R376A) (R378A)::wrmScarlet]) II; his-72 (uge30[gfp::his-72]) III.
| This study |
Primers, CRISPR guides and restriction enzymes used in this study
Name | Sequence (5'-3') | Usage | Source |
cPM105 | TGATGATTCGAGCTGCTCGT | C-terminus VRK-1 CRISPR guide, for eGPF insert | This study |
rPM2149 | ATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer | This study |
rPM2150 | TCATTTGTATAGTTCATCCATGCC | eGFP reverse primer | This study |
rPM2151 | AAAGCCAACATTTGATGATTCGAGCTGCTCGTCAGAAGTGGGATCCGGTGGAGGCGGGTCTGGAGGCGGGGGTAGTGGCGGGGGTGGAATGAGTAAAGGAGAAGAACTTTTCACTGG | eGFP forward primer + VRK-1 5' homology | This study |
rPM2152 | TGTGACTCGATTGAAGATTCCAATGGTTTACACTTTCATTTGTATAGTTCATCCATGCC | eGFP reverse primer + VRK-1 3' homology | This study |
cPM111 | GAGAACTACTCGAAAAGCTG | CRISPR guide for 4R/KA mutations | This study |
rPM2153 | ATAAAGATAATGATGAAGTGGAAGTTAAACCGGAAgcagctGCTACTCCCgctAAGgcaACTACTCGAAAAGCTGTcGAAGTCAACAATGATTCAGATGACaatgaagaac | Repair template for 4R/KA mutations | This study |
rPM1830 | CCGTGGTGATATTGAGATTCTTGCC | 4R/KA genotyping forward primer | This study |
rPM1831 | CTCTTTGATAATCATCGATCGTCTGCC | 4R/KA genotyping reverse primer | This study |
PvuII |
| Digests the 4R/KA PCR product twice, the WT product once | NEB |
VRK1 is a serine/threonine chromatin-binding kinase with roles in a range of biological processes, including mitosis and cell cycle progression, the DNA damage response and chromatin remodeling (Lazo, 2024). VRK1 is predominantly localized in the nucleus and bound to chromatin, although a small fraction is cytosolic (Valbuena et al., 2007). The protein comprises an N-terminal kinase domain and a C-terminal disordered region that can fold over the kinase domain, adopting several conformations that modulate kinase activity and protein-protein interactions (Shin et al., 2011). In C. elegans, the disordered C-terminal region is considerably larger than mammalian VRK1 (Fig. 1a). Rare coding variants of VRK1 are associated with distal neuropathies in humans, a heterogeneous group of progressive diseases that primarily affect motor neurons (Lazo and Morejón-García, 2023). In model organisms, null mutants in or RNAi knockdown of VRK1 (or its orthologues) result in microcephaly, loss of neuroblast identity, reduced proliferation and motor defects (Carrasco Apolinario et al., 2023; Vinograd-Byk et al., 2018; Yakulov et al., 2014). Because of the essential role of VRK1 in mitosis, however, it is difficult to attribute these phenotypes to mitotic defects rather than other, non-mitotic pathways regulated by VRK1. Here, we show that mutations in the C-terminal region of C. elegans VRK-1 impair animal motor function without causing detectable mitotic defects.
We previously reported that expression of catalytically inactive VRK-1(K169E) (VRK-1KD for kinase dead) dramatically alters chromatin architecture in hypodermal nuclei, where chromatin becomes highly enriched at the nuclear periphery - a phenotype suppressed by depletion of BAF-1, a key nuclear envelope substrate of VRK-1 (Smith et al., 2026 bioRxiv). Several other reports suggest the VRK-1/BAF-1 signaling axis is critical for detaching chromosomes from the nuclear periphery during mitosis and meiosis (Lancaster et al., 2007; Paouneskou et al., 2025; Torras-Llort et al., 2026). hVRK1 has additional chromatin substrates beyond BAF, including histone-modifying enzymes as well as histones H3 and H2A themselves (Lazo, 2024). hVRK1 has been shown to bind the negatively charged nucleosome acidic patch through its extreme C-terminal basic-acidic-basic (BAB) patch (Budziszewski et al., 2022). Mutants in which four conserved arginine residues of the BAB are substituted with alanine (hVRK14RA) show abolished binding of VRK1 to nucleosomes in vitro and loss of association of VRK1 with mitotic chromosomes in vivo, based on fluorescent microscopy. In vitro kinase assays show that H3 threonine 3 phosphorylation is reduced by approximately 50% in VRK14RA mutants, whereas BAF phosphorylation is unaffected (Budziszewski et al., 2022). Because these substitutions abolish nucleosome binding while leaving BAF phosphorylation intact in vitro, they offer a way to probe the contribution of VRK-1 to chromatin architecture independently of the BAF-1 signaling axis. We therefore used CRISPR genome editing to introduce the equivalent VRK14RA amino acid substitutions into the endogenously tagged VRK-1::wrmScarlet in C. elegans: K371A, K372A, R376A and R378A (VRK-14R/KA here on) (Fig. 1b). We note that these substitutions were designed to abolish nucleosome binding rather than to mimic a specific patient variant: mutation of the first arginine of the human BAB patch (R387H) is linked to distal hereditary motor neuropathy, whereas the remaining three residues have not been associated with disease.
To assess whether the 4R/KA substitutions affect chromatin binding, we compared the localization of the mutant VRK-1 with that of GFP-tagged histone H3 (HIS-72::GFP), used to visualise chromatin, and first examined mitosis and VRK-1 localization in rapidly dividing embryonic blastomeres. WT VRK-1::wrmScarlet associates with the nuclear envelope during prophase and early metaphase. Later in metaphase, WT VRK-1::wrmScarlet no longer strongly associates with chromatin, but reassociates during anaphase, often becoming enriched around mitotic chromosomes as anaphase progresses to form a shell-like structure (Fig. 1c). These observations are consistent with previous immunofluorescence studies of VRK-1 localization during mitosis in C. elegans, indicating that VRK-1::wrmScarlet recapitulates the localization of the endogenous protein (Gorjánácz et al., 2007). Interestingly, we found that VRK-1::wrmScarlet forms bridges between anaphase chromosomes, which have not been detected previously using immunofluorescence (Gorjánácz et al., 2007; Moura et al., 2018). In the two-colour images in Fig. 1c, HIS-72::GFP was not detectable above the local background along these VRK-1-positive strands in either VRK-1::wrmScarlet or VRK-14R/KA::wrmScarlet embryos, with histone signal there below approximately 10% and 2%, respectively, of that over the adjacent chromosome masses, whereas VRK-1::wrmScarlet along the same pixels reached roughly one third to two thirds of its own level over chromosome masses. As these are single optical sections of denoised images, we cannot exclude a histone-containing structure below our detection limit; however, our quantifications suggest that the strands are largely histone-negative. Histone-depleted connections between separating chromosomes have been described as ultrafine DNA bridges in other systems, and we note this as one possible interpretation of the structures we report. To better resolve the dynamics of VRK-1 during mitosis, we generated an endogenous VRK-1::eGFP fusion, which is substantially more photostable than VRK-1::wrmScarlet and allowed us to image VRK-1::eGFP localization over time during mitosis. At 1.6 s temporal resolution, VRK-1::eGFP showed the same overall distribution described above, and resolved changes in localization that are not apparent in single snapshots (extended data videos 1-6). During prophase, VRK-1::eGFP redistributes from the nucleoplasm to the nuclear periphery over approximately one minute, and transient VRK-1::eGFP foci appear and disappear at the nuclear periphery between consecutive frames (extended data videos 1/2). On entry into metaphase, the peripheral signal weakens and becomes discontinuous, and VRK-1::eGFP-positive structures are transiently detected across the nuclear space (extended data videos 3/4). During anaphase, a VRK-1::eGFP-positive strand spans the separating chromosome masses (extended data videos 5/6). In both timelapses this strand was present over several consecutive frames, on the order of 40 to 60 s, thinning and changing shape as the masses moved apart, and was no longer detectable while the masses continued to separate. Because these timelapses were acquired in a single channel, we cannot assign these events relative to anaphase onset or to the anaphase-to-telophase transition, and we therefore describe them relative to chromosome separation only. Establishing it would require additional markers, which we have not examined here. Acute depletion of VRK-1 in the germline results in ectopic chromosome bridges in oocytes (Paouneskou et al., 2025), and we observed a similar effect in hypodermal nuclei in nematodes expressing VRK-1KD. We therefore suggest that anaphase VRK-1 bridges have biological relevance, at least in C. elegans, and are unlikely artifacts of live-imaging or tagging. Our preliminary observations of VRK-1-positive bridge-like connections between chromosome masses, in animals that show no embryonic lethality, are provocative and will require further investigation to document their frequency and to understand their nature and significance.
In contrast to hVRK14RA and to our surprise, the localization of ceVRK-14R/KA::wrmScarlet during mitosis was largely comparable to that of WT from prophase to anaphase, and mitotic chromosomes appeared morphologically similar (Fig. 1c). Because WT VRK-1::eGFP localization changed rapidly between frames (extended data videos 1-6), and because VRK-1::wrmScarlet photobleached rapidly, we were unable to perform a quantitative analysis and therefore cannot rule out subtle defects in localization or morphology. As mitotic defects associated with VRK-1 null mutants cause sterility and embryonic lethality (Gorjánácz et al., 2007; Waters et al., 2010), we performed a brood size assay to test for such defects in vrk-14R/KA, additionally scoring for embryonic lethality. We found no significant differences in brood size between VRK-1 WT and VRK-14R/KA (Fig. 1d), and no evidence of dead embryos, suggesting that embryonic development and germline function are broadly unimpaired in these mutants.
We next turned to somatic nuclei. We reasoned that if chromatin binding of VRK-14R/KA were severely impaired, its subnuclear distribution would appear diffuse. As in mitosis, VRK-14R/KA::wrmScarlet localization was comparable to WT VRK-1::wrmScarlet in hypodermal nuclei, with a broad, speckle-like distribution across the nucleus that overlapped with chromatin marked by HIS-72::GFP (Fig. 1e). The overall chromatin distribution was unaffected (Fig. 1e). Finally, the morphology of VRK-14R/KA mutant animals was superficially wild type, in contrast to VRK-1 null mutants, which display a highly penetrant protruding vulva phenotype, most likely due to mitotic defects (Dobrzynska and Askjaer, 2016; Klerkx et al., 2009). Taken together, we conclude that the VRK-14R/KA mutations have no major effects on VRK-1 localization, mitosis, or broad chromatin distribution in somatic nuclei in C. elegans. The difference in chromatin binding between hVRK14RA and ceVRK-14R/KA could arise because C. elegans VRK-1 has a substantially longer disordered C-terminal region than hVRK1, raising the possibility that nucleosome binding is mediated by multiple regions of the protein. Alternatively, VRK-1 recruitment to chromatin could be mediated by cofactors absent in mammalian systems. Because we limited our study largely to VRK-1 localisation experiments, we cannot rule out other aspects such as kinase activity or protein turnover are affected in this mutant and a more detailed examination will be required in the future. For example, histone phosphorylation at H3T3 or H3S10 could still be affected in these mutants even if overall VRK-1 localization appears unchanged.
Visual inspection of animal locomotion suggested that vrk-14R/KA animals appeared lethargic. We therefore performed thrashing assays to quantify locomotion behavior, counting the number of thrashes per animal in liquid over 30 s. We found a significant reduction (34%) in VRK-14R/KA L4 larvae compared to WT ones (Fig. 1f), indicating impaired motor function. Because the phenotypes caused by the vast majority of disease-causing VRK1 variants become progressively more severe over time in patients (Lazo and Morejón-García, 2023), we next assessed whether this was also the case in C. elegans. We measured thrashing over 30 s on days 1, 3 and 5 of adulthood. Whereas control animals showed a mild decline in thrashing frequency by day 5, vrk-14R/KA mutant animals showed a progressive and significant decline over time, and moved significantly less than WT ones (Fig. 1g). In addition, vrk-14R/KA mutants exhibited seizure-like behaviors, coiling for several seconds every 30 s to 1 min before resuming movement (extended data videos 7-8). Notably, we never observed seizure-like behavior after VRK-1 depletion or in VRK-1KD mutants. Of note, coding variants or altered expression of human VRK2, the VRK1 paralogue, have been implicated as a risk factor for epilepsy (Azimi et al., 2018; International League Against Epilepsy Consortium on Complex Epilepsies, 2023; 2014; Li and Yue, 2018).
Overall, these data suggest that mutations in the BAB patch of VRK-1 broadly recapitulate aspects of human disease in C. elegans, while having no detectable impact on mitosis. To our knowledge, this is the first analysis of mutations in the disease-associated BAB patch of VRK1 in a model organism, beyond knockdown or null mutants. Therefore, we propose that the VRK-14R/KA mutant will be an effective model for 1) decoupling the mitotic and non-mitotic functions of VRK-1 and 2) further understanding the etiology of VRK1-associated distal motor neuron diseases and VRK-related epilepsy. Future studies should pursue a more systematic analysis of behavior in these mutants, coupled with the examination of muscle and nervous system architectures, including motor neuron morphology and function, to identify the perturbed molecular pathways.
","references":[{"reference":"Azimi T, Ghafouri Fard S, Davood Omrani M, Mazdeh M, Arsang Jang S, Sayad A, Taheri M. 2018. Vaccinia Related Kinase 2 (VRK2) expression in neurological disorders:. Mult. Scler. Relat. Disord. 19: 15-19.","pubmedId":"","doi":"10.1016/j.msard.2017.10.017"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94.","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Budziszewski GR, Zhao Y, Spangler CJ, Kedziora KM, Williams MR, Azzam DN, et al., Mc Ginty RK. 2022. Multivalent DNA and nucleosome acidic patch interactions specify VRK1. Nucleic Acids Res. 50: 4355-4371.","pubmedId":"","doi":"10.1093/nar/gkac198"},{"reference":"Carrasco Apolinario ME, Umeda R, Teranishi H, Shan M, Phurpa, Sebastian WA, et al., Hanada R. 2023. Behavioral and neurological effects of Vrk1 deficiency in zebrafish. Biochem. Biophys. Res. Commun. 675: 10-18.","pubmedId":"","doi":"10.1016/j.bbrc.2023.07.005"},{"reference":"Dobrzynska A, Askjaer P. 2016. Vaccinia-related kinase 1 is required for early uterine development in. Dev. Biol. 411: 246-256.","pubmedId":"","doi":"10.1016/j.ydbio.2016.01.010"},{"reference":"Gorjanacz M, Klerkx EPF, Galy V, Santarella R, Lopez Iglesias C, Askjaer P, Mattaj IW. 2007. Caenorhabditis elegans BAF-1 and its kinase VRK-1 participate directly in. EMBO J. 26: 132-143.","pubmedId":"","doi":"10.1038/sj.emboj.7601470"},{"reference":"Greenbaum L, Barel O, Nikitin V, Hersalis Eldar A, Kol N, Reznik Wolf H, et al., Dori A. 2020. Identification of a homozygous VRK1 mutation in two patients with. Muscle Nerve. 61: 395-400.","pubmedId":"","doi":"10.1002/mus.26779"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies. 2023. GWAS meta-analysis of over 29,000 people with epilepsy identifies 26 risk. Nat. Genet. 55: 1471-1482.","pubmedId":"","doi":"10.1038/s41588-023-01485-w"},{"reference":"International League Against Epilepsy Consortium On Complex Epilepsies Electronic Address Epilepsy Austin Unimelb Edu Au. 2014. Genetic determinants of common epilepsies: a meta-analysis of genome-wide. Lancet Neurol. 13: 893-903.","pubmedId":"","doi":"10.1016/S1474-4422(14)70171-1"},{"reference":"Klerkx EPF, Alarcon P, Waters K, Reinke V, Sternberg PW, Askjaer P. 2009. Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in. Dev. Biol. 335: 12-21.","pubmedId":"","doi":"10.1016/j.ydbio.2009.08.007"},{"reference":"Lancaster OM, Cullen CF, Ohkura H. 2007. NHK-1 phosphorylates BAF to allow karyosome formation in the Drosophila. J. Cell Biol. 179: 817-824.","pubmedId":"","doi":"10.1083/jcb.200706067"},{"reference":"Lazo PA. 2024. Nuclear functions regulated by the VRK1 kinase. Nucleus. 15: 2353249.","pubmedId":"","doi":"10.1080/19491034.2024.2353249"},{"reference":"Lazo PA, Morejon Garcia P. 2023. VRK1 variants at the cross road of Cajal body neuropathogenic mechanisms. Neurobiol. Dis. 183: 106172.","pubmedId":"","doi":"10.1016/j.nbd.2023.106172"},{"reference":"Li M, Yue W. 2018. VRK2, a candidate gene for psychiatric and neurological disorders. Mol. Neuropsychiatry. 4: 119-133.","pubmedId":"","doi":"10.1159/000493941"},{"reference":"Moura DS, Campillo Marcos I, Vazquez Cedeira M, Lazo PA. 2018. VRK1 and AURKB form a complex that cross inhibit their kinase activity and. Cell. Mol. Life Sci. 75: 2591-2611.","pubmedId":"","doi":"10.1007/s00018-018-2746-7"},{"reference":"Paouneskou D, Baudrimont A, Kelemen R, Elkrewi M, Graf A, Moukbel Ali Aldawla S, et al., Jantsch V. 2025. BAF-1-VRK-1 mediated release of meiotic chromosomes from the nuclear. Nat. Commun. 16: 10446.","pubmedId":"","doi":"10.1038/s41467-025-65420-9"},{"reference":"Shin J, Chakraborty G, Bharatham N, Kang C, Tochio N, Koshiba S, et al., Yoon HS. 2011. NMR solution structure of human vaccinia-related kinase 1 (VRK1) reveals. J. Biol. Chem. 286: 22131-22138.","pubmedId":"","doi":"10.1074/jbc.M110.200162"},{"reference":"Smith W, Aksianiuk V, Pfaendler R, Villaseñor R, Sankar DS, Stumpe M, et al., Meister P. 2026. Proximity labeling at H3K9me3 reveals VRK-1 regulate global chromatin distribution in C. elegans. bioRxiv: pii: 2026.07.07.737140. 10.64898/2026.07.07.737140.
","pubmedId":"42465445","doi":""},{"reference":"Torras Llort M, Carbonell A, Escudero Ferruz P, Serrat M, Zhang C, Reina O, et al., Azorin F. 2026. Phosphorylation of Barrier-to-Autointegration Factor (BAF) regulates. Nucleic Acids Res. 54","pubmedId":"","doi":"10.1093/nar/gkag021"},{"reference":"Valbuena A, Lopez Sanchez I, Vega FM, Sevilla A, Sanz Garcia M, Blanco S, Lazo PA. 2007. Identification of a dominant epitope in human vaccinia-related kinase 1. Arch. Biochem. Biophys. 465: 219-226.","pubmedId":"","doi":"10.1016/j.abb.2007.06.005"},{"reference":"Villasenor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al., Baubec T. 2020. ChromID identifies the protein interactome at chromatin marks. Nature Biotechnology. 38: 728-736.","pubmedId":"","doi":"10.1038/s41587-020-0434-2"},{"reference":"Vinograd Byk H, Renbaum P, Levy Lahad E. 2018. Vrk1 partial knockdown in mice results in reduced brain weight and mild. Sci. Rep. 8: 11265.","pubmedId":"","doi":"10.1038/s41598-018-29215-x"},{"reference":"Waters K, Yang AZ, Reinke V. 2010. Genome-wide analysis of germ cell proliferation in C.elegans identifies. Dev. Biol. 344: 1011-1025.","pubmedId":"","doi":"10.1016/j.ydbio.2010.06.022"},{"reference":"Yakulov T, Gunesdogan U, Jackle H, Herzig A. 2014. Bällchen participates in proliferation control and prevents the. Biol. Open. 3: 881-886.","pubmedId":"","doi":"10.1242/bio.20148631"}],"title":"Human disease-relevant mutations in the VRK-1 basic-acidic-basic patch result in motor impairment independent of mitotic defects in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"74854dd3-0d33-413b-af93-0bb4da3bfe27","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}