In Caenorhabditis elegans, disruption of the purine salvage enzymes ADAH-1 or PNP-1 induces an innate immune program coined the Intracellular Pathogen Response (IPR). To determine if these enzymes have conserved immune regulatory roles, we utilized RNAi-competent strains of Caenorhabditis briggsae and Caenorhabditis remanei to knock down Cbr/Cre-adah-1 and Cbr/Cre-pnp-1. In both species, knockdown of these enzymes induces expression of Cbr/Cre-pals genes, a hallmark of the C. elegans IPR. Furthermore, knockdown of Cbr-adah-1 or Cbr-pnp-1 promotes resistance to the microsporidia species Nematocida parisii. Our results suggest that perturbations to purine salvage metabolism may activate innate immune programs across diverse nematode species.
","acknowledgements":"We thank Dr. Emily Troemel and Dr. Eillen Tecle for insightful feedback on the manuscript. We thank Colorado College summer research students Caroline Bay and Joselyn Campuzano for helpful suggestions during the early stages of project development.
","authors":[{"affiliations":["Colorado College, Colorado Springs, CO, United States"],"departments":["Department of Molecular Biology"],"credit":["conceptualization","investigation","methodology","writing_reviewEditing"],"email":"m_flannery2023@ColoradoCollege.edu","firstName":"Mya G.","lastName":"Flannery","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Emory University, Atlanta, GA, United States"],"departments":["School of Medicine"],"credit":["conceptualization","investigation","methodology","writing_reviewEditing"],"email":"mona.hamad@emory.edu","firstName":"Mona A.","lastName":"Hamad","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Colorado College, Colorado Springs, CO, United States"],"departments":["Department of Molecular Biology"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","supervision","writing_originalDraft","writing_reviewEditing"],"email":"sgang2023@coloradocollege.edu","firstName":"Spencer S.","lastName":"Gang","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5907-0631"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Raw data associated with Figure 1C
","doi":null,"resourceType":"Dataset","name":"C. briggsae pnp-1 and adah-1 RNAi qPCR.prism","url":"https://portal.micropublication.org/uploads/c34e97eed06f0a709a9b9013d7c0aaad.prism"},{"description":"Raw data associated with Figure 1D
","doi":null,"resourceType":"Dataset","name":"C. remanei pnp-1 and adah-1 RNAi qPCR.prism","url":"https://portal.micropublication.org/uploads/9e203a544ae40f5a65ba18705e587dbd.prism"},{"description":"Raw data associated with Figure 1F
","doi":null,"resourceType":"Dataset","name":"Cbr adah-1 and pnp-1 RNAi Infection Data.prism","url":"https://portal.micropublication.org/uploads/e7d02af594707a8ffcb8cb12c608b580.prism"},{"description":"Genbank plasmid sequence file for pSSG001
","doi":null,"resourceType":"Dataset","name":"pSSG001_L4440-Cbr-pnp-1.gb","url":"https://portal.micropublication.org/uploads/8416e2febce6034eba9334d8e6d1f244.gb"},{"description":"Genbank plasmid sequence file for pSSG004
","doi":null,"resourceType":"Dataset","name":"pSSG004_L4440-Cbr-adah-1.gb","url":"https://portal.micropublication.org/uploads/aa046e7306041d277221b3134a38ce51.gb"},{"description":"Genbank plasmid sequence file for pSSG015
","doi":null,"resourceType":"Dataset","name":"pSSG015_L4440-Cre-adah-1.gb","url":"https://portal.micropublication.org/uploads/40b2e42efa09d27f08336a00c1bce609.gb"},{"description":"Genbank plasmid sequence file for pSSG016
","doi":null,"resourceType":"Dataset","name":"pSSG016_L4440-Cre-pnp-1.gb","url":"https://portal.micropublication.org/uploads/e94a4c15286e7596cd9d51665ac824b1.gb"}],"funding":"Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by the Colorado College Figge-Bourquin Endowment and Natural Sciences Executive Committee Research and Development Grant.
","image":{"url":"https://portal.micropublication.org/uploads/601a7b1d77f2bf3b5c4f50088ff71cd2.png"},"imageCaption":"A) Diagram of the purine salvage pathway. The enzymes ADAH-1 and PNP-1, which negatively regulate the C. elegans IPR, are shown in red. ADAH-1 and PNP-1 also act on deoxy forms of nucleosides, not shown for simplicity.
B) Representative images of C. elegans jyIs8[pals-5p::GFP; myo-2p::mCherry] X adults following treatment with control, adah-1, or pnp-1 RNAi. pals-5p::GFP is expressed when the IPR is activated; myo-2p::mCherry is a co-expression marker in the pharynx.
C) RT-qPCR of C. briggsae mfIs42[Cel-sid-2 + Cel-myo-2::DsRed] following treatment with control, Cbr-adah-1, or Cbr-pnp-1 RNAi. Expression of Cbr-adah-1, Cbr-pnp-1, and three Cbr-pals genes (CBG06463, CBG06596, and CBG30948) was analyzed for fold change relative to control RNAi-treated animals.
D) RT-qPCR of C. remanei mfEx34[Cel-sid-2 + Cel-myo-2::DsRed] following treatment with control, Cre-adah-1, or Cre-pnp-1 RNAi. Expression of Cre-adah-1, Cre-pnp-1, and three select Cre-pals genes (CRE18779, CRE09158, and CRE27419) was analyzed for fold change relative to control RNAi-treated animals.
E) Representative images of C. briggsae mfIs42 animals treated with control, Cbr-pnp-1, or Cbr-adah-1 RNAi (top) or C. elegans wild-type and pnp-1(jy121) mutants in the jyIs8 background (bottom) stained with N. parisii-specific FISH probe (red-orange fluorescence). Solid black lines denote regions of worms quantified for N. parisii infection in F, while white dashed lines denote pharyngeal areas with co-expression markers that were omitted from infection quantification.
F) Quantification of N. parisii FISH fluorescence. **** p < 0.0001, ns = not significant, Kruskal-Wallis test with Dunn's multiple comparisons test. n = 73-81 animals analyzed per strain and condition across three independent infection experiments. Circles represent N. parisii FISH fluorescence normalized to body area for individual worms. Bar heights indicate mean values, and error bars represent standard deviations.
B, E) Scale bar = 100 mm
C, D) **** p < 0.0001, ** p < 0.01, * p < 0.05, unpaired, one-tailed Welch's T-test. n = 4 independent experimental replicates; Circles represent the expression values for individual replicates. Bar heights indicate mean values, and error bars represent standard deviations.
","imageTitle":"Purine salvage enzymes have conserved immune regulatory roles in C. elegans, C. briggsae, and C. remanei
","methods":"Worm strain maintenance
C. elegans, C. briggsae, and C. remanei strains (Table 1) were maintained at 21 °C on Nematode Growth Media (NGM) plates seeded with Escherichia coli OP50-1. RNAi experiments were performed at 22 °C on NGM plates supplemented with 1 mM Carbenicillin and 5 mM IPTG seeded with E. coli HT115(DE3) carrying the desired dsRNA expression plasmids (Table 2). Seeded RNAi plates were grown in the dark at room temperature (RT) for at least 3 days before adding worms.
IPR reporter imaging
P0 L4s of C. elegans jyIs8 were picked to 6-cm RNAi plates seeded with control, adah-1, or pnp-1 RNAi. F1 adults were then picked to the same RNAi treatments. F2 adults were imaged for IPR reporter expression on a Zeiss Axioscope 7.
Cloning
cDNA sequences for Cbr/Cre-adah-1 or Cbr/Cre-pnp-1 were synthesized as gene fragments (Twist Biosciences) and inserted into linearized pL4440 between the T7 promoters by NEBuilder HiFi assembly (New England Biolabs). Assembled plasmids were transformed into DH5a chemically competent cells (Thermo Fisher Scientific). Candidate clones were miniprepped (Qiagen) and sequence-confirmed for the desired insertion using Sanger and PlasmidEZ whole-vector sequencing (Azenta Life Sciences). Verified plasmids were subsequently transformed into chemically competent HT115(DE3) bacteria prepared with the Mix & Go E. coli Transformation Kit (Zymo Research). Genbank files for each plasmid vector generated in this study are included as Extended Data.
RNA extraction and RT-qPCR
For C. briggsae mfIs42, ~10-12 P0 L4s were picked to 10-cm RNAi plates seeded with control, Cbr-adah-1, or Cbr-pnp-1 RNAi. ~10-12 F1 adults were then picked to 2 x 10-cm RNAi plates of the same treatments. After 3 days, F2s were enriched for L4 and adult life stages by gravity settling in M9 in a 15 mL conical tube for RNA extraction. For C. remanei mfEx34, a mixed-stage plate was chunked to 10-cm RNAi plates seeded with control, Cre-adah-1, or Cre-pnp-1 RNAi. After 3 days, F1 mixed-stage worms were chunked again to 2 x 10-cm RNAi plates of the same treatments. After 3 days, F2s were enriched for L4 and adult life stages by gravity settling in M9 in a 15 mL conical tube for RNA extraction. For both species, total RNA was purified as previously described (Gang et al., 2022) and converted to cDNA using iScript (Bio-Rad). RT-qPCR was performed with iQ SYBR Green using a CFX Connect machine running CFX Maestro v1.1 (Bio-Rad). RT-qPCR data was normalized to the Cbr/Cre-eef-2 gene using the Pfaffl method (Pfaffl, 2001). To assess expression, Cbr/Cre-adah-1 and Cbr/Cre-pnp-1 knockdown samples were normalized to control RNAi-treated samples. RT-qPCR primers are listed in Table 3.
Microsporidia infection
mfIs42 P0 and F1 generations were picked to seeded 10-cm RNAi plates as described above. ~125 F2 L4s for each treatment were then picked to 6-cm NGM plates seeded with a thin lawn of OP50-1 covering the entire surface. A mixture of 1 million N. parisii spores, 50 µL of 10X-concentrated OP50-1, and M9 to a total volume of 300 µL was then top-plated, spread evenly across the surface, and dried at RT for 10 minutes. The infection plates were transferred to 25 °C for 3 h. Infected worms were washed off the plates in M9, pelleted, and transferred to 6-cm RNAi plates seeded with HT115(DE3) to sustain knockdown of the desired genes, without additional N. parisii spores, and returned to 25 °C for 27 h. At 30 hpi, worms were fixed in 4% paraformaldehyde for 30 min at RT. Worms were FISH-stained with 5 ng/µL N. parisii-specific MicroB CF610 probe (Biosearch Technologies), imaged on a Zeiss Axioscope 7, and infection was quantified using ImageJ as previously described (Gang et al., 2022).
","reagents":"Table 1. Worm Strains
Strain | Genotype | Description | Source |
Transcriptional reporter for the C. elegans Intracelluar Pathogen Response (IPR) | Bakowski et al. 2014 | ||
C. briggsae AF16 sensitized for ingestion of dsRNA via expression of C. elegans SID-2 | Nuez and Félix 2012 | ||
C. remaeni PB4641 sensitized for ingestion of dsRNA via expression of C. elegans SID-2 | Nuez and Félix 2012 | ||
CRISPR/Cas9-mediated knockout of endogenous pnp-1 + IPR transcriptional reporter | Tecle et al. 2021 |
Table 2. Plasmids
Plasmid | Genotype | Description | Source |
pL4440 | pL4440 RNAi control | pL4440 RNAi feeding vector without nematode gene target inserted | Ahringer RNAi library |
pL4440-pnp-1 | pL4440-pnp-1 | pL4440 RNAi feeding vector targeting pnp-1 | Ahringer RNAi library, Wernet et al. 2025 |
pL4440-adah-1 | pL4440-adah-1 | pL4440 RNAi feeding vector targeting adah-1 | Ahringer RNAi library, Wernet et al. 2025 |
pSSG001 | pL4440-Cbr-pnp-1 | pL4440 RNAi feeding vector with 647 bp of Cbr-pnp-1 cDNA inserted targeting exons 2 and 3, isoform A | This study |
pSSG004 | pL4440-Cbr-adah-1 | pL4440 RNAi feeding vector with 700 bp of Cbr-adah-1 cDNA inserted targeting exons 1-4, isoform A | This study |
pSSG015 | pL4440-Cre-adah-1 | pL4440 RNAi feeding vector with 450 bp of Cre-adah-1 cDNA inserted targeting exon 5 | This study |
pSSG016 | pL4440-Cre-pnp-1 | pL4440 RNAi feeding vector with 400 bp of Cre-pnp-1 cDNA inserted targeting exon 2 | This study |
Table 3. qPCR Primers
Gene Name | Primer Description | Sequence |
Cbr-eef-2 RT-qPCR - Forward | GCTTACTTGCCTGTCAACGAGTC | |
Cbr-eef-2 RT-qPCR - Reverse | CGGTGTTGGAGCGGAGA | |
Cbr-adah-1 RT-qPCR - Forward | AAAGCTCAACTCAACGCTGCC | |
Cbr-adah-1 RT-qPCR - Reverse | TGGCTCTCCAGCTTCAACTAGT | |
Cbr-pnp-1 RT-qPCR - Forward | TGCTAACCTGGACGCTGATCA | |
Cbr-pnp-1 RT-qPCR - Reverse | ACGAATCGAGATGCTCGCTCT | |
CBG06463 RT-qPCR - Forward | ACTACCTCCGATCGGTTGAGATGT | |
CBG06463 RT-qPCR - Reverse | GCAGTCAGAGGGCTCGTGTAC | |
CBG06596 RT-qPCR - Forward | GCTCTCATCTGCTCTAACCGCT | |
CBG06596 RT-qPCR - Reverse | ACGGTTTGGAAAAGTTGCGGAG | |
CBG30948 RT-qPCR - Forward | AGCTTCCCTGAATGATGATCCA | |
CBG30948 RT-qPCR - Reverse | AACGTTCCGATCAGGTCACCC | |
Cre-eef-2 RT-qPCR - Forward | AGGAGTCCCAAGTCACCGGAA | |
Cre-eef-2 RT-qPCR - Reverse | GCTTGTCCTCCGGTGTTGGAA | |
Cre-adah-1 RT-qPCR - Forward | GCTGCCCGTTCCTGTTTCCTA | |
Cre-adah-1 RT-qPCR - Reverse | TCCGGCCTGAACCAACTTCAC | |
Cre-pnp-1 RT-qPCR - Forward | AAAACTGTTGGTGCCGATGCG | |
Cre-pnp-1 RT-qPCR - Reverse | AGCGAGAATCCGAGCACCTTG | |
CRE18779 RT-qPCR - Forward | AGCCGCTCAGCAACAAAGTCA | |
CRE18779 RT-qPCR - Reverse | CCTGAGTGCAGCTCGTTCCTC | |
CRE09158 RT-qPCR - Forward | GACTTTGGCGGCTAACGAGGA | |
CRE09158 RT-qPCR - Reverse | AGCTTCGGCTTCACTGATAGCA | |
CRE27419 RT-qPCR - Forward | CGTGTCCCACGTGCTATTGAATC | |
CRE27419 RT-qPCR - Reverse | CCAATTCGTCGACGCCTTTCG |
The Intracellular Pathogen Response (IPR) is an innate immune program in Caenorhabditis elegans involving the upregulation of a suite of genes in response to natural intracellular pathogens of the intestine, including Orsay virus and microsporidia species like Nematocida parisii (Sarkies et al., 2013; Bakowski et al., 2014; Reddy et al., 2019). In addition to infection, the IPR is also genetically regulated through several parallel pathways (Reddy et al., 2017; Reddy et al., 2019; Sowa et al., 2020; Lazetic et al., 2023). Two such genetic regulators are enzymes of the highly conserved purine salvage pathway, Adenosine Deaminase (ADAH-1, ADA in humans) and Purine Nucleoside Phosphorylase (PNP-1, PNP in humans), which recycle purine nucleosides and bases (Figure 1A) (Tecle et al., 2021; Wernet et al., 2025). Knockout or knockdown of adah-1 or pnp-1 induces expression of the pals-5p::GFP IPR transcriptional reporter (Figure 1B) (Bakowski et al., 2014), as well as many other IPR genes, and promotes resistance to intracellular infections. Thus, ADAH-1 and PNP-1 act as negative regulators of the IPR (Tecle et al., 2021; Wernet et al., 2025).
While the IPR is well-defined in C. elegans, the extent to which this immune program is conserved or divergent among related nematode species is unclear. Infection of Caenorhabditis briggsae with Santeuil virus or Nematocida species of microsporidia induces the upregulation of several gene families in common with the C. elegans IPR, such as pals and DUF713 genes, suggesting broadly similar transcriptional responses to intracellular infection (Chen et al., 2017; Wan et al., 2022). However, whether known genetic regulators of the IPR serve similar functions outside of C. elegans has not been investigated.
Here, to determine whether orthologs of adah-1 and pnp-1 have conserved immune regulatory roles, we used C. briggsae and Caenorhabditis remanei strains transgenically modified to express C. elegans SID-2, which enables uptake of dsRNA to induce systemic RNA interference (RNAi) by feeding (Winston et al., 2007; Nuez & Felix, 2012). We cloned cDNA fragments of Cbr-adah-1 and Cbr-pnp-1 into the L4440 RNAi plasmid vector, transformed HT115 bacteria, and performed RNAi by feeding C. briggsae mfIs42[Cel-sid-2 + Cel-myo-2::DsRed] animals dsRNA targeting each gene. RT-qPCR showed knockdown of Cbr-adah-1 and Cbr-pnp-1 transcript levels and the upregulation of three Cbr-pals genes (CBG06463, CBG06596, and CBG30948) when compared to control RNAi-treated animals (Figure 1C). CBG06596 and CBG30948 were induced to comparable levels as previously demonstrated for pals-5 following adah-1 and pnp-1 RNAi (Wernet et al., 2025). Notably, all three Cbr-pals genes tested were also previously shown to be upregulated during infection by Santeuil virus, N. parisii, or both pathogens, suggesting these genes are both genetically and infection-regulated, like pals genes of the C. elegans IPR (Chen et al., 2017; Wan et al., 2022).
Next, we cloned cDNA fragments for Cre-adah-1 and Cre-pnp-1 into L4440 and performed RNAi by feeding C. remanei mfEx34[Cel-sid-2 + Cel-myo-2::DsRed] animals dsRNA targeting each gene. As with C. briggsae, we were able to knock down the expression of Cre-adah-1 and Cre-pnp-1 and observed upregulation of three Cre-pals genes (CRE18779, CRE09158, and CRE27419) compared with control RNAi-treated animals (Figure 1D). Cre-pals genes were not induced to the same degree as Cbr-pals genes (~3 to 500-fold in C. briggsae versus ~3-14-fold in C. remanei) (Figure 1C, D). This reduced induction could be an intrinsic property of pals gene family regulation in this species or the inducibility of the specific genes tested. Alternatively, we note that knockdown of Cre-adah-1/pnp-1 was not as effective as Cbr-adah-1/pnp-1 (~0.083 and 0.085-fold in C. briggsae versus ~0.19 and 0.28-fold in C. remanei) (Figure 1C, D). This suggests that RNAi may be less efficient in C. remanei mfEx34, leading to higher background activity of the targeted enzyme and muted upregulation of the Cre-pals genes. We do not attribute this effect to the extrachromosomal inheritance pattern of the mfEx34 transgene, as this strain has previously been reported as a spontaneous integrant; we similarly observe 100% inheritance of this transgene (Nuez & Felix, 2012). Taken together, our results demonstrate that Cbr/Cre-adah-1 and Cbr/Cre-pnp-1 negatively regulate pals gene expression, indicating conserved immune regulatory roles for these purine salvage enzymes, like adah-1 and pnp-1 for the IPR.
Constitutive expression of the C. elegans IPR promotes resistance to intracellular infection in the intestine (Reddy et al., 2019; Tecle et al., 2021; Lazetic et al., 2023; Wernet et al., 2025). While pals gene expression is a useful proxy for IPR induction, only one induced C. elegans pals gene has been shown to confer resistance (Raman et al., 2024). Therefore, analyzing Cbr/Cre-pals expression after knocking down purine salvage enzymes may not fully capture whether a broader IPR-like immune program and its associated phenotypes are induced. To assess intracellular pathogen susceptibility, we performed Cbr-adah-1/pnp-1 RNAi and infected C. briggsae mfIs42 animals with N. parisii. We focused our analysis on C. briggsae for two reasons: 1) more potent RNAi and induction of pals genes (Figure 1C), and 2) both C. briggsae and C. elegans are infected by N. parisii, which allowed for the inclusion of C. elegans strains as controls in our experiment; N. parisii cannot infect C. remanei (Zhang et al., 2016; Wadi et al., 2023). At 30 hours post-infection, we FISH-stained C. briggsae mfIs42 RNAi-treated animals with a probe targeting N. parisii rRNA and quantified FISH fluorescence (Troemel et al., 2008). Knockdown of Cbr-pnp-1 and Cbr-adah-1 resulted in reduced average FISH fluorescence when compared to control RNAi-treated animals, consistent with increased microsporidia resistance (Figure 1E, F). The degree of resistance observed in C. briggsae was similar to that of C. elegans pnp-1(jy121) mutants when compared to wild-type animals (Figure 1E, F) (Tecle et al., 2021). These findings further support a conserved role for purine salvage enzymes as negative regulators of an innate immune program against intracellular pathogens in a distinct Caenorhabditis species.
In this study, we sought to determine if purine salvage enzymes that act as negative regulators of the C. elegans IPR, ADAH-1 and PNP-1 (Figure 1A, B), serve similar immune-regulatory roles in related nematode species. We cloned cDNA fragments of Cbr/Cre-adah-1 and Cbr/Cre-pnp-1 into L4440 and utilized RNAi-competent C. briggsae and C. remanei strains to knock down these enzymes. In both species, knockdown induced pals gene expression indicative of IPR-like immune activation (Figure 1C, D). Additionally, knockdown of Cbr-adah-1 and Cbr-pnp-1 promoted N. parisii resistance(Figure 1E, F). Purine salvage metabolism represents just one of several parallel genetic pathways that regulate the C. elegans IPR. Other regulators include members of the pals gene family that act in antagonistic modules (Reddy et al., 2019; Lazetic et al., 2023), drh-1 as a sensor of dsRNA during viral infection (Sowa et al., 2020; Batachari et al., 2024), and zip-1 as a transcription factor that acts downstream of these factors and controls a subset of IPR genes (Lazetic et al., 2022). Future work can evaluate whether these genetic regulators have broadly conserved immune regulatory roles, as assessed here for Cbr/Cre-adah-1 and Cbr/Cre-pnp-1, whether these genes have divergent functions, or whether novel regulators have evolved in the diverse nematode species that are susceptible to intracellular pathogens.
","references":[{"reference":"Bakowski MA, Desjardins CA, Smelkinson MG, Dunbar TL, Lopez-Moyado IF, Rifkin SA, Cuomo CA, Troemel ER. 2014. Ubiquitin-mediated response to microsporidia and virus infection in C. elegans. PLoS Pathog 10(6): e1004200.
","pubmedId":"24945527","doi":""},{"reference":"Batachari LE, Dai AY, Troemel ER. 2024. Caenorhabditis elegans RIG-I-like receptor DRH-1 signals via CARDs to activate antiviral immunity in intestinal cells. Proc Natl Acad Sci U S A 121(29): e2402126121.
","pubmedId":"38980902","doi":""},{"reference":"Chen K, Franz CJ, Jiang H, Jiang Y, Wang D. 2017. An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18(1): 303.
","pubmedId":"28415971","doi":""},{"reference":"Gang SS, Grover M, Reddy KC, Raman D, Chang YT, Ekiert DC, Barkoulas M, Troemel ER. 2022. A pals-25 gain-of-function allele triggers systemic resistance against natural pathogens of C. elegans. PLoS Genet 18(10): e1010314.
","pubmedId":"36191002","doi":""},{"reference":"Lažetić V, Blanchard MJ, Bui T, Troemel ER. 2023. Multiple pals gene modules control a balance between immunity and development in Caenorhabditis elegans. PLoS Pathog 19(7): e1011120.
","pubmedId":"37463170","doi":""},{"reference":"Lažetić V, Wu F, Cohen LB, Reddy KC, Chang YT, Gang SS, Bhabha G, Troemel ER. 2022. The transcription factor ZIP-1 promotes resistance to intracellular infection in Caenorhabditis elegans. Nat Commun 13(1): 17.
","pubmedId":"35013162","doi":""},{"reference":"Nuez I, Félix MA. 2012. Evolution of susceptibility to ingested double-stranded RNAs in Caenorhabditis nematodes. PLoS One 7(1): e29811.
","pubmedId":"22253787","doi":""},{"reference":"Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9): e45.
","pubmedId":"11328886","doi":""},{"reference":"Raman D, Wernet N, Gang S, Troemel E. 2024. PALS-14 promotes resistance to Nematocida parisii infection in Caenorhabditis elegans. MicroPubl Biol 2024: 10.17912/micropub.biology.001325.
","pubmedId":"39473452","doi":""},{"reference":"Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER. 2017. An Intracellular Pathogen Response Pathway Promotes Proteostasis in C. elegans. Curr Biol 27(22): 3544-3553.e5.
","pubmedId":"29103937","doi":""},{"reference":"Reddy KC, Dror T, Underwood RS, Osman GA, Elder CR, Desjardins CA, et al., Troemel ER. 2019. Antagonistic paralogs control a switch between growth and pathogen resistance in C. elegans. PLoS Pathog 15(1): e1007528.
","pubmedId":"30640956","doi":""},{"reference":"Sarkies P, Ashe A, Le Pen J, McKie MA, Miska EA. 2013. Competition between virus-derived and endogenous small RNAs regulates gene expression in Caenorhabditis elegans. Genome Res 23(8): 1258-70.
","pubmedId":"23811144","doi":""},{"reference":"Sowa JN, Jiang H, Somasundaram L, Tecle E, Xu G, Wang D, Troemel ER. 2020. The Caenorhabditis elegans RIG-I Homolog DRH-1 Mediates the Intracellular Pathogen Response upon Viral Infection. J Virol 94(2): 10.1128/JVI.01173-19.
","pubmedId":"31619561","doi":""},{"reference":"Tecle E, Chhan CB, Franklin L, Underwood RS, Hanna-Rose W, Troemel ER. 2021. The purine nucleoside phosphorylase pnp-1 regulates epithelial cell resistance to infection in C. elegans. PLoS Pathog 17(4): e1009350.
","pubmedId":"33878133","doi":""},{"reference":"Troemel ER, Félix MA, Whiteman NK, Barrière A, Ausubel FM. 2008. Microsporidia are natural intracellular parasites of the nematode Caenorhabditis elegans. PLoS Biol 6(12): 2736-52.
","pubmedId":"19071962","doi":""},{"reference":"Wadi L, El Jarkass HT, Tran TD, Islah N, Luallen RJ, Reinke AW. 2023. Genomic and phenotypic evolution of nematode-infecting microsporidia. PLoS Pathog 19(7): e1011510.
","pubmedId":"37471459","doi":""},{"reference":"Wan YC, Troemel ER, Reinke AW. 2022. Conservation of Nematocida microsporidia gene expression and host response in Caenorhabditis nematodes. PLoS One 17(12): e0279103.
","pubmedId":"36534656","doi":""},{"reference":"Wernet ND, Tecle E, Sarmiento MB, Kuo CJ, Chhan CB, Baick I, et al., Troemel ER. 2025. Adenosine deaminase and deoxyadenosine regulate intracellular immune response in C. elegans. iScience 28(3): 111950.
","pubmedId":"40034845","doi":""},{"reference":"Winston WM, Sutherlin M, Wright AJ, Feinberg EH, Hunter CP. 2007. Caenorhabditis elegans SID-2 is required for environmental RNA interference. Proc Natl Acad Sci U S A 104(25): 10565-70.
","pubmedId":"17563372","doi":""},{"reference":"Zhang G, Sachse M, Prevost MC, Luallen RJ, Troemel ER, Félix MA. 2016. A Large Collection of Novel Nematode-Infecting Microsporidia and Their Diverse Interactions with Caenorhabditis elegans and Other Related Nematodes. PLoS Pathog 12(12): e1006093.
","pubmedId":"27942022","doi":""}],"title":"Purine salvage enzymes are innate immune regulators in Caenorhabditis briggsae and Caenorhabditis remanei
","reviews":[{"reviewer":{"displayName":"Aaron Reinke"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"3b69ef76-ee5a-4d03-ad90-63840ec0e37e","decision":"accept","abstract":"In Caenorhabditis elegans, disruption of the purine salvage enzymes ADAH-1 or PNP-1 induces an innate immune program coined the Intracellular Pathogen Response (IPR). To determine if these enzymes have conserved immune regulatory roles, we utilized RNAi-competent strains of Caenorhabditis briggsae and Caenorhabditis remanei to knock down Cbr/Cre-adah-1 and Cbr/Cre-pnp-1. In both species, knockdown of these enzymes induces expression of Cbr/Cre-pals genes, a hallmark of the C. elegans IPR. Furthermore, knockdown of Cbr-adah-1 or Cbr-pnp-1 promotes resistance to the microsporidia species Nematocida parisii. Our results suggest that perturbations to purine salvage metabolism may activate innate immune programs across Caenorhabditis species.
","acknowledgements":"We thank Dr. Emily Troemel and Dr. Eillen Tecle for insightful feedback on the manuscript. We thank Colorado College summer research students Caroline Bay and Joselyn Campuzano for helpful suggestions during the early stages of project development.
","authors":[{"affiliations":["Colorado College, Colorado Springs, CO, United States"],"departments":["Department of Molecular Biology"],"credit":["conceptualization","investigation","methodology","writing_reviewEditing"],"email":"m_flannery2023@ColoradoCollege.edu","firstName":"Mya G.","lastName":"Flannery","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Emory University, Atlanta, GA, United States"],"departments":["School of Medicine"],"credit":["conceptualization","investigation","methodology","writing_reviewEditing"],"email":"mona.hamad@emory.edu","firstName":"Mona A.","lastName":"Hamad","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Colorado College, Colorado Springs, CO, United States"],"departments":["Department of Molecular Biology"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","supervision","writing_originalDraft","writing_reviewEditing"],"email":"sgang2023@coloradocollege.edu","firstName":"Spencer S.","lastName":"Gang","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5907-0631"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Genbank plasmid sequence file for pSSG001
","doi":null,"resourceType":"Dataset","name":"pSSG001_L4440-Cbr-pnp-1.gb","url":"https://portal.micropublication.org/uploads/8416e2febce6034eba9334d8e6d1f244.gb"},{"description":"Genbank plasmid sequence file for pSSG004
","doi":null,"resourceType":"Dataset","name":"pSSG004_L4440-Cbr-adah-1.gb","url":"https://portal.micropublication.org/uploads/aa046e7306041d277221b3134a38ce51.gb"},{"description":"Genbank plasmid sequence file for pSSG015
","doi":null,"resourceType":"Dataset","name":"pSSG015_L4440-Cre-adah-1.gb","url":"https://portal.micropublication.org/uploads/40b2e42efa09d27f08336a00c1bce609.gb"},{"description":"Genbank plasmid sequence file for pSSG016
","doi":null,"resourceType":"Dataset","name":"pSSG016_L4440-Cre-pnp-1.gb","url":"https://portal.micropublication.org/uploads/e94a4c15286e7596cd9d51665ac824b1.gb"},{"description":"Raw data and statistics for Figure 1C
","doi":null,"resourceType":"Dataset","name":"C. briggsae pnp-1 and adah-1 RNAi qPCR_FINAL.prism","url":"https://portal.micropublication.org/uploads/6358f74e197c937542b0ad01b0146be5.prism"},{"description":"Raw data and statistics for Figure 1D
","doi":null,"resourceType":"Dataset","name":"C. remanei pnp-1 and adah-1 RNAi qPCR_FINAL.prism","url":"https://portal.micropublication.org/uploads/501c641a154e43dfdf1b1409347b97ed.prism"},{"description":"Raw data and statistics for Figure 1F
","doi":null,"resourceType":"Dataset","name":"Cbr adah-1 and pnp-1 RNAi Infection Data_FINAL.prism","url":"https://portal.micropublication.org/uploads/37a741559d097ca938326eb57493ae7e.prism"}],"funding":"Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by the Colorado College Figge-Bourquin Endowment and Natural Sciences Executive Committee Research and Development Grant.
","image":{"url":"https://portal.micropublication.org/uploads/6a90666a857948fe838295bf2119b8ee.png"},"imageCaption":"A) Diagram of the purine salvage pathway. The enzymes ADAH-1 and PNP-1, which negatively regulate the C. elegans IPR, are shown in red. ADAH-1 and PNP-1 also act on deoxy forms of nucleosides, not shown for simplicity.
B) Representative images of C. elegans jyIs8[pals-5p::GFP; myo-2p::mCherry] X adults following treatment with control, adah-1, or pnp-1 RNAi. pals-5p::GFP is expressed when the IPR is activated; myo-2p::mCherry is a co-expression marker in the pharynx. Scale bar = 100 μm
C) RT-qPCR of C. briggsae mfIs42[Cel-sid-2 + Cel-myo-2::DsRed] following treatment with control, Cbr-adah-1, or Cbr-pnp-1 RNAi. Expression of Cbr-adah-1, Cbr-pnp-1, and three Cbr-pals genes (CBG06463, CBG06596, and CBG30948) was analyzed for fold change relative to control RNAi-treated animals.
D) RT-qPCR of C. remanei mfEx34[Cel-sid-2 + Cel-myo-2::DsRed] following treatment with control, Cre-adah-1, or Cre-pnp-1 RNAi. Expression of Cre-adah-1, Cre-pnp-1, and three Cre-pals genes (CRE18779, CRE09158, and CRE27419) was analyzed for fold change relative to control RNAi-treated animals.
E) Representative images of C. briggsae mfIs42 animals treated with control, Cbr-pnp-1, or Cbr-adah-1 RNAi (top) or C. elegans wild-type and pnp-1(jy121) mutants in the jyIs8 background (bottom) stained with N. parisii-specific FISH probe (red-orange fluorescence). Solid black lines denote regions of worms quantified for N. parisii infection in F, while white dashed lines denote pharyngeal areas with co-expression markers that were omitted from infection quantification. Scale bar = 100 μm
F) Quantification of N. parisii FISH fluorescence. ** p < 0.01, * p < 0.05, ns = not significant, one-way ANOVA with Tukey's multiple comparisons test. n = 3 independent infection experiments (73-81 animals analyzed per strain and condition total). Circles represent average N. parisii FISH fluorescence normalized to body area. Bar heights indicate mean values, and error bars represent standard deviations.
C, D) **** p < 0.0001, ** p < 0.01, * p < 0.05, unpaired, one-tailed Welch's T-test. n = 4 independent experimental replicates; Circles represent the expression values for individual replicates. Bar heights indicate mean values, and error bars represent standard deviations.
","imageTitle":"Purine salvage enzymes have conserved immune regulatory roles in C. elegans, C. briggsae, and C. remanei
","methods":"Worm strain maintenance
C. elegans, C. briggsae, and C. remanei strains (Table 1) were maintained at 21 °C on Nematode Growth Media (NGM) plates seeded with Escherichia coli OP50-1. RNAi experiments were performed at 22 °C on NGM plates supplemented with 1 mM Carbenicillin and 5 mM IPTG seeded with E. coli HT115(DE3) carrying the desired dsRNA expression plasmids (Table 2). Seeded RNAi plates were grown in the dark at room temperature (RT) for at least 3 days before adding worms.
IPR reporter imaging
P0 L4s of C. elegans jyIs8 were picked to 6-cm RNAi plates seeded with control, adah-1, or pnp-1 RNAi. F1 adults were then picked to the same RNAi treatments. F2 adults were imaged for IPR reporter expression on a Zeiss Axioscope 7.
Cloning
cDNA sequences for Cbr/Cre-adah-1 or Cbr/Cre-pnp-1 were synthesized as gene fragments (Twist Biosciences) and inserted into linearized pL4440 between the T7 promoters by NEBuilder HiFi assembly (New England Biolabs). Assembled plasmids were transformed into DH5a chemically competent cells (Thermo Fisher Scientific). Candidate clones were miniprepped (Qiagen) and sequence-confirmed for the desired insertion using Sanger and PlasmidEZ whole-vector sequencing (Azenta Life Sciences). Verified plasmids were subsequently transformed into chemically competent HT115(DE3) bacteria prepared with the Mix & Go E. coli Transformation Kit (Zymo Research). Genbank files for each plasmid vector generated in this study are included as Extended Data.
RNA extraction and RT-qPCR
For C. briggsae mfIs42, ~10-12 P0 L4s were picked to 10-cm RNAi plates seeded with control, Cbr-adah-1, or Cbr-pnp-1 RNAi. ~10-12 F1 adults were then picked to 2 x 10-cm RNAi plates of the same treatments. After 3 days, F2s were enriched for L4 and adult life stages by gravity settling in M9 in a 15 mL conical tube for RNA extraction. For C. remanei mfEx34, a mixed-stage plate was chunked to 10-cm RNAi plates seeded with control, Cre-adah-1, or Cre-pnp-1 RNAi. After 3 days, F1 mixed-stage worms were chunked again to 2 x 10-cm RNAi plates of the same treatments. After 3 days, F2s were enriched for L4 and adult life stages by gravity settling in M9 in a 15 mL conical tube for RNA extraction. For both species, total RNA was purified as previously described (Gang et al., 2022) and converted to cDNA using iScript (Bio-Rad). RT-qPCR was performed with iQ SYBR Green using a CFX Connect machine running CFX Maestro v1.1 (Bio-Rad). RT-qPCR data was normalized to the Cbr/Cre-eef-2 gene using the Pfaffl method (Pfaffl, 2001). To assess expression, Cbr/Cre-adah-1 and Cbr/Cre-pnp-1 knockdown samples were normalized to control RNAi-treated samples. RT-qPCR primers are listed in Table 3.
Microsporidia infection
mfIs42 P0 and F1 generations were picked to seeded 10-cm RNAi plates as described above. ~125 F2 L4s for each treatment were then picked to 6-cm NGM plates seeded with a thin lawn of OP50-1 covering the entire surface. A mixture of 1 million N. parisii spores, 50 µL of 10X-concentrated OP50-1, and M9 to a total volume of 300 µL was then top-plated, spread evenly across the surface, and dried at RT for 10 minutes. The infection plates were transferred to 25 °C for 3 h. Infected worms were washed off the plates in M9, pelleted, and transferred to 6-cm RNAi plates seeded with HT115(DE3) to sustain knockdown of the desired genes, without additional N. parisii spores, and returned to 25 °C for 27 h. At 30 hpi, worms were fixed in 4% paraformaldehyde for 30 min at RT. Worms were FISH-stained with 5 ng/µL N. parisii-specific MicroB CF610 probe (Biosearch Technologies), imaged on a Zeiss Axioscope 7, and infection was quantified using ImageJ as previously described (Gang et al., 2022).
Statistics
All statistical tests were performed in GraphPad Prism version 11. The statistical test used in each experiment, number of replicates performed, and summary of test results are described in the corresponding figure legend panel. All individual data points and the complete results of statistical tests performed are included as Extended Data.
","reagents":"Table 1. Worm Strains
Strain | Genotype | Description | Source |
Transcriptional reporter for the C. elegans Intracelluar Pathogen Response (IPR) | Bakowski et al. 2014 | ||
C. briggsae AF16 sensitized for ingestion of dsRNA via expression of C. elegans SID-2 | Nuez and Félix 2012 | ||
C. remanei PB4641 sensitized for ingestion of dsRNA via expression of C. elegans SID-2 | Nuez and Félix 2012 | ||
CRISPR/Cas9-mediated knockout of endogenous pnp-1 + IPR transcriptional reporter | Tecle et al. 2021 |
Table 2. Plasmids
Plasmid | Genotype | Description | Source |
pL4440 | pL4440 RNAi control | pL4440 RNAi feeding vector without nematode gene target inserted | Ahringer RNAi library |
pL4440-pnp-1 | pL4440-pnp-1 | pL4440 RNAi feeding vector targeting pnp-1 | Ahringer RNAi library, Wernet et al. 2025 |
pL4440-adah-1 | pL4440-adah-1 | pL4440 RNAi feeding vector targeting adah-1 | Ahringer RNAi library, Wernet et al. 2025 |
pSSG001 | pL4440-Cbr-pnp-1 | pL4440 RNAi feeding vector with 647 bp of Cbr-pnp-1 cDNA inserted targeting exons 2 and 3, isoform A | This study |
pSSG004 | pL4440-Cbr-adah-1 | pL4440 RNAi feeding vector with 700 bp of Cbr-adah-1 cDNA inserted targeting exons 1-4, isoform A | This study |
pSSG015 | pL4440-Cre-adah-1 | pL4440 RNAi feeding vector with 450 bp of Cre-adah-1 cDNA inserted targeting exon 5 | This study |
pSSG016 | pL4440-Cre-pnp-1 | pL4440 RNAi feeding vector with 400 bp of Cre-pnp-1 cDNA inserted targeting exon 2 | This study |
Table 3. qPCR Primers
Gene Name | Primer Description | Sequence |
Cbr-eef-2 RT-qPCR - Forward | GCTTACTTGCCTGTCAACGAGTC | |
Cbr-eef-2 RT-qPCR - Reverse | CGGTGTTGGAGCGGAGA | |
Cbr-adah-1 RT-qPCR - Forward | AAAGCTCAACTCAACGCTGCC | |
Cbr-adah-1 RT-qPCR - Reverse | TGGCTCTCCAGCTTCAACTAGT | |
Cbr-pnp-1 RT-qPCR - Forward | TGCTAACCTGGACGCTGATCA | |
Cbr-pnp-1 RT-qPCR - Reverse | ACGAATCGAGATGCTCGCTCT | |
CBG06463 RT-qPCR - Forward | ACTACCTCCGATCGGTTGAGATGT | |
CBG06463 RT-qPCR - Reverse | GCAGTCAGAGGGCTCGTGTAC | |
CBG06596 RT-qPCR - Forward | GCTCTCATCTGCTCTAACCGCT | |
CBG06596 RT-qPCR - Reverse | ACGGTTTGGAAAAGTTGCGGAG | |
CBG30948 RT-qPCR - Forward | AGCTTCCCTGAATGATGATCCA | |
CBG30948 RT-qPCR - Reverse | AACGTTCCGATCAGGTCACCC | |
Cre-eef-2 RT-qPCR - Forward | AGGAGTCCCAAGTCACCGGAA | |
Cre-eef-2 RT-qPCR - Reverse | GCTTGTCCTCCGGTGTTGGAA | |
Cre-adah-1 RT-qPCR - Forward | GCTGCCCGTTCCTGTTTCCTA | |
Cre-adah-1 RT-qPCR - Reverse | TCCGGCCTGAACCAACTTCAC | |
Cre-pnp-1 RT-qPCR - Forward | AAAACTGTTGGTGCCGATGCG | |
Cre-pnp-1 RT-qPCR - Reverse | AGCGAGAATCCGAGCACCTTG | |
CRE18779 RT-qPCR - Forward | AGCCGCTCAGCAACAAAGTCA | |
CRE18779 RT-qPCR - Reverse | CCTGAGTGCAGCTCGTTCCTC | |
CRE09158 RT-qPCR - Forward | GACTTTGGCGGCTAACGAGGA | |
CRE09158 RT-qPCR - Reverse | AGCTTCGGCTTCACTGATAGCA | |
CRE27419 RT-qPCR - Forward | CGTGTCCCACGTGCTATTGAATC | |
CRE27419 RT-qPCR - Reverse | CCAATTCGTCGACGCCTTTCG |
The Intracellular Pathogen Response (IPR) is an innate immune program in Caenorhabditis elegans involving the upregulation of a suite of genes in response to natural intracellular pathogens of the intestine, including Orsay virus and microsporidia species like Nematocida parisii (Sarkies et al., 2013; Bakowski et al., 2014; Reddy et al., 2019). In addition to infection, the IPR is also genetically regulated through several parallel pathways (Reddy et al., 2017; Reddy et al., 2019; Sowa et al., 2020; Lazetic et al., 2023). Two such genetic regulators are enzymes of the highly conserved purine salvage pathway, Adenosine Deaminase (ADAH-1, ADA in humans) and Purine Nucleoside Phosphorylase (PNP-1, PNP in humans), which recycle purine nucleosides and bases (Figure 1A) (Tecle et al., 2021; Wernet et al., 2025). Knockout or knockdown of adah-1 or pnp-1 induces expression of the pals-5p::GFP IPR transcriptional reporter (Figure 1B) (Bakowski et al., 2014), as well as many other IPR genes, and promotes resistance to intracellular infections. Thus, ADAH-1 and PNP-1 act as negative regulators of the IPR (Tecle et al., 2021; Wernet et al., 2025).
While the IPR is well-defined in C. elegans, the extent to which this immune program is conserved or divergent among related nematode species is unclear. Infection of Caenorhabditis briggsae with Santeuil virus or Nematocida species of microsporidia induces the upregulation of several gene families in common with the C. elegans IPR, such as pals and DUF713 genes, suggesting broadly similar transcriptional responses to intracellular infection (Chen et al., 2017; Wan et al., 2022). However, whether known genetic regulators of the IPR serve similar functions outside of C. elegans has not been investigated.
Here, to determine whether orthologs of adah-1 and pnp-1 have conserved immune regulatory roles, we used C. briggsae and Caenorhabditis remanei strains transgenically modified to express C. elegans SID-2, which enables uptake of dsRNA to induce systemic RNA interference (RNAi) by feeding (Winston et al., 2007; Nuez & Felix, 2012). We cloned cDNA fragments of Cbr-adah-1 and Cbr-pnp-1 into the L4440 RNAi plasmid vector, transformed HT115 bacteria, and performed RNAi by feeding C. briggsae mfIs42[Cel-sid-2 + Cel-myo-2::DsRed] animals dsRNA targeting each gene. RT-qPCR showed knockdown of Cbr-adah-1 and Cbr-pnp-1 transcript levels and the upregulation of three Cbr-pals genes (CBG06463, CBG06596, and CBG30948) when compared to control RNAi-treated animals (Figure 1C). CBG06596 and CBG30948 were induced to comparable levels as previously demonstrated for pals-5 following adah-1 and pnp-1 RNAi (Wernet et al., 2025). Notably, all three Cbr-pals genes tested were also previously shown to be upregulated during infection by Santeuil virus, N. parisii, or both pathogens, suggesting these genes are both genetically and infection-regulated, like pals genes of the C. elegans IPR (Chen et al., 2017; Wan et al., 2022).
Next, we cloned cDNA fragments for Cre-adah-1 and Cre-pnp-1 into L4440 and performed RNAi by feeding C. remanei mfEx34[Cel-sid-2 + Cel-myo-2::DsRed] animals dsRNA targeting each gene. As with C. briggsae, we were able to knock down the expression of Cre-adah-1 and Cre-pnp-1 and observed upregulation of three Cre-pals genes (CRE18779, CRE09158, and CRE27419) compared with control RNAi-treated animals (Figure 1D). Cre-pals genes were not induced to the same degree as Cbr-pals genes (~3 to 500-fold in C. briggsae versus ~3-14-fold in C. remanei) (Figure 1C, D). This reduced induction could be an intrinsic property of pals gene family regulation in this species or the inducibility of the specific genes tested. Alternatively, we note that knockdown of Cre-adah-1/pnp-1 was not as effective as Cbr-adah-1/pnp-1 (~0.083 and 0.085-fold in C. briggsae versus ~0.19 and 0.28-fold in C. remanei) (Figure 1C, D). This suggests that RNAi may be less efficient in C. remanei mfEx34, leading to higher background activity of the targeted enzyme and muted upregulation of the Cre-pals genes. We do not attribute this effect to the extrachromosomal inheritance pattern of the mfEx34 transgene, as this strain has previously been reported as a spontaneous integrant; we similarly observe 100% inheritance of this transgene (Nuez & Felix, 2012). Taken together, our results demonstrate that Cbr/Cre-adah-1 and Cbr/Cre-pnp-1 negatively regulate pals gene expression, indicating conserved immune regulatory roles for these purine salvage enzymes, like adah-1 and pnp-1 for the IPR.
Constitutive expression of the C. elegans IPR promotes resistance to intracellular infection in the intestine (Reddy et al., 2019; Tecle et al., 2021; Lazetic et al., 2023; Wernet et al., 2025). While pals gene expression is a useful proxy for IPR induction, only one induced C. elegans pals gene has been shown to confer resistance (Raman et al., 2024). Therefore, analyzing Cbr/Cre-pals expression after knocking down purine salvage enzymes may not fully capture whether a broader IPR-like immune program and its associated phenotypes are induced. To assess intracellular pathogen susceptibility, we performed Cbr-adah-1/pnp-1 RNAi and infected C. briggsae mfIs42 animals with N. parisii. We focused our analysis on C. briggsae for two reasons: 1) more potent RNAi and induction of pals genes (Figure 1C), and 2) both C. briggsae and C. elegans are infected by N. parisii, which allowed for the inclusion of C. elegans strains as controls in our experiment; N. parisii cannot infect C. remanei (Zhang et al., 2016; Wadi et al., 2023). At 30 hours post-infection, we FISH-stained C. briggsae mfIs42 RNAi-treated animals with a probe targeting N. parisii rRNA and quantified FISH fluorescence (Troemel et al., 2008). Knockdown of Cbr-pnp-1 and Cbr-adah-1 resulted in reduced average FISH fluorescence when compared to control RNAi-treated animals, consistent with increased microsporidia resistance (Figure 1E, F). The degree of resistance observed in C. briggsae was similar to that of C. elegans pnp-1(jy121) mutants when compared to wild-type animals (Figure 1E, F) (Tecle et al., 2021). These findings further support a conserved role for purine salvage enzymes as negative regulators of an innate immune program against intracellular pathogens in a distinct Caenorhabditis species.
In this study, we sought to determine if purine salvage enzymes that act as negative regulators of the C. elegans IPR, ADAH-1 and PNP-1 (Figure 1A, B), serve similar immune-regulatory roles in related nematode species. We cloned cDNA fragments of Cbr/Cre-adah-1 and Cbr/Cre-pnp-1 into L4440 and utilized RNAi-competent C. briggsae and C. remanei strains to knock down these enzymes. In both species, knockdown induced pals gene expression indicative of IPR-like immune activation (Figure 1C, D). Additionally, knockdown of Cbr-adah-1 and Cbr-pnp-1 promoted N. parisii resistance (Figure 1E, F). Purine salvage metabolism represents just one of several parallel genetic pathways that regulate the C. elegans IPR. Other regulators include members of the pals gene family that act in antagonistic modules (Reddy et al., 2019; Lazetic et al., 2023), drh-1 as a sensor of dsRNA during viral infection (Sowa et al., 2020; Batachari et al., 2024), and zip-1 as a transcription factor that acts downstream of these factors and controls a subset of IPR genes (Lazetic et al., 2022). Future work can evaluate whether these genetic regulators have broadly conserved immune regulatory roles, as assessed here for Cbr/Cre-adah-1 and Cbr/Cre-pnp-1, whether these genes have divergent functions, or whether novel regulators have evolved in the diverse nematode species that are susceptible to intracellular pathogens.
","references":[{"reference":"Bakowski MA, Desjardins CA, Smelkinson MG, Dunbar TL, Lopez-Moyado IF, Rifkin SA, Cuomo CA, Troemel ER. 2014. Ubiquitin-mediated response to microsporidia and virus infection in C. elegans. PLoS Pathog 10(6): e1004200.
","pubmedId":"24945527","doi":""},{"reference":"Batachari LE, Dai AY, Troemel ER. 2024. Caenorhabditis elegans RIG-I-like receptor DRH-1 signals via CARDs to activate antiviral immunity in intestinal cells. Proc Natl Acad Sci U S A 121(29): e2402126121.
","pubmedId":"38980902","doi":""},{"reference":"Chen K, Franz CJ, Jiang H, Jiang Y, Wang D. 2017. An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18(1): 303.
","pubmedId":"28415971","doi":""},{"reference":"Gang SS, Grover M, Reddy KC, Raman D, Chang YT, Ekiert DC, Barkoulas M, Troemel ER. 2022. A pals-25 gain-of-function allele triggers systemic resistance against natural pathogens of C. elegans. PLoS Genet 18(10): e1010314.
","pubmedId":"36191002","doi":""},{"reference":"Lažetić V, Blanchard MJ, Bui T, Troemel ER. 2023. Multiple pals gene modules control a balance between immunity and development in Caenorhabditis elegans. PLoS Pathog 19(7): e1011120.
","pubmedId":"37463170","doi":""},{"reference":"Lažetić V, Wu F, Cohen LB, Reddy KC, Chang YT, Gang SS, Bhabha G, Troemel ER. 2022. The transcription factor ZIP-1 promotes resistance to intracellular infection in Caenorhabditis elegans. Nat Commun 13(1): 17.
","pubmedId":"35013162","doi":""},{"reference":"Nuez I, Félix MA. 2012. Evolution of susceptibility to ingested double-stranded RNAs in Caenorhabditis nematodes. PLoS One 7(1): e29811.
","pubmedId":"22253787","doi":""},{"reference":"Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9): e45.
","pubmedId":"11328886","doi":""},{"reference":"Raman D, Wernet N, Gang S, Troemel E. 2024. PALS-14 promotes resistance to Nematocida parisii infection in Caenorhabditis elegans. MicroPubl Biol 2024: 10.17912/micropub.biology.001325.
","pubmedId":"39473452","doi":""},{"reference":"Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER. 2017. An Intracellular Pathogen Response Pathway Promotes Proteostasis in C. elegans. Curr Biol 27(22): 3544-3553.e5.
","pubmedId":"29103937","doi":""},{"reference":"Reddy KC, Dror T, Underwood RS, Osman GA, Elder CR, Desjardins CA, et al., Troemel ER. 2019. Antagonistic paralogs control a switch between growth and pathogen resistance in C. elegans. PLoS Pathog 15(1): e1007528.
","pubmedId":"30640956","doi":""},{"reference":"Sarkies P, Ashe A, Le Pen J, McKie MA, Miska EA. 2013. Competition between virus-derived and endogenous small RNAs regulates gene expression in Caenorhabditis elegans. Genome Res 23(8): 1258-70.
","pubmedId":"23811144","doi":""},{"reference":"Sowa JN, Jiang H, Somasundaram L, Tecle E, Xu G, Wang D, Troemel ER. 2020. The Caenorhabditis elegans RIG-I Homolog DRH-1 Mediates the Intracellular Pathogen Response upon Viral Infection. J Virol 94(2): 10.1128/JVI.01173-19.
","pubmedId":"31619561","doi":""},{"reference":"Tecle E, Chhan CB, Franklin L, Underwood RS, Hanna-Rose W, Troemel ER. 2021. The purine nucleoside phosphorylase pnp-1 regulates epithelial cell resistance to infection in C. elegans. PLoS Pathog 17(4): e1009350.
","pubmedId":"33878133","doi":""},{"reference":"Troemel ER, Félix MA, Whiteman NK, Barrière A, Ausubel FM. 2008. Microsporidia are natural intracellular parasites of the nematode Caenorhabditis elegans. PLoS Biol 6(12): 2736-52.
","pubmedId":"19071962","doi":""},{"reference":"Wadi L, El Jarkass HT, Tran TD, Islah N, Luallen RJ, Reinke AW. 2023. Genomic and phenotypic evolution of nematode-infecting microsporidia. PLoS Pathog 19(7): e1011510.
","pubmedId":"37471459","doi":""},{"reference":"Wan YC, Troemel ER, Reinke AW. 2022. Conservation of Nematocida microsporidia gene expression and host response in Caenorhabditis nematodes. PLoS One 17(12): e0279103.
","pubmedId":"36534656","doi":""},{"reference":"Wernet ND, Tecle E, Sarmiento MB, Kuo CJ, Chhan CB, Baick I, et al., Troemel ER. 2025. Adenosine deaminase and deoxyadenosine regulate intracellular immune response in C. elegans. iScience 28(3): 111950.
","pubmedId":"40034845","doi":""},{"reference":"Winston WM, Sutherlin M, Wright AJ, Feinberg EH, Hunter CP. 2007. Caenorhabditis elegans SID-2 is required for environmental RNA interference. Proc Natl Acad Sci U S A 104(25): 10565-70.
","pubmedId":"17563372","doi":""},{"reference":"Zhang G, Sachse M, Prevost MC, Luallen RJ, Troemel ER, Félix MA. 2016. A Large Collection of Novel Nematode-Infecting Microsporidia and Their Diverse Interactions with Caenorhabditis elegans and Other Related Nematodes. PLoS Pathog 12(12): e1006093.
","pubmedId":"27942022","doi":""}],"title":"Purine salvage enzymes are innate immune regulators in Caenorhabditis briggsae and Caenorhabditis remanei
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":"1789001418922"},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1789661308486"}]},{"id":"e160b755-e416-4957-96fa-bfcc5e8bb99a","decision":"publish","abstract":"In Caenorhabditis elegans, disruption of the purine salvage enzymes ADAH-1 or PNP-1 induces an innate immune program coined the Intracellular Pathogen Response (IPR). To determine if these enzymes have conserved immune regulatory roles, we utilized RNAi-competent strains of Caenorhabditis briggsae and Caenorhabditis remanei to knock down Cbr/Cre-adah-1 and Cbr/Cre-pnp-1. In both species, knockdown of these enzymes induces expression of Cbr/Cre-pals genes, a hallmark of the C. elegans IPR. Furthermore, knockdown of Cbr-adah-1 or Cbr-pnp-1 promotes resistance to the microsporidia species Nematocida parisii. Our results suggest that perturbations to purine salvage metabolism may activate innate immune programs across Caenorhabditis species.
","acknowledgements":"We thank Dr. Emily Troemel and Dr. Eillen Tecle for insightful feedback on the manuscript. We thank Colorado College summer research students Caroline Bay and Joselyn Campuzano for helpful suggestions during the early stages of project development.
","authors":[{"affiliations":["Colorado College, Colorado Springs, CO, United States"],"departments":["Department of Molecular Biology"],"credit":["conceptualization","investigation","methodology","writing_reviewEditing"],"email":"m_flannery2023@ColoradoCollege.edu","firstName":"Mya G.","lastName":"Flannery","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Emory University, Atlanta, GA, United States"],"departments":["School of Medicine"],"credit":["conceptualization","investigation","methodology","writing_reviewEditing"],"email":"mona.hamad@emory.edu","firstName":"Mona A.","lastName":"Hamad","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Colorado College, Colorado Springs, CO, United States"],"departments":["Department of Molecular Biology"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","supervision","writing_originalDraft","writing_reviewEditing"],"email":"sgang2023@coloradocollege.edu","firstName":"Spencer S.","lastName":"Gang","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5907-0631"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Genbank plasmid sequence file for pSSG001
","doi":"10.22002/cn2g0-w7t31","resourceType":"Dataset","name":"pSSG001_L4440-Cbr-pnp-1.gb","url":"https://portal.micropublication.org/uploads/8416e2febce6034eba9334d8e6d1f244.gb"},{"description":"Genbank plasmid sequence file for pSSG004
","doi":"10.22002/sjxqd-n0t03","resourceType":"Dataset","name":"pSSG004_L4440-Cbr-adah-1.gb","url":"https://portal.micropublication.org/uploads/aa046e7306041d277221b3134a38ce51.gb"},{"description":"Genbank plasmid sequence file for pSSG015
","doi":"10.22002/qhrk7-de075","resourceType":"Dataset","name":"pSSG015_L4440-Cre-adah-1.gb","url":"https://portal.micropublication.org/uploads/40b2e42efa09d27f08336a00c1bce609.gb"},{"description":"Genbank plasmid sequence file for pSSG016
","doi":"10.22002/d9w52-jvr62","resourceType":"Dataset","name":"pSSG016_L4440-Cre-pnp-1.gb","url":"https://portal.micropublication.org/uploads/e94a4c15286e7596cd9d51665ac824b1.gb"},{"description":"Raw data and statistics summary for Figures 1C, 1D, and 1F
","doi":"10.22002/26eec-pdn25","resourceType":"Dataset","name":"Raw Data and Statistics Summary_1C,1D,1F.xlsx","url":"https://portal.micropublication.org/uploads/14ec9ca86bb03a63679a5e728ddb09e5.xlsx"}],"funding":"Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by the Colorado College Figge-Bourquin Endowment and Natural Sciences Executive Committee Research and Development Grant.
","image":{"url":"https://portal.micropublication.org/uploads/6a90666a857948fe838295bf2119b8ee.png"},"imageCaption":"A) Diagram of the purine salvage pathway. The enzymes ADAH-1 and PNP-1, which negatively regulate the C. elegans IPR, are shown in red. ADAH-1 and PNP-1 also act on deoxy forms of nucleosides, not shown for simplicity.
B) Representative images of C. elegans jyIs8[pals-5p::GFP; myo-2p::mCherry] X adults following treatment with control, adah-1, or pnp-1 RNAi. pals-5p::GFP is expressed when the IPR is activated; myo-2p::mCherry is a co-expression marker in the pharynx. Scale bar = 100 μm
C) RT-qPCR of C. briggsae mfIs42[Cel-sid-2 + Cel-myo-2::DsRed] following treatment with control, Cbr-adah-1, or Cbr-pnp-1 RNAi. Expression of Cbr-adah-1, Cbr-pnp-1, and three Cbr-pals genes (CBG06463, CBG06596, and CBG30948) was analyzed for fold change relative to control RNAi-treated animals.
D) RT-qPCR of C. remanei mfEx34[Cel-sid-2 + Cel-myo-2::DsRed] following treatment with control, Cre-adah-1, or Cre-pnp-1 RNAi. Expression of Cre-adah-1, Cre-pnp-1, and three Cre-pals genes (CRE18779, CRE09158, and CRE27419) was analyzed for fold change relative to control RNAi-treated animals.
E) Representative images of C. briggsae mfIs42 animals treated with control, Cbr-pnp-1, or Cbr-adah-1 RNAi (top) or C. elegans wild-type and pnp-1(jy121) mutants in the jyIs8 background (bottom) stained with N. parisii-specific FISH probe (red-orange fluorescence). Solid black lines denote regions of worms quantified for N. parisii infection in F, while white dashed lines denote pharyngeal areas with co-expression markers that were omitted from infection quantification. Scale bar = 100 μm
F) Quantification of N. parisii FISH fluorescence. ** p < 0.01, * p < 0.05, ns = not significant, one-way ANOVA with Tukey's multiple comparisons test. n = 3 independent infection experiments (73-81 animals analyzed per strain and condition total). Circles represent average N. parisii FISH fluorescence normalized to body area. Bar heights indicate mean values, and error bars represent standard deviations.
C, D) **** p < 0.0001, ** p < 0.01, * p < 0.05, unpaired, one-tailed Welch's T-test. n = 4 independent experimental replicates; Circles represent the expression values for individual replicates. Bar heights indicate mean values, and error bars represent standard deviations.
","imageTitle":"Purine salvage enzymes have conserved immune regulatory roles in C. elegans, C. briggsae, and C. remanei
","methods":"Worm strain maintenance
C. elegans, C. briggsae, and C. remanei strains (Table 1) were maintained at 21 °C on Nematode Growth Media (NGM) plates seeded with Escherichia coli OP50-1. RNAi experiments were performed at 22 °C on NGM plates supplemented with 1 mM Carbenicillin and 5 mM IPTG seeded with E. coli HT115(DE3) carrying the desired dsRNA expression plasmids (Table 2). Seeded RNAi plates were grown in the dark at room temperature (RT) for at least 3 days before adding worms.
IPR reporter imaging
P0 L4s of C. elegans jyIs8 were picked to 6-cm RNAi plates seeded with control, adah-1, or pnp-1 RNAi. F1 adults were then picked to the same RNAi treatments. F2 adults were imaged for IPR reporter expression on a Zeiss Axioscope 7.
Cloning
cDNA sequences for Cbr/Cre-adah-1 or Cbr/Cre-pnp-1 were synthesized as gene fragments (Twist Biosciences) and inserted into linearized pL4440 between the T7 promoters by NEBuilder HiFi assembly (New England Biolabs). Assembled plasmids were transformed into DH5α chemically competent cells (Thermo Fisher Scientific). Candidate clones were miniprepped (Qiagen) and sequence-confirmed for the desired insertion using Sanger and PlasmidEZ whole-vector sequencing (Azenta Life Sciences). Verified plasmids were subsequently transformed into chemically competent HT115(DE3) bacteria prepared with the Mix & Go E. coli Transformation Kit (Zymo Research). Genbank files for each plasmid vector generated in this study are included as Extended Data.
RNA extraction and RT-qPCR
For C. briggsae mfIs42, ~10-12 P0 L4s were picked to 10-cm RNAi plates seeded with control, Cbr-adah-1, or Cbr-pnp-1 RNAi. ~10-12 F1 adults were then picked to 2 x 10-cm RNAi plates of the same treatments. After 3 days, F2s were enriched for L4 and adult life stages by gravity settling in M9 in a 15 mL conical tube for RNA extraction. For C. remanei mfEx34, a mixed-stage plate was chunked to 10-cm RNAi plates seeded with control, Cre-adah-1, or Cre-pnp-1 RNAi. After 3 days, F1 mixed-stage worms were chunked again to 2 x 10-cm RNAi plates of the same treatments. After 3 days, F2s were enriched for L4 and adult life stages by gravity settling in M9 in a 15 mL conical tube for RNA extraction. For both species, total RNA was purified as previously described (Gang et al., 2022) and converted to cDNA using iScript (Bio-Rad). RT-qPCR was performed with iQ SYBR Green using a CFX Connect machine running CFX Maestro v1.1 (Bio-Rad). RT-qPCR data was normalized to the Cbr/Cre-eef-2 gene using the Pfaffl method (Pfaffl, 2001). To assess expression, Cbr/Cre-adah-1 and Cbr/Cre-pnp-1 knockdown samples were normalized to control RNAi-treated samples. RT-qPCR primers are listed in Table 3.
Microsporidia infection
mfIs42 P0 and F1 generations were picked to seeded 10-cm RNAi plates as described above. ~125 F2 L4s for each treatment were then picked to 6-cm NGM plates seeded with a thin lawn of OP50-1 covering the entire surface. A mixture of 1 million N. parisii spores, 50 µL of 10X-concentrated OP50-1, and M9 to a total volume of 300 µL was then top-plated, spread evenly across the surface, and dried at RT for 10 minutes. The infection plates were transferred to 25 °C for 3 h. Infected worms were washed off the plates in M9, pelleted, and transferred to 6-cm RNAi plates seeded with HT115(DE3) to sustain knockdown of the desired genes, without additional N. parisii spores, and returned to 25 °C for 27 h. At 30 hpi, worms were fixed in 4% paraformaldehyde for 30 min at RT. Worms were FISH-stained with 5 ng/µL N. parisii-specific MicroB CF610 probe (Biosearch Technologies), imaged on a Zeiss Axioscope 7, and infection was quantified using ImageJ as previously described (Gang et al., 2022).
Statistics
All statistical tests were performed in GraphPad Prism version 11. The statistical test used in each experiment, number of replicates performed, and summary of test results are described in the corresponding figure legend panel. All individual data points and the complete results of statistical tests performed are included as Extended Data.
","reagents":"Table 1. Worm Strains
Strain | Genotype | Description | Source |
Transcriptional reporter for the C. elegans Intracelluar Pathogen Response (IPR) | Bakowski et al. 2014 | ||
C. briggsae AF16 sensitized for ingestion of dsRNA via expression of C. elegans SID-2 | Nuez and Félix 2012 | ||
C. remanei PB4641 sensitized for ingestion of dsRNA via expression of C. elegans SID-2 | Nuez and Félix 2012 | ||
CRISPR/Cas9-mediated knockout of endogenous pnp-1 + IPR transcriptional reporter | Tecle et al. 2021 |
Table 2. Plasmids
Plasmid | Genotype | Description | Source |
pL4440 | pL4440 RNAi control | pL4440 RNAi feeding vector without nematode gene target inserted | Ahringer RNAi library |
pL4440-pnp-1 | pL4440-pnp-1 | pL4440 RNAi feeding vector targeting pnp-1 | Ahringer RNAi library, Wernet et al. 2025 |
pL4440-adah-1 | pL4440-adah-1 | pL4440 RNAi feeding vector targeting adah-1 | Ahringer RNAi library, Wernet et al. 2025 |
pSSG001 | pL4440-Cbr-pnp-1 | pL4440 RNAi feeding vector with 647 bp of Cbr-pnp-1 cDNA inserted targeting exons 2 and 3, isoform A. See .gb file in Extended Data for exact sequence. | This study |
pSSG004 | pL4440-Cbr-adah-1 | pL4440 RNAi feeding vector with 700 bp of Cbr-adah-1 cDNA inserted targeting exons 1-4, isoform A. See .gb file in Extended Data for exact sequence. | This study |
pSSG015 | pL4440-Cre-adah-1 | pL4440 RNAi feeding vector with 450 bp of Cre-adah-1 cDNA inserted targeting exon 5. See .gb file in Extended Data for exact sequence. | This study |
pSSG016 | pL4440-Cre-pnp-1 | pL4440 RNAi feeding vector with 400 bp of Cre-pnp-1 cDNA inserted targeting exon 2. See .gb file in Extended Data for exact sequence. | This study |
Table 3. qPCR Primers
Gene Name | Primer Description | Sequence |
Cbr-eef-2 RT-qPCR - Forward | GCTTACTTGCCTGTCAACGAGTC | |
Cbr-eef-2 RT-qPCR - Reverse | CGGTGTTGGAGCGGAGA | |
Cbr-adah-1 RT-qPCR - Forward | AAAGCTCAACTCAACGCTGCC | |
Cbr-adah-1 RT-qPCR - Reverse | TGGCTCTCCAGCTTCAACTAGT | |
Cbr-pnp-1 RT-qPCR - Forward | TGCTAACCTGGACGCTGATCA | |
Cbr-pnp-1 RT-qPCR - Reverse | ACGAATCGAGATGCTCGCTCT | |
CBG06463 RT-qPCR - Forward | ACTACCTCCGATCGGTTGAGATGT | |
CBG06463 RT-qPCR - Reverse | GCAGTCAGAGGGCTCGTGTAC | |
CBG06596 RT-qPCR - Forward | GCTCTCATCTGCTCTAACCGCT | |
CBG06596 RT-qPCR - Reverse | ACGGTTTGGAAAAGTTGCGGAG | |
CBG30948 RT-qPCR - Forward | AGCTTCCCTGAATGATGATCCA | |
CBG30948 RT-qPCR - Reverse | AACGTTCCGATCAGGTCACCC | |
Cre-eef-2 RT-qPCR - Forward | AGGAGTCCCAAGTCACCGGAA | |
Cre-eef-2 RT-qPCR - Reverse | GCTTGTCCTCCGGTGTTGGAA | |
Cre-adah-1 RT-qPCR - Forward | GCTGCCCGTTCCTGTTTCCTA | |
Cre-adah-1 RT-qPCR - Reverse | TCCGGCCTGAACCAACTTCAC | |
Cre-pnp-1 RT-qPCR - Forward | AAAACTGTTGGTGCCGATGCG | |
Cre-pnp-1 RT-qPCR - Reverse | AGCGAGAATCCGAGCACCTTG | |
CRE18779 RT-qPCR - Forward | AGCCGCTCAGCAACAAAGTCA | |
CRE18779 RT-qPCR - Reverse | CCTGAGTGCAGCTCGTTCCTC | |
CRE09158 RT-qPCR - Forward | GACTTTGGCGGCTAACGAGGA | |
CRE09158 RT-qPCR - Reverse | AGCTTCGGCTTCACTGATAGCA | |
CRE27419 RT-qPCR - Forward | CGTGTCCCACGTGCTATTGAATC | |
CRE27419 RT-qPCR - Reverse | CCAATTCGTCGACGCCTTTCG |
The Intracellular Pathogen Response (IPR) is an innate immune program in Caenorhabditis elegans involving the upregulation of a suite of genes in response to natural intracellular pathogens of the intestine, including Orsay virus and microsporidia species like Nematocida parisii (Sarkies et al., 2013; Bakowski et al., 2014; Reddy et al., 2019). In addition to infection, the IPR is also genetically regulated through several parallel pathways (Reddy et al., 2017; Reddy et al., 2019; Sowa et al., 2020; Lazetic et al., 2023). Two such genetic regulators are enzymes of the highly conserved purine salvage pathway, Adenosine Deaminase (ADAH-1, ADA in humans) and Purine Nucleoside Phosphorylase (PNP-1, PNP in humans), which recycle purine nucleosides and bases (Figure 1A) (Tecle et al., 2021; Wernet et al., 2025). Knockout or knockdown of adah-1 or pnp-1 induces expression of the pals-5p::GFP IPR transcriptional reporter (Figure 1B) (Bakowski et al., 2014), as well as many other IPR genes, and promotes resistance to intracellular infections. Thus, ADAH-1 and PNP-1 act as negative regulators of the IPR (Tecle et al., 2021; Wernet et al., 2025).
While the IPR is well-defined in C. elegans, the extent to which this immune program is conserved or divergent among related nematode species is unclear. Infection of Caenorhabditis briggsae with Santeuil virus or Nematocida species of microsporidia induces the upregulation of several gene families in common with the C. elegans IPR, such as pals and DUF713 genes, suggesting broadly similar transcriptional responses to intracellular infection (Chen et al., 2017; Wan et al., 2022). However, whether known genetic regulators of the IPR serve similar functions outside of C. elegans has not been investigated.
Here, to determine whether orthologs of adah-1 and pnp-1 have conserved immune regulatory roles, we used C. briggsae and Caenorhabditis remanei strains transgenically modified to express C. elegans SID-2, which enables uptake of dsRNA to induce systemic RNA interference (RNAi) by feeding (Winston et al., 2007; Nuez & Felix, 2012). We cloned cDNA fragments of Cbr-adah-1 and Cbr-pnp-1 into the L4440 RNAi plasmid vector, transformed HT115 bacteria, and performed RNAi by feeding C. briggsae mfIs42[Cel-sid-2 + Cel-myo-2::DsRed] animals dsRNA targeting each gene. RT-qPCR showed knockdown of Cbr-adah-1 and Cbr-pnp-1 transcript levels and the upregulation of three Cbr-pals genes (CBG06463, CBG06596, and CBG30948) when compared to control RNAi-treated animals (Figure 1C). CBG06596 and CBG30948 were induced to comparable levels as previously demonstrated for pals-5 following adah-1 and pnp-1 RNAi (Wernet et al., 2025). Notably, all three Cbr-pals genes tested were also previously shown to be upregulated during infection by Santeuil virus, N. parisii, or both pathogens, suggesting these genes are both genetically and infection-regulated, like pals genes of the C. elegans IPR (Chen et al., 2017; Wan et al., 2022).
Next, we cloned cDNA fragments for Cre-adah-1 and Cre-pnp-1 into L4440 and performed RNAi by feeding C. remanei mfEx34[Cel-sid-2 + Cel-myo-2::DsRed] animals dsRNA targeting each gene. As with C. briggsae, we were able to knock down the expression of Cre-adah-1 and Cre-pnp-1 and observed upregulation of three Cre-pals genes (CRE18779, CRE09158, and CRE27419) compared with control RNAi-treated animals (Figure 1D). Cre-pals genes were not induced to the same degree as Cbr-pals genes (~3 to 500-fold in C. briggsae versus ~3-14-fold in C. remanei) (Figure 1C, D). This reduced induction could be an intrinsic property of pals gene family regulation in this species or the inducibility of the specific genes tested. Alternatively, we note that knockdown of Cre-adah-1/pnp-1 was not as effective as Cbr-adah-1/pnp-1 (~0.083 and 0.085-fold in C. briggsae versus ~0.19 and 0.28-fold in C. remanei) (Figure 1C, D). This suggests that RNAi may be less efficient in C. remanei mfEx34, leading to higher background activity of the targeted enzyme and muted upregulation of the Cre-pals genes. We do not attribute this effect to the extrachromosomal inheritance pattern of the mfEx34 transgene, as this strain has previously been reported as a spontaneous integrant; we similarly observe 100% inheritance of this transgene (Nuez & Felix, 2012). Taken together, our results demonstrate that Cbr/Cre-adah-1 and Cbr/Cre-pnp-1 negatively regulate pals gene expression, indicating conserved immune regulatory roles for these purine salvage enzymes, like adah-1 and pnp-1 for the IPR.
Constitutive expression of the C. elegans IPR promotes resistance to intracellular infection in the intestine (Reddy et al., 2019; Tecle et al., 2021; Lazetic et al., 2023; Wernet et al., 2025). While pals gene expression is a useful proxy for IPR induction, only one induced C. elegans pals gene has been shown to confer resistance (Raman et al., 2024). Therefore, analyzing Cbr/Cre-pals expression after knocking down purine salvage enzymes may not fully capture whether a broader IPR-like immune program and its associated phenotypes are induced. To assess intracellular pathogen susceptibility, we performed Cbr-adah-1/pnp-1 RNAi and infected C. briggsae mfIs42 animals with N. parisii. We focused our analysis on C. briggsae for two reasons: 1) more potent RNAi and induction of pals genes (Figure 1C), and 2) both C. briggsae and C. elegans are infected by N. parisii, which allowed for the inclusion of C. elegans strains as controls in our experiment; N. parisii cannot infect C. remanei (Zhang et al., 2016; Wadi et al., 2023). At 30 hours post-infection, we FISH-stained C. briggsae mfIs42 RNAi-treated animals with a probe targeting N. parisii rRNA and quantified FISH fluorescence (Troemel et al., 2008). Knockdown of Cbr-pnp-1 and Cbr-adah-1 resulted in reduced average FISH fluorescence when compared to control RNAi-treated animals, consistent with increased microsporidia resistance (Figure 1E, F). The degree of resistance observed in C. briggsae was similar to that of C. elegans pnp-1(jy121) mutants when compared to wild-type animals (Figure 1E, F) (Tecle et al., 2021). These findings further support a conserved role for purine salvage enzymes as negative regulators of an innate immune program against intracellular pathogens in a distinct Caenorhabditis species.
In this study, we sought to determine if purine salvage enzymes that act as negative regulators of the C. elegans IPR, ADAH-1 and PNP-1 (Figure 1A, B), serve similar immune-regulatory roles in related nematode species. We cloned cDNA fragments of Cbr/Cre-adah-1 and Cbr/Cre-pnp-1 into L4440 and utilized RNAi-competent C. briggsae and C. remanei strains to knock down these enzymes. In both species, knockdown induced pals gene expression indicative of IPR-like immune activation (Figure 1C, D). Additionally, knockdown of Cbr-adah-1 and Cbr-pnp-1 promoted N. parisii resistance (Figure 1E, F). Purine salvage metabolism represents just one of several parallel genetic pathways that regulate the C. elegans IPR. Other regulators include members of the pals gene family that act in antagonistic modules (Reddy et al., 2019; Lazetic et al., 2023), drh-1 as a sensor of dsRNA during viral infection (Sowa et al., 2020; Batachari et al., 2024), and zip-1 as a transcription factor that acts downstream of these factors and controls a subset of IPR genes (Lazetic et al., 2022). Future work can evaluate whether these genetic regulators have broadly conserved immune regulatory roles, as assessed here for Cbr/Cre-adah-1 and Cbr/Cre-pnp-1, whether these genes have divergent functions, or whether novel regulators have evolved in the diverse nematode species that are susceptible to intracellular pathogens.
","references":[{"reference":"Bakowski MA, Desjardins CA, Smelkinson MG, Dunbar TL, Lopez-Moyado IF, Rifkin SA, Cuomo CA, Troemel ER. 2014. Ubiquitin-mediated response to microsporidia and virus infection in C. elegans. PLoS Pathog 10(6): e1004200.
","pubmedId":"24945527","doi":""},{"reference":"Batachari LE, Dai AY, Troemel ER. 2024. Caenorhabditis elegans RIG-I-like receptor DRH-1 signals via CARDs to activate antiviral immunity in intestinal cells. Proc Natl Acad Sci U S A 121(29): e2402126121.
","pubmedId":"38980902","doi":""},{"reference":"Chen K, Franz CJ, Jiang H, Jiang Y, Wang D. 2017. An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18(1): 303.
","pubmedId":"28415971","doi":""},{"reference":"Gang SS, Grover M, Reddy KC, Raman D, Chang YT, Ekiert DC, Barkoulas M, Troemel ER. 2022. A pals-25 gain-of-function allele triggers systemic resistance against natural pathogens of C. elegans. PLoS Genet 18(10): e1010314.
","pubmedId":"36191002","doi":""},{"reference":"Lažetić V, Blanchard MJ, Bui T, Troemel ER. 2023. Multiple pals gene modules control a balance between immunity and development in Caenorhabditis elegans. PLoS Pathog 19(7): e1011120.
","pubmedId":"37463170","doi":""},{"reference":"Lažetić V, Wu F, Cohen LB, Reddy KC, Chang YT, Gang SS, Bhabha G, Troemel ER. 2022. The transcription factor ZIP-1 promotes resistance to intracellular infection in Caenorhabditis elegans. Nat Commun 13(1): 17.
","pubmedId":"35013162","doi":""},{"reference":"Nuez I, Félix MA. 2012. Evolution of susceptibility to ingested double-stranded RNAs in Caenorhabditis nematodes. PLoS One 7(1): e29811.
","pubmedId":"22253787","doi":""},{"reference":"Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9): e45.
","pubmedId":"11328886","doi":""},{"reference":"Raman D, Wernet N, Gang S, Troemel E. 2024. PALS-14 promotes resistance to Nematocida parisii infection in Caenorhabditis elegans. MicroPubl Biol 2024: 10.17912/micropub.biology.001325.
","pubmedId":"39473452","doi":""},{"reference":"Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER. 2017. An Intracellular Pathogen Response Pathway Promotes Proteostasis in C. elegans. Curr Biol 27(22): 3544-3553.e5.
","pubmedId":"29103937","doi":""},{"reference":"Reddy KC, Dror T, Underwood RS, Osman GA, Elder CR, Desjardins CA, et al., Troemel ER. 2019. Antagonistic paralogs control a switch between growth and pathogen resistance in C. elegans. PLoS Pathog 15(1): e1007528.
","pubmedId":"30640956","doi":""},{"reference":"Sarkies P, Ashe A, Le Pen J, McKie MA, Miska EA. 2013. Competition between virus-derived and endogenous small RNAs regulates gene expression in Caenorhabditis elegans. Genome Res 23(8): 1258-70.
","pubmedId":"23811144","doi":""},{"reference":"Sowa JN, Jiang H, Somasundaram L, Tecle E, Xu G, Wang D, Troemel ER. 2020. The Caenorhabditis elegans RIG-I Homolog DRH-1 Mediates the Intracellular Pathogen Response upon Viral Infection. J Virol 94(2): 10.1128/JVI.01173-19.
","pubmedId":"31619561","doi":""},{"reference":"Tecle E, Chhan CB, Franklin L, Underwood RS, Hanna-Rose W, Troemel ER. 2021. The purine nucleoside phosphorylase pnp-1 regulates epithelial cell resistance to infection in C. elegans. PLoS Pathog 17(4): e1009350.
","pubmedId":"33878133","doi":""},{"reference":"Troemel ER, Félix MA, Whiteman NK, Barrière A, Ausubel FM. 2008. Microsporidia are natural intracellular parasites of the nematode Caenorhabditis elegans. PLoS Biol 6(12): 2736-52.
","pubmedId":"19071962","doi":""},{"reference":"Wadi L, El Jarkass HT, Tran TD, Islah N, Luallen RJ, Reinke AW. 2023. Genomic and phenotypic evolution of nematode-infecting microsporidia. PLoS Pathog 19(7): e1011510.
","pubmedId":"37471459","doi":""},{"reference":"Wan YC, Troemel ER, Reinke AW. 2022. Conservation of Nematocida microsporidia gene expression and host response in Caenorhabditis nematodes. PLoS One 17(12): e0279103.
","pubmedId":"36534656","doi":""},{"reference":"Wernet ND, Tecle E, Sarmiento MB, Kuo CJ, Chhan CB, Baick I, et al., Troemel ER. 2025. Adenosine deaminase and deoxyadenosine regulate intracellular immune response in C. elegans. iScience 28(3): 111950.
","pubmedId":"40034845","doi":""},{"reference":"Winston WM, Sutherlin M, Wright AJ, Feinberg EH, Hunter CP. 2007. Caenorhabditis elegans SID-2 is required for environmental RNA interference. Proc Natl Acad Sci U S A 104(25): 10565-70.
","pubmedId":"17563372","doi":""},{"reference":"Zhang G, Sachse M, Prevost MC, Luallen RJ, Troemel ER, Félix MA. 2016. A Large Collection of Novel Nematode-Infecting Microsporidia and Their Diverse Interactions with Caenorhabditis elegans and Other Related Nematodes. PLoS Pathog 12(12): e1006093.
","pubmedId":"27942022","doi":""}],"title":"Purine salvage enzymes are innate immune regulators in Caenorhabditis briggsae and Caenorhabditis remanei
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"c33b4d45-54ee-483c-9d28-508d69469c34","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}