T-DNA insertion lines are reported to have a high probability of chromosomal rearrangements such as translocations, which can result in gametophytic developmental defects. Here we report pollen and ovule phenotypes in a RALF17 GABI-Kat insertion line that are present only when the T-DNA is in a hemizygous state, including misshapen mature pollen and an accumulation of callose in the embryo sac. These observations are consistent with phenotypes resulting from chromosomal translocations, often associated with multiple T-DNAs, and we confirmed presence of a second T-DNA insertion. We urge the research community to use alternative knockout lines for reproductive studies of RALF17.
","acknowledgements":"We thank Andrew Fleming and Alice Baillie (University of Sheffield) for discussions at various stages of the project.
","authors":[{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["conceptualization","investigation","visualization","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"j.sloan@sheffield.ac.uk","firstName":"Jen","lastName":"Sloan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-0334-3722"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["conceptualization","investigation","writing_reviewEditing"],"email":"rl.liu2@siat.ac.cn","firstName":"Yui-Leung ","lastName":"Lau","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":" 0000-0002-1459-2639"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["investigation","writing_reviewEditing"],"email":"Amber.Gentle@jic.ac.uk","firstName":"Amber ","lastName":"Gentle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0006-1944-4754"},{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["investigation"],"email":"e.allwood@sheffield.ac.uk","firstName":"Ellen","lastName":"Allwood","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3825-4789"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["investigation"],"email":"V.Cevik@bath.ac.uk","firstName":"Volkan ","lastName":"Cevik","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3545-3179"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["conceptualization","supervision","writing_reviewEditing"],"email":"bssjd@bath.ac.uk","firstName":"James","lastName":"Doughty","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-1459-2639"},{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["dataCuration","supervision","fundingAcquisition","investigation","formalAnalysis","visualization","writing_originalDraft","writing_reviewEditing"],"email":"Lisa.m.smith@sheffield.ac.uk","firstName":"Lisa M","lastName":"Smith","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-2364-8187"}],"awards":[{"awardId":"2019-056","funderName":"Leverhulme Trust (United Kingdom)","awardRecipient":"Lisa Smith"},{"awardId":"BB/W013754/1","funderName":"Biotechnology and Biological Sciences Research Council (United Kingdom)","awardRecipient":"Lisa Smith"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/1fae1a8abb095e013e44ce110f3f1514.jpg"},"imageCaption":"A: Cleared siliques of genotypes used in this study showing a reduced number of seeds in lines where the ralf17 GABI-Kat T-DNA insertion of stock line GK_699G03 is hemizygous but not homozygous. Scale bar 1 mm. B: Seeds counts for each genotype (6 plants per genotype, 7-8 siliques per plant) show lower numbers of seeds are produced when ralf17 is hemizygous in either a cross to wildtype Col-0 or the ralf20 T-DNA insertion. Letters refer to statistically similar groups based Kruskal-Wallis test with a post hoc Dunn’s multiple comparisons test. C: SEM images of pollen grains on mature anthers for each genotype showing pollen defects in the F1 progeny of ralf17/ralf17 x Col-0 and ralf17/ralf17 x ralf20/ralf20 crosses. Scale bar 100 μm. D: Composite image of aniline blue (sirofluor)-stained carpels of each genotype. Callose deposits can be observed in approximately half of the ovules in carpels from F1 progeny of ralf17/ralf17 x Col-0 and ralf17/ralf17 x ralf20/ralf20 crosses. Anthers were removed prior to dehiscence and carpels stained 48 hours after anther removal to ensure ovule maturity. E: Epifluorescence image of callose staining of two ovules from a RALF17/ralf17 RALF20/ralf20 plant showing abnormal callose deposition in the embryo sac of the upper ovule compared to a normal ovule below. F: Quantification of the number of ovules with abnormal vs normal callose levels in the embryo sac for each genotype used in this study. Ovules from 2-3 siliques per plant for 3 plants per line were categorised according to callose level. Means from each plant were used to calculate standard error of the mean. Significantly more ovules had abnormal levels of callose in the RALF17/ralf17 RALF20/ralf20 and RALF17/ralf17 plant compared to Col-0, with letters referring to statistically similar groups based on pair-wise Chi-squared tests with correction for multiple testing. G: Mapping of Illumina reads against the ralf17 gene model confirms insertion in the 5’ UTR. The upper grey histogram indicates read depth, with grey lines below showing individual reads. The gene model is shown below in blue, while a black arrow indicates the insertion site. H: PCR genotyping confirmed the GABI-Kat T-DNA insertion in RALF17 for three ralf17 plants, while only the wildtype allele is detected for three Col-0 plants. I: Mapping of Illumina reads indicates a second GABI-Kat insertion in the 5’ UTR of AT1G51370. As per G, the upper grey histogram indicates read depth, with grey lines below showing individual reads. The gene model is shown below in blue, while a black arrow indicates the insertion site. J: PCR genotyping confirmed presence of the GABI-Kat T-DNA backbone in AT1G51370 for three ralf17 plants.
","imageTitle":"An Arabidopsis RALF17 GABI-Kat T-DNA line with two insertions has reproductive defects in the hemizygous state, possibly due to a genomic rearrangement
","methods":"Plant growth
The ralf17 and ralf20 T-DNA insertion lines (GK_699G03 and SALK_089411C, respectively; (Alonso et al., 2003, Kleinboelting et al., 2012)) were acquired from the Nottingham Arabidopsis Stock Centre. Plants were grown in a 3:1 mix of Levington M3 compost:sand in a Conviron growth chamber. Set growth conditions were 22ºC, ~150 µmol-1m-2 light from LEDs for 16 hrs per day and 60% humidity. Genotyping used Qiagen multiplex PCR mix (catalogue number 206143) as per the manufacturer’s guidance, with primers as per the sequences below.
Developmental assays
For seed counts, mature siliques (7-8 per plant from 6 plants per genotype) were cleared for 2-4 days in 0.4 M NaOH 1% Triton-X 100 at room temperature before photographs were taken. Seed counts were scored from the photographs.
Pollen imaging
Anthers were mounted onto aluminium stubs with carbon tabs (Agar Scientific) and imaged using a Hitachi TM3030Plus benchtop scanning electron microscope in secondary electron mode at 15kV.
Ovule imaging
For aniline blue/sirofluor staining (Conrath, 2024), anthers were removed from the flowers (stage 16) prior to dehiscence and unpollinated carpels collected 48 hrs later to ensure ovule maturity. Staining and imaging with a Leica DM6 epifluorescence microscope were as described in (Galindo-Trigo et al., 2020). Ovule phenotypes were categorised for 2-3 carpels per plant and 3 plants per genotype.
Statistics
Seed counts were compared using a Kruskal-Wallis test with correction for multiple testing (Dunn’s multiple comparisons test) performed in GraphPad Prism v 10.0.2. T-DNA insertion transmission rates were analysed in Microsoft Excel (v 16.90.02) using a Chi-square test.
T-DNA insertion mapping
To identify T-DNA insertion sites in the ralf17 mutant, genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Maxi Kit (Qiagen). The DNA sample was submitted to Novagene for Illumina sequencing to generate 150-bp paired-end reads. The raw sequencing reads were processed using Fastp (Chen et al., 2018) to remove adapter sequences and trim low-quality bases. The resulting filtered reads were initially mapped to the Arabidopsis thaliana reference genome (TAIR10) using the Burrows-Wheeler Aligner (BWA; (Li and Durbin, 2010)). The resulting SAM files were converted to sorted BAM files using SAMtools (Li et al., 2009). The sorted BAM files were then visualised using Integrative Genomics Viewer (IGV), version 2.19.8 (Robinson et al., 2011), allowing the T-DNA integration site in ralf17 to be identified.
To determine whether additional T-DNA integrations were present in the mutant, the filtered Illumina sequencing reads were used to generate de novo genome assemblies for ralf17 using SPAdes Genome Assembler, version 4.3.0 (Prjibelski et al., 2020). The ralf17 assembly consisted of 4,728 contigs, with a total assembly length of 124,456,250 bp and an N50 of 100,402 bp.
The genome assembly was subsequently searched for sequences derived from the full-length pGABI1 plasmid sequence using BLAST+ (Camacho et al., 2009). BLAST hits corresponding to plasmid-derived sequences were then examined to identify contigs containing T-DNA sequences and to assess the possibility of additional T-DNA integration sites.
","reagents":"Genotype | Gene | ID | Source |
Col-0 | - | - |
|
Col-0 ralf17 | At2g32885 | GK_699G03 | NASC N467083 |
Col-0 ralf20 | At2g34825 | SALK_089411C | NASC N671676 |
Primer name | Primer sequence |
SALK T-DNA (for RALF20 genotyping) | ATTTTGCCGATTTCGGAAC |
GK T-DNA (for RALF17 genotyping) | CATTTTATAATAACGCTGCGGACATCTAC |
RALF17fw | AATGCTACCACATGAACTGGC |
RALF17rv | GTACCAGTCTCAGCTTGCTGC |
RALF20fw | TATCCTCTCACGATGGGACAC |
RALF20rv | TGATCATTTCTTTCACTGGCAG |
At1g51360fw | TGGAAGAAGCGAAATTGGAGA |
At1g51360rv | TGAAAGTCCCACAAACAACCA |
GK T-DNA for At1g51360 insertion | TCAAACCCGGCAGCTTAGTT |
While studying the effects of RALF peptides on reproduction in Arabidopsis, we noted reduced seed set in F1 lines containing a RALF17 (At2g32885; as per (Abarca et al., 2021)) GABI-Kat T-DNA insertion (GK_699G03) in the hemizygous state, but no effect on seed set in homozygous lines. Given reports of genomic rearrangements causing similar phenotypes (Alling and Galindo-Trigo, 2023), we describe here our phenotypic observations and genotyping in order to alert the Arabidopsis research community to issues with this specific plant line.
A ralf17 ralf20 cross was performed due to potential functions of the cognate proteins in pollen grain hydration and an unexpected reduction in seed number per silique was noted in the F1 generation (i.e. plants hemizygous for both T-DNA insertions) (Lau, 2023). Production of a homozygous double mutant was not possible due to the linkage of the two genes (AT2G32885 and AT2G34825). However, normal seed set was observed for each individual T-DNA insertion line in a homozygous state, indicating the observed phenotype was not due to lethality of one or other of the gene knockouts during gamete development.
To assess the extent of the seed development phenotype in the RALF17/ralf17 RALF20/ralf20 F1 plants, siliques were cleared and seeds counted in comparison to the homozygous single T-DNA lines and a Col-0 wildtype control. The F1 plants had significantly fewer seeds than the Col-0, ralf17/ralf17 or ralf20/ralf20 controls (Fig. 1A,B; Kruskal-Wallis test; Col-0 vs F1 p = 0.01, ralf17 vs F1 p = 0.002, ralf20 vs F1 p = 0.01), with a mean of 25.6 seeds per F1 silique compared to 62.7 in Col-0, 64.0 in ralf17 and 63.4 in ralf20. While the F1 plants produce fewer than half as many seeds, it was unclear which aspect of reproduction was affected (e.g. gamete development, pollen tube growth, pollen tube reception or seed development), and whether the RALF17 or RALF20 T-DNA insertion was the genetic determinant.
To determine which of the RALF17 or RALF20 T-DNA insertions was responsible for the observed reduction in seed set, the ralf17 and ralf20 homozygous lines were each backcrossed to Col-0 and seed numbers in the F1 generation counted. With seed counts in the RALF17/ralf17 plants averaging 22.0 compared to a mean of 58.8 in the RALF20/ralf20 plants (Fig. 1A,B), the RALF17 T-DNA insertion was determined to be causal.
Crosses with the wildtype Col-0 line further explored the genetics of the phenotype. As the two T-DNAs are linked, non-Mendelian inheritance in a 1:1 ratio is expected in the seeds of a cross to Col-0. Genotyping of 99 seedlings from the Col-0 (female) x RALF17/ralf17 RALF20/ralf20 (male) cross demonstrated equal transmission of the two T-DNAs via pollen (47 and 52 progeny hemizygous for the ralf17 and ralf20 T-DNAs, respectively; Chi-squared test p = 0.62). In contrast, transmission of the two T-DNA insertions via the female lineage in a RALF17/ralf17 RALF20/ralf20 x Col-0 cross indicated reduced inheritance of the ralf17 T-DNA (35 and 56 progeny inheriting the ralf17 and ralf20 T-DNAs, respectively; Chi-squared test p = 0.03). Thus, viable pollen grain formation is not significantly affected in the F1 RALF17/ralf17 RALF20/ralf20 plants, while ralf17 haploid ovules may have reduced viability.
To further understand the ralf17 hemizygous phenotype, we examined gamete development, including pollen grains despite the lack of transmission effect. Pollen structure was examined through imaging with a scanning electron microscope. The wildtype Col-0 line and both single mutants had elongated pollen grains with three evenly spaced apertures and a regular exine pattern. A high proportion of the pollen grains of the RALF17/ralf17 RALF20/ralf20 plants were much smaller and more rounded with wider, less regular apertures and an irregular, less defined exine pattern (Fig. 1C). The F1 RALF17/ralf17 had pollen grains similar to the double mutant, with many pollen grains having the smaller, irregular shape. RALF20/ralf20 pollen grains, however, were comparable to Col-0 or the single homozygous mutants. Therefore, although transmission of the T-DNA insertions via pollen appears unaffected by whether the haploid genome contains the ralf17 or ralf20 T-DNA insertion, pollen grain development is nonetheless affected by hemizygousity of the ralf17 T-DNA insertion in the parental plant.
Female gamete development was examined through callose staining of unfertilised carpels (48 hrs after emasculation to ensure mature ovules). Unfertilised, mature ovules in the RALF17/ralf17 RALF20/ralf20 plants could be separated into two categories - those with limited/no callose deposition in the embryo sac that are comparable to ovules of wildtype Col-0 and those with increased deposition of callose in the embryo sac (Fig. 1D,E). These two categories of embryo sacs were observed at 45% (normal) and 55% (increased callose) frequency in RALF17/ralf17 RALF20/ralf20 plants (Fig. 1F). Examining earlier stages of ovule development in Col-0, we did not observe callose deposition in the embryo sacs, indicating that this is ectopic callose deposition rather than a delay or cessation of ovule development. Combined with the T-DNA insertion transmission rates and seed set numbers presented above, the embryo sac phenotype does not appear to strictly correlate with a lack of viability of the ovules, as otherwise we would expect a much stronger effect on T-DNA insertion transmission via the female lineage and an inability to obtain homozygous ralf17 plants. Aberrant embryo sac development could alternatively be a function of genomic rearrangements which lead to developmental defects rather than arising from hemizygousity of the ralf17 T-DNA insertion per se.
Whole genome Illumina sequencing was undertaken to identify if a second T-DNA insertion is present in the ralf17 GABI-Kat line. As well as confirming the T-DNA insertion in RALF17 (Fig. 1G,H), a second insertion on chromosome 1 at AT1G51370 (encoding an uncharacterised F-box protein) was identified based on a gap in reads mapped to the Arabidopsis thaliana genome (Fig. 1I) and mapping of read contigs to the pGABI1 plasmid. This insertion, confirmed by PCR (Fig. 1J), consists of the plasmid backbone between the right and left T-DNA borders of the pGABI1 plasmid, explaining why it was not identified during standard T-DNA line characterisation. Our mapping approach cannot address whether there is a genomic rearrangement incorporating these two T-DNA insertions as individual reads do not span the insertions.
The ovules and pollen grain phenotypes we have observed in plants hemizygous for the ralf17 T-DNA insertion are consistent with phenotypes previously reported for other T-DNA insertion lines with genomic rearrangements. Reports of chromosomal translocations in non-T-DNA-containing plant lines of Datura and maize, that result in meiotic and gametophytic defects, date back a century (Belling and Blakeslee, 1926). With the advent of T-DNA lines for genetics research, genomic rearrangements became a more frequent pitfall. A number of studies have reported gametophytic defects and chromosomal translocations in individual Arabidopsis T-DNA lines (e.g. (Curtis et al., 2009, Alling and Galindo-Trigo, 2023)). One study of 64 SALK T-DNA lines found a 19% rate of chromosomal translocations (Clark and Krysan, 2010) indicating the prevalence of this issue. A smaller study which sequenced the genomes of 14 GABI-Kat T-DNA insertion lines identified chromosomal translocations in four lines, along with numerous T-DNA insertion sites that had not been annotated, concluding that GABI-Kat lines may contain an average of two T-DNA insertions (Pucker et al., 2021). The presence of multiple T-DNA insertions is not however required for chromosomal translocations to occur in insertion lines (reviewed in (Thomson et al., 2024)). As recently highlighted by (Raabe et al., 2024), the gametophytic effects of potential chromosomal rearrangements are of particular concern when studying plant reproduction, with screening of gametophyte phenotypes in F1 crosses of particular relevance. Here we would add our voice to those of others, urging caution when gametophytic phenotypes are observed in hemizygous T-DNA insertion lines but not cognate homozygous lines, with particular warning regarding the RALF17 GABI-Kat T-DNA insertion line GK_699G03.
","references":[{"reference":"Abarca A, Franck CM, Zipfel C. 2021. Family-wide evaluation of RAPID ALKALINIZATION FACTOR peptides. Plant Physiology: kiab308. 1.","pubmedId":"","doi":"10.1093/plphys/kiab308"},{"reference":"Alling R, Galindo Trigo S. 2023. Reproductive defects in the abscission mutant ida-2 are caused by T-DNA–induced genomic rearrangements. Plant Physiology. 193: 2292–2297. 2.","pubmedId":"","doi":"10.1093/plphys/kiad449"},{"reference":"Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, et al., Ecker JR. 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 301: 653–7. 11.","pubmedId":"12893945","doi":"10.1126/science.1086391"},{"reference":"Belling J, Blakeslee AF. 1926. On the attachment of non-homologous chromosomes at the reduction division in certain 25-chromosome Daturas. Proceedings of the National Academy of Sciences. 12: 7–11. 4.","pubmedId":"","doi":"10.1073/pnas.12.1.7"},{"reference":"Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL. 2009. BLAST+: architecture and applications. BMC Bioinformatics. 10: 421. 19.","pubmedId":"20003500","doi":"10.1186/1471-2105-10-421"},{"reference":"Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 34: i884–i890. 14.","pubmedId":"30423086","doi":"10.1093/bioinformatics/bty560"},{"reference":"Clark KA, Krysan PJ. 2010. Chromosomal translocations are a common phenomenon in Arabidopsis thaliana T-DNA insertion lines. The Plant Journal. 64: 990–1001. 6.","pubmedId":"","doi":"10.1111/j.1365-313X.2010.04386.x"},{"reference":"Conrath U. 2024. Unlocking Precision in Callose Staining: Unveiling the Role of Sirofluor. Molecular Plant-Microbe Interactions®. 37: 595. 12.","pubmedId":"38739552","doi":"10.1094/mpmi-04-24-0038-le"},{"reference":"Curtis MJ, Belcram K, Bollmann SR, Tominey CM, Hoffman PD, Mercier R, Hays JB. 2009. Reciprocal chromosome translocation associated with TDNA-insertion mutation in Arabidopsis: genetic and cytological analyses of consequences for gametophyte development and for construction of doubly mutant lines. Planta. 229: 731–745. 5.","pubmedId":"","doi":"10.1007/s00425-008-0868-0"},{"reference":"Galindo Trigo S, Blanco Tourinan N, De Falco TA, Wells ES, Gray JE, Zipfel C, Smith LM. 2020. CrRLK1L receptor-like kinases HERK1 and ANJEA are female determinants of pollen tube reception. EMBO Reports. 21: e48466. 13.","pubmedId":"31867824","doi":"10.15252/embr.201948466"},{"reference":"Kleinboelting N, Huep G, Kloetgen A, Viehoever P, Weisshaar B. 2012. GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database. Nucleic Acids Res 40(Database issue): D1211-5.
","pubmedId":"22080561","doi":"10.1093/nar/gkr1047"},{"reference":"Lau YL. 2023. Functional analysis of Arabidopsis pollen coat proteins in the pollen-stigma interaction. 3.","pubmedId":"","doi":""},{"reference":"Li H, Durbin R. 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics. 26: 589–95. 15.","pubmedId":"20080505","doi":"10.1093/bioinformatics/btp698"},{"reference":"Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al., Genome Project Data Processing S. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25: 2078–9. 16.","pubmedId":"19505943","doi":"10.1093/bioinformatics/btp352"},{"reference":"Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. 2020. Using SPAdes De Novo Assembler. Curr Protoc Bioinformatics. 70: e102. 18.","pubmedId":"32559359","doi":"10.1002/cpbi.102"},{"reference":"Pucker B, Kleinbolting N, Weisshaar B. 2021. Large scale genomic rearrangements in selected Arabidopsis thaliana T-DNA lines are caused by T-DNA insertion mutagenesis. BMC genomics. 22: 1–21. 7.","pubmedId":"","doi":"10.1186/s12864-021-07877-8"},{"reference":"Raabe K, Sun L, Schindfessel C, Honys D, Geelen D. 2024. A word of caution: T-DNA-associated mutagenesis in plant reproduction research. Journal of Experimental Botany. 75: 3248–3258. 9.","pubmedId":"","doi":"10.1093/jxb/erae114"},{"reference":"Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrative genomics viewer. Nat Biotechnol. 29: 24–6. 17.","pubmedId":"21221095","doi":"10.1038/nbt.1754"},{"reference":"Thomson G, Dickinson L, Jacob Y. 2024. Genomic consequences associated with Agrobacterium-mediated transformation of plants. The Plant Journal. 117: 342–363. 8.","pubmedId":"","doi":"https://doi.org/10.1111/tpj.16496"}],"title":"An Arabidopsis RALF17 GABI-Kat T-DNA line with two insertions has reproductive defects in the hemizygous state, possibly due to a genomic rearrangement
","reviews":[{"reviewer":{"displayName":"David E Somers"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[]},{"id":"b019996b-7d13-47c7-9799-c93ab9efa971","decision":"accept","abstract":"T-DNA insertion lines are reported to have a high probability of chromosomal rearrangements such as translocations, which can result in gametophytic developmental defects. Here we report pollen and ovule phenotypes in a RALF17 (AT2G32885) GABI-Kat line that are present only when the T-DNA is in a hemizygous state, including misshapen mature pollen and an accumulation of callose in the embryo sac. These observations are consistent with phenotypes resulting from chromosomal translocations, often associated with multiple T-DNAs, and we confirmed presence of a second T-DNA insertion. We urge the research community to use alternative knockout lines for reproductive studies of RALF17.
","acknowledgements":"We thank Andrew Fleming and Alice Baillie (University of Sheffield) for discussions at various stages of the project.
","authors":[{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["conceptualization","investigation","visualization","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"j.sloan@sheffield.ac.uk","firstName":"Jen","lastName":"Sloan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-0334-3722"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["conceptualization","investigation","writing_reviewEditing"],"email":"rl.liu2@siat.ac.cn","firstName":"Yui-Leung ","lastName":"Lau","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":" 0000-0002-1459-2639"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["investigation","writing_reviewEditing"],"email":"Amber.Gentle@jic.ac.uk","firstName":"Amber ","lastName":"Gentle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0006-1944-4754"},{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["investigation"],"email":"e.allwood@sheffield.ac.uk","firstName":"Ellen","lastName":"Allwood","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3825-4789"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["investigation"],"email":"V.Cevik@bath.ac.uk","firstName":"Volkan ","lastName":"Cevik","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3545-3179"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["conceptualization","supervision","writing_reviewEditing"],"email":"bssjd@bath.ac.uk","firstName":"James","lastName":"Doughty","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-1459-2639"},{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["dataCuration","supervision","fundingAcquisition","investigation","formalAnalysis","visualization","writing_originalDraft","writing_reviewEditing"],"email":"Lisa.m.smith@sheffield.ac.uk","firstName":"Lisa M","lastName":"Smith","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-2364-8187"}],"awards":[{"awardId":"2019-056","funderName":"Leverhulme Trust (United Kingdom)","awardRecipient":"Lisa Smith"},{"awardId":"BB/W013754/1","funderName":"Biotechnology and Biological Sciences Research Council (United Kingdom)","awardRecipient":"Lisa Smith"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/89440356562f10cfaf4ca7eed751ded0.jpg"},"imageCaption":"A: Cleared siliques of genotypes used in this study showing a reduced number of seeds in lines where the ralf17-1 GABI-Kat T-DNA insertion of stock line GK_699G03.03 is hemizygous but not homozygous. Scale bar 1 mm. B: Seeds counts for each genotype (6 plants per genotype, 7-8 siliques per plant) show lower numbers of seeds are produced when ralf17-1 is hemizygous in either a cross to wildtype Col-0 or the ralf20-1 T-DNA insertion. Letters refer to statistically similar groups based Kruskal-Wallis test with a post hoc Dunn’s multiple comparisons test. C: SEM images of pollen grains on mature anthers for each genotype showing pollen defects in the F1 progeny of ralf17-1/ralf17-1 x Col-0 and ralf17-1/ralf17-1 x ralf20-1/ralf20-1 crosses. Scale bar 100 μm. D: Composite image of aniline blue (sirofluor)-stained carpels of each genotype. Callose deposits can be observed in approximately half of the ovules in carpels from F1 progeny of ralf17-1/ralf17-1 x Col-0 and ralf17-1/ralf17-1 x ralf20-1/ralf20-1 crosses. Anthers were removed prior to dehiscence and carpels stained 48 hours after anther removal to ensure ovule maturity. E: Epifluorescence image of callose staining of two ovules from a RALF17/ralf17-1 RALF20/ralf20-1 plant showing abnormal callose deposition in the embryo sac of the upper ovule compared to a normal ovule below. F: Quantification of the number of ovules with abnormal vs normal callose levels in the embryo sac for each genotype used in this study. Ovules from 2-3 siliques per plant for 3 plants per line were categorised according to callose level. Means from each plant were used to calculate standard error of the mean. Significantly more ovules had abnormal levels of callose in the RALF17/ralf17-1 RALF20/ralf20-1 and RALF17/ralf17-1 plant compared to Col-0, with letters referring to statistically similar groups based on pair-wise Chi-squared tests with correction for multiple testing. G: Mapping of Illumina reads against the ralf17-1 gene model confirms insertion in the 5’ UTR. The upper grey histogram indicates read depth, with grey lines below showing individual reads. The gene model is shown below in blue, while a black arrow indicates the insertion site. H: PCR genotyping confirmed the GABI-Kat T-DNA insertion in RALF17 for three ralf17-1 plants, while only the wildtype allele is detected for three Col-0 plants. I: Mapping of Illumina reads indicates a second GABI-Kat insertion in the 5’ UTR of AT1G51370. As per G, the upper grey histogram indicates read depth, with grey lines below showing individual reads. The gene model is shown below in blue, while a black arrow indicates the insertion site. J: PCR genotyping confirmed presence of the GABI-Kat T-DNA backbone in AT1G51370 for three ralf17-1 plants.
","imageTitle":"The RALF17 GABI-Kat T-DNA insertion line has gametophytic defects when in a hemizygous state
","methods":"Methods
Plant growth
The ralf17-1 and ralf20-1 T-DNA insertion lines (GK_699G03.03 and SALK_089411C, respectively; (Alonso et al., 2003, Kleinboelting et al., 2012)) were acquired from the Nottingham Arabidopsis Stock Centre. Plants were grown in a 3:1 mix of Levington M3 compost:sand in a Conviron growth chamber. Set growth conditions were 22ºC, ~150 µmol-1m-2 light from LEDs for 16 hrs per day and 60% humidity. Genotyping used Qiagen multiplex PCR mix (catalogue number 206143) as per the manufacturer’s guidance, with primers as per the sequences below.
Developmental assays
For seed counts, mature siliques (7-8 per plant from 6 plants per genotype) were cleared for 2-4 days in 0.4 M NaOH 1% Triton-X 100 at room temperature before photographs were taken. Seed counts were scored from the photographs.
Pollen imaging
Anthers were mounted onto aluminium stubs with carbon tabs (Agar Scientific) and imaged using a Hitachi TM3030Plus benchtop scanning electron microscope in secondary electron mode at 15kV.
Ovule imaging
For aniline blue/sirofluor staining (Conrath, 2024), anthers were removed from the flowers (stage 16) prior to dehiscence and unpollinated carpels collected 48 hrs later to ensure ovule maturity. Staining and imaging with a Leica DM6 epifluorescence microscope were as described in (Galindo-Trigo et al., 2020). Ovule phenotypes were categorised for 2-3 carpels per plant and 3 plants per genotype.
Statistics
Seed counts were compared using a Kruskal-Wallis test with correction for multiple testing (Dunn’s multiple comparisons test) performed in GraphPad Prism v 10.0.2. T-DNA insertion transmission rates were analysed in Microsoft Excel (v 16.90.02) using a Chi-square test.
T-DNA insertion mapping
To identify T-DNA insertion sites in the ralf17-1 mutant, genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Maxi Kit (Qiagen). The DNA sample was submitted to Novagene for Illumina sequencing to generate 150-bp paired-end reads. The raw sequencing reads were processed using Fastp (Chen et al., 2018) to remove adapter sequences and trim low-quality bases. The resulting filtered reads were initially mapped to the Arabidopsis thaliana reference genome (TAIR10) using the Burrows-Wheeler Aligner (BWA; (Li and Durbin, 2010)). The resulting SAM files were converted to sorted BAM files using SAMtools (Li et al., 2009). The sorted BAM files were then visualised using Integrative Genomics Viewer (IGV), version 2.19.8 (Robinson et al., 2011), allowing the T-DNA integration site in ralf17-1 to be identified.
To determine whether additional T-DNA integrations were present in the mutant, the filtered Illumina sequencing reads were used to generate de novo genome assemblies for ralf17-1 using SPAdes Genome Assembler, version 4.3.0 (Prjibelski et al., 2020). The ralf17-1 assembly consisted of 4,728 contigs, with a total assembly length of 124,456,250 bp and an N50 of 100,402 bp.
The genome assembly was subsequently searched for sequences derived from the full-length pGABI1 plasmid sequence using BLAST+ (Camacho et al., 2009). BLAST hits corresponding to plasmid-derived sequences were then examined to identify contigs containing T-DNA sequences and to assess the possibility of additional T-DNA integration sites.
","reagents":"Genotype | Gene | ID | Source |
Col-0 | - | - |
|
Col-0 ralf17-1 | At2g32885 | GK_699G03.03 | NASC N467083 |
Col-0 ralf20-1 | At2g34825 | SALK_089411C | NASC N671676 |
Primer name | Primer sequence |
SALK T-DNA (for RALF20 genotyping) | ATTTTGCCGATTTCGGAAC |
GK T-DNA (for RALF17 genotyping) | CATTTTATAATAACGCTGCGGACATCTAC |
RALF17fw | AATGCTACCACATGAACTGGC |
RALF17rv | GTACCAGTCTCAGCTTGCTGC |
RALF20fw | TATCCTCTCACGATGGGACAC |
RALF20rv | TGATCATTTCTTTCACTGGCAG |
At1g51360fw | TGGAAGAAGCGAAATTGGAGA |
At1g51360rv | TGAAAGTCCCACAAACAACCA |
GK T-DNA for At1g51360 insertion | TCAAACCCGGCAGCTTAGTT |
While studying the effects of RALF peptides on reproduction in Arabidopsis, we noted reduced seed set in F1 lines containing a RALF17 (At2G32885; as per (Abarca et al., 2021)) GABI-Kat T-DNA insertion (GK_699G03.03, N467083) in the hemizygous state, but no effect on seed set in homozygous lines. Given reports of genomic rearrangements causing similar phenotypes (Alling and Galindo-Trigo, 2023), we describe here our phenotypic observations and genotyping in order to alert the Arabidopsis research community to issues with this specific plant line.
A ralf17-1 ralf20-1 cross was performed due to potential functions of the cognate proteins in pollen grain hydration and an unexpected reduction in seed number per silique was noted in the F1 generation (i.e. plants hemizygous for both T-DNA insertions) (Lau, 2023). Production of a homozygous double mutant was not possible due to the linkage of the two genes (AT2G32885 and AT2G34825). However, normal seed set was observed for each individual T-DNA insertion line in a homozygous state, indicating the observed phenotype was not due to lethality of one or other of the gene knockouts during gamete development.
To assess the extent of the seed development phenotype in the RALF17/ralf17-1 RALF20/ralf20-1 F1 plants, siliques were cleared and seeds counted in comparison to the homozygous single T-DNA lines and a Col-0 wildtype control. The F1 plants had significantly fewer seeds than the Col-0, ralf17-1/ralf17-1 or ralf20-1/ralf20-1 controls (Fig. 1A,B; Kruskal-Wallis test; Col-0 vs F1 p = 0.01, ralf17-1 vs F1 p = 0.002, ralf20-1 vs F1 p = 0.01), with a mean of 25.6 seeds per F1 silique compared to 62.7 in Col-0, 64.0 in ralf17-1 and 63.4 in ralf20-1. While the F1 plants produce fewer than half as many seeds, it was unclear which aspect of reproduction was affected (e.g. gamete development, pollen tube growth, pollen tube reception or seed development), and whether the RALF17 or RALF20 T-DNA insertion was the genetic determinant.
To determine which of the RALF17 or RALF20 T-DNA insertions was responsible for the observed reduction in seed set, the ralf17-1 and ralf20-1 homozygous lines were each backcrossed to Col-0 and seed numbers in the F1 generation counted. With seed counts in the RALF17/ralf17-1 plants averaging 22.0 compared to a mean of 58.8 in the RALF20/ralf20-1 plants (Fig. 1A,B), the RALF17 T-DNA insertion was determined to be causal.
Crosses with the wildtype Col-0 line further explored the genetics of the phenotype. As the two T-DNAs are linked, non-Mendelian inheritance in a 1:1 ratio is expected in the seeds of a cross to Col-0. Genotyping of 99 seedlings from the Col-0 (female) x RALF17/ralf17-1 RALF20/ralf20-1 (male) cross demonstrated equal transmission of the two T-DNAs via pollen (47 and 52 progeny hemizygous for the ralf17-1 and ralf20-1 T-DNAs, respectively; Chi-squared test p = 0.62). In contrast, transmission of the two T-DNA insertions via the female lineage in a RALF17/ralf17-1 RALF20/ralf20-1 x Col-0 cross indicated reduced inheritance of the ralf17-1 T-DNA (35 and 56 progeny inheriting the ralf17-1 and ralf20-1 T-DNAs, respectively; Chi-squared test p = 0.03). Thus, viable pollen grain formation is not significantly affected in the F1 RALF17/ralf17-1 RALF20/ralf20-1 plants, while ralf17-1 haploid ovules may have reduced viability.
To further understand the ralf17-1 hemizygous phenotype, we examined gamete development, including pollen grains despite the lack of transmission effect. Pollen structure was examined through imaging with a scanning electron microscope. The wildtype Col-0 line and both single mutants had elongated pollen grains with three evenly spaced apertures and a regular exine pattern. A high proportion of the pollen grains of the RALF17/ralf17-1 RALF20/ralf20-1 plants were much smaller and more rounded with wider, less regular apertures and an irregular, less defined exine pattern (Fig. 1C). The F1 RALF17/ralf17-1 had pollen grains similar to the double mutant, with many pollen grains having the smaller, irregular shape. RALF20/ralf20-1 pollen grains, however, were comparable to Col-0 or the single homozygous mutants. Therefore, although transmission of the T-DNA insertions via pollen appears unaffected by whether the haploid genome contains the ralf17-1 or ralf20-1 T-DNA insertion, pollen grain development is nonetheless affected by hemizygousity of the ralf17-1 T-DNA insertion in the parental plant.
Female gamete development was examined through callose staining of unfertilised carpels (48 hrs after emasculation to ensure mature ovules). Unfertilised, mature ovules in the RALF17/ralf17-1 RALF20/ralf20-1 plants could be separated into two categories - those with limited/no callose deposition in the embryo sac that are comparable to ovules of wildtype Col-0 and those with increased deposition of callose in the embryo sac (Fig. 1D,E). These two categories of embryo sacs were observed at 45% (normal) and 55% (increased callose) frequency in RALF17/ralf17-1 RALF20/ralf20-1 plants (Fig. 1F). Examining earlier stages of ovule development in Col-0, we did not observe callose deposition in the embryo sacs, indicating that this is ectopic callose deposition rather than a delay or cessation of ovule development. Combined with the T-DNA insertion transmission rates and seed set numbers presented above, the embryo sac phenotype does not appear to strictly correlate with a lack of viability of the ovules, as otherwise we would expect a much stronger effect on T-DNA insertion transmission via the female lineage and an inability to obtain homozygous ralf17-1 plants. Aberrant embryo sac development could alternatively be a function of genomic rearrangements which lead to developmental defects rather than arising from hemizygousity of the ralf17-1 T-DNA insertion per se.
Whole genome Illumina sequencing was undertaken to identify if a second T-DNA insertion is present in the ralf17-1 GABI-Kat line. As well as confirming the T-DNA insertion in RALF17 (Fig. 1G,H), a second insertion on chromosome 1 at AT1G51370 (encoding an uncharacterised F-box protein) was identified based on a gap in reads mapped to the Arabidopsis thaliana genome (Fig. 1I) and mapping of read contigs to the pGABI1 plasmid. This insertion, confirmed by PCR (Fig. 1J), consists of the plasmid backbone between the right and left T-DNA borders of the pGABI1 plasmid, explaining why it was not identified during standard T-DNA line characterisation. Our mapping approach cannot address whether there is a genomic rearrangement incorporating these two T-DNA insertions as individual reads do not span the insertions.
The ovules and pollen grain phenotypes we have observed in plants hemizygous for the ralf17-1 T-DNA insertion are consistent with phenotypes previously reported for other T-DNA insertion lines with genomic rearrangements. Reports of chromosomal translocations in non-T-DNA-containing plant lines of Datura and maize, that result in meiotic and gametophytic defects, date back a century (Belling and Blakeslee, 1926). With the advent of T-DNA lines for genetics research, genomic rearrangements became a more frequent pitfall. A number of studies have reported gametophytic defects and chromosomal translocations in individual Arabidopsis T-DNA lines (e.g. (Curtis et al., 2009, Alling and Galindo-Trigo, 2023)). One study of 64 SALK T-DNA lines found a 19% rate of chromosomal translocations (Clark and Krysan, 2010) indicating the prevalence of this issue. A smaller study which sequenced the genomes of 14 GABI-Kat T-DNA insertion lines identified chromosomal translocations in four lines, along with numerous T-DNA insertion sites that had not been annotated, concluding that GABI-Kat lines may contain an average of two T-DNA insertions (Pucker et al., 2021). The presence of multiple T-DNA insertions is not however required for chromosomal translocations to occur in insertion lines (reviewed in (Thomson et al., 2024)). As recently highlighted by (Raabe et al., 2024), the gametophytic effects of potential chromosomal rearrangements are of particular concern when studying plant reproduction, with screening of gametophyte phenotypes in F1 crosses of particular relevance. Here we would add our voice to those of others, urging caution when gametophytic phenotypes are observed in hemizygous T-DNA insertion lines but not cognate homozygous lines, with particular warning regarding the RALF17 GABI-Kat T-DNA insertion line GK_699G03.03, NASC N467083.
","references":[{"reference":"Abarca A, Franck CM, Zipfel C. 2021. Family-wide evaluation of RAPID ALKALINIZATION FACTOR peptides. Plant Physiology: kiab308. 1.","pubmedId":"","doi":"10.1093/plphys/kiab308"},{"reference":"Alling R, Galindo Trigo S. 2023. Reproductive defects in the abscission mutant ida-2 are caused by T-DNA–induced genomic rearrangements. Plant Physiology. 193: 2292–2297. 2.","pubmedId":"","doi":"10.1093/plphys/kiad449"},{"reference":"Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, et al., Ecker JR. 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 301: 653–7. 11.","pubmedId":"12893945","doi":"10.1126/science.1086391"},{"reference":"Belling J, Blakeslee AF. 1926. On the attachment of non-homologous chromosomes at the reduction division in certain 25-chromosome Daturas. Proceedings of the National Academy of Sciences. 12: 7–11. 4.","pubmedId":"","doi":"10.1073/pnas.12.1.7"},{"reference":"Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL. 2009. BLAST+: architecture and applications. BMC Bioinformatics. 10: 421. 19.","pubmedId":"20003500","doi":"10.1186/1471-2105-10-421"},{"reference":"Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 34: i884–i890. 14.","pubmedId":"30423086","doi":"10.1093/bioinformatics/bty560"},{"reference":"Clark KA, Krysan PJ. 2010. Chromosomal translocations are a common phenomenon in Arabidopsis thaliana T-DNA insertion lines. The Plant Journal. 64: 990–1001. 6.","pubmedId":"","doi":"10.1111/j.1365-313X.2010.04386.x"},{"reference":"Conrath U. 2024. Unlocking Precision in Callose Staining: Unveiling the Role of Sirofluor. Molecular Plant-Microbe Interactions®. 37: 595. 12.","pubmedId":"38739552","doi":"10.1094/mpmi-04-24-0038-le"},{"reference":"Curtis MJ, Belcram K, Bollmann SR, Tominey CM, Hoffman PD, Mercier R, Hays JB. 2009. Reciprocal chromosome translocation associated with TDNA-insertion mutation in Arabidopsis: genetic and cytological analyses of consequences for gametophyte development and for construction of doubly mutant lines. Planta. 229: 731–745. 5.","pubmedId":"","doi":"10.1007/s00425-008-0868-0"},{"reference":"Galindo Trigo S, Blanco Tourinan N, De Falco TA, Wells ES, Gray JE, Zipfel C, Smith LM. 2020. CrRLK1L receptor-like kinases HERK1 and ANJEA are female determinants of pollen tube reception. EMBO Reports. 21: e48466. 13.","pubmedId":"31867824","doi":"10.15252/embr.201948466"},{"reference":"Kleinboelting N, Huep G, Kloetgen A, Viehoever P, Weisshaar B. 2012. GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database. Nucleic Acids Res 40(Database issue): D1211-5.
","pubmedId":"22080561","doi":"10.1093/nar/gkr1047"},{"reference":"Lau YL. 2023. Functional analysis of Arabidopsis pollen coat proteins in the pollen-stigma interaction. 3.","pubmedId":"","doi":""},{"reference":"Li H, Durbin R. 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics. 26: 589–95. 15.","pubmedId":"20080505","doi":"10.1093/bioinformatics/btp698"},{"reference":"Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al., Genome Project Data Processing S. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25: 2078–9. 16.","pubmedId":"19505943","doi":"10.1093/bioinformatics/btp352"},{"reference":"Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. 2020. Using SPAdes De Novo Assembler. Curr Protoc Bioinformatics. 70: e102. 18.","pubmedId":"32559359","doi":"10.1002/cpbi.102"},{"reference":"Pucker B, Kleinbolting N, Weisshaar B. 2021. Large scale genomic rearrangements in selected Arabidopsis thaliana T-DNA lines are caused by T-DNA insertion mutagenesis. BMC genomics. 22: 1–21. 7.","pubmedId":"","doi":"10.1186/s12864-021-07877-8"},{"reference":"Raabe K, Sun L, Schindfessel C, Honys D, Geelen D. 2024. A word of caution: T-DNA-associated mutagenesis in plant reproduction research. Journal of Experimental Botany. 75: 3248–3258. 9.","pubmedId":"","doi":"10.1093/jxb/erae114"},{"reference":"Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrative genomics viewer. Nat Biotechnol. 29: 24–6. 17.","pubmedId":"21221095","doi":"10.1038/nbt.1754"},{"reference":"Thomson G, Dickinson L, Jacob Y. 2024. Genomic consequences associated with Agrobacterium-mediated transformation of plants. The Plant Journal. 117: 342–363. 8.","pubmedId":"","doi":"https://doi.org/10.1111/tpj.16496"}],"title":"An Arabidopsis RALF17 (AT2G32885) GABI-Kat T-DNA line with two insertions has reproductive defects in the hemizygous state, possibly due to a genomic rearrangement
","reviews":[],"curatorReviews":[]},{"id":"69c2d418-9094-4855-ac42-24c49defad8c","decision":"accept","abstract":"T-DNA insertion lines are reported to have a high probability of chromosomal rearrangements such as translocations, which can result in gametophytic developmental defects. Here we report pollen and ovule phenotypes in a RALF17 (AT2G32885) GABI-Kat line that are present only when the T-DNA is in a hemizygous state, including misshapen mature pollen and an accumulation of callose in the embryo sac. These observations are consistent with phenotypes resulting from chromosomal translocations, often associated with multiple T-DNAs, and we confirmed presence of a second T-DNA insertion. We urge the research community to use alternative knockout lines for reproductive studies of RALF17.
","acknowledgements":"We thank Andrew Fleming and Alice Baillie (University of Sheffield) for discussions at various stages of the project.
","authors":[{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["conceptualization","investigation","visualization","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"j.sloan@sheffield.ac.uk","firstName":"Jen","lastName":"Sloan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-0334-3722"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["conceptualization","investigation","writing_reviewEditing"],"email":"rl.liu2@siat.ac.cn","firstName":"Yui-Leung ","lastName":"Lau","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":" 0000-0002-1459-2639"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["investigation","writing_reviewEditing"],"email":"Amber.Gentle@jic.ac.uk","firstName":"Amber ","lastName":"Gentle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0006-1944-4754"},{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["investigation"],"email":"e.allwood@sheffield.ac.uk","firstName":"Ellen","lastName":"Allwood","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3825-4789"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["investigation"],"email":"V.Cevik@bath.ac.uk","firstName":"Volkan ","lastName":"Cevik","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3545-3179"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["conceptualization","supervision","writing_reviewEditing"],"email":"bssjd@bath.ac.uk","firstName":"James","lastName":"Doughty","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-1459-2639"},{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["dataCuration","supervision","fundingAcquisition","investigation","formalAnalysis","visualization","writing_originalDraft","writing_reviewEditing"],"email":"Lisa.m.smith@sheffield.ac.uk","firstName":"Lisa M","lastName":"Smith","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-2364-8187"}],"awards":[{"awardId":"BB/W013754/1","funderName":"Biotechnology and Biological Sciences Research Council (United Kingdom)","awardRecipient":"Lisa Smith"},{"awardId":"2019-056","funderName":"Leverhulme Trust (United Kingdom)","awardRecipient":"Lisa Smith"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/67ce49492a2e50bfdfa51e26354bb91c.jpg"},"imageCaption":"A: Cleared siliques of genotypes used in this study showing a reduced number of seeds in lines where the ralf17-1 GABI-Kat T-DNA insertion of stock line GK_699G03.03 is hemizygous but not homozygous. Scale bar 1 mm. B: Seeds counts for each genotype (6 plants per genotype, 7-8 siliques per plant) show lower numbers of seeds are produced when ralf17-1 is hemizygous in either a cross to wildtype Col-0 or the ralf20-1 T-DNA insertion. Letters refer to statistically similar groups based Kruskal-Wallis test with a post hoc Dunn’s multiple comparisons test. C: SEM images of pollen grains on mature anthers for each genotype showing pollen defects in the F1 progeny of ralf17-1/ralf17-1 x Col-0 and ralf17-1/ralf17-1 x ralf20-1/ralf20-1 crosses. Scale bar 100 μm. D: Composite image of aniline blue (sirofluor)-stained carpels of each genotype. Callose deposits can be observed in approximately half of the ovules in carpels from F1 progeny of ralf17-1/ralf17-1 x Col-0 and ralf17-1/ralf17-1 x ralf20-1/ralf20-1 crosses. Anthers were removed prior to dehiscence and carpels stained 48 hours after anther removal to ensure ovule maturity. E: Epifluorescence image of callose staining of two ovules from a RALF17/ralf17-1 RALF20/ralf20-1 plant showing abnormal callose deposition in the embryo sac of the upper ovule compared to a normal ovule below. F: Quantification of the number of ovules with abnormal vs normal callose levels in the embryo sac for each genotype used in this study. Ovules from 2-3 siliques per plant for 3 plants per line were categorised according to callose level. Means from each plant were used to calculate standard error of the mean. Significantly more ovules had abnormal levels of callose in the RALF17/ralf17-1 RALF20/ralf20-1 and RALF17/ralf17-1 plant compared to Col-0, with letters referring to statistically similar groups based on pair-wise Chi-squared tests with correction for multiple testing. G: Mapping of Illumina reads against the ralf17-1 gene model confirms insertion in the 5’ UTR. The upper grey histogram indicates read depth, with grey lines below showing individual reads. The gene model is shown below in blue, while a black arrow indicates the insertion site. H: PCR genotyping confirmed the GABI-Kat T-DNA insertion in RALF17 for three ralf17-1 plants, while only the wildtype allele is detected for three Col-0 plants. I: Mapping of Illumina reads indicates a second GABI-Kat insertion in the 5’ UTR of AT1G51370. As per G, the upper grey histogram indicates read depth, with grey lines below showing individual reads. The gene model is shown below in blue, while a black arrow indicates the insertion site. J: PCR genotyping confirmed presence of the GABI-Kat T-DNA backbone in AT1G51370 for three ralf17-1 plants.
","imageTitle":"The RALF17 GABI-Kat T-DNA insertion line has gametophytic defects when in a hemizygous state
","methods":"Plant growth
The ralf17-1 and ralf20-1 T-DNA insertion lines (GK_699G03.03 and SALK_089411C, respectively; (Alonso et al., 2003, Kleinboelting et al., 2012)) were acquired from the Nottingham Arabidopsis Stock Centre. Plants were grown in a 3:1 mix of Levington M3 compost:sand in a Conviron growth chamber. Set growth conditions were 22ºC, ~150 µmol-1m-2 light from LEDs for 16 hrs per day and 60% humidity. Genotyping used Qiagen multiplex PCR mix (catalogue number 206143) as per the manufacturer’s guidance, with primers as per the sequences below.
Developmental imaging
For seed counts, mature siliques (7-8 per plant from 6 plants per genotype) were cleared for 2-4 days in 0.4 M NaOH 1% Triton-X 100 at room temperature before photographs were taken. Seed counts were scored from the photographs.
For pollen imaging, anthers were mounted onto aluminium stubs with carbon tabs (Agar Scientific) and imaged using a Hitachi TM3030Plus benchtop scanning electron microscope in secondary electron mode at 15kV.
For aniline blue/sirofluor staining of ovules (Conrath, 2024), anthers were removed from the flowers (stage 16) prior to dehiscence and unpollinated carpels collected 48 hrs later to ensure ovule maturity. Staining and imaging with a Leica DM6 epifluorescence microscope were as described in (Galindo-Trigo et al., 2020). Ovule phenotypes were categorised for 2-3 carpels per plant and 3 plants per genotype.
Statistics
Seed counts were compared using a Kruskal-Wallis test with correction for multiple testing (Dunn’s multiple comparisons test) performed in GraphPad Prism v 10.0.2. T-DNA insertion transmission rates were analysed in Microsoft Excel (v 16.90.02) using a Chi-square test.
T-DNA insertion mapping
To identify T-DNA insertion sites in the ralf17-1 mutant, genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Maxi Kit (Qiagen). The DNA sample was submitted to Novagene for Illumina sequencing to generate 150-bp paired-end reads. The raw sequencing reads were processed using Fastp (Chen et al., 2018) to remove adapter sequences and trim low-quality bases. The resulting filtered reads were initially mapped to the Arabidopsis thaliana reference genome (TAIR10) using the Burrows-Wheeler Aligner (BWA; (Li and Durbin, 2010)). The resulting SAM files were converted to sorted BAM files using SAMtools (Li et al., 2009). The sorted BAM files were then visualised using Integrative Genomics Viewer (IGV), version 2.19.8 (Robinson et al., 2011), allowing the T-DNA integration site in ralf17-1 to be identified.
To determine whether additional T-DNA integrations were present in the mutant, the filtered Illumina sequencing reads were used to generate de novo genome assemblies for ralf17-1 using SPAdes Genome Assembler, version 4.3.0 (Prjibelski et al., 2020). The ralf17-1 assembly consisted of 4,728 contigs, with a total assembly length of 124,456,250 bp and an N50 of 100,402 bp.
The genome assembly was subsequently searched for sequences derived from the full-length pGABI1 plasmid sequence using BLAST+ (Camacho et al., 2009). BLAST hits corresponding to plasmid-derived sequences were then examined to identify contigs containing T-DNA sequences and to assess the possibility of additional T-DNA integration sites.
","reagents":"Genotype | Gene | ID | Source |
Col-0 | - | - |
|
Col-0 ralf17-1 | At2g32885 | GK_699G03.03 | NASC N467083 |
Col-0 ralf20-1 | At2g34825 | SALK_089411C | NASC N671676 |
Primer name | Primer sequence |
SALK T-DNA (for RALF20 genotyping) | ATTTTGCCGATTTCGGAAC |
GK T-DNA (for RALF17 genotyping) | CATTTTATAATAACGCTGCGGACATCTAC |
RALF17fw | AATGCTACCACATGAACTGGC |
RALF17rv | GTACCAGTCTCAGCTTGCTGC |
RALF20fw | TATCCTCTCACGATGGGACAC |
RALF20rv | TGATCATTTCTTTCACTGGCAG |
At1g51360fw | TGGAAGAAGCGAAATTGGAGA |
At1g51360rv | TGAAAGTCCCACAAACAACCA |
GK T-DNA for At1g51360 insertion | TCAAACCCGGCAGCTTAGTT |
While studying the effects of RALF peptides on reproduction in Arabidopsis, we noted reduced seed set in F1 lines containing a RALF17 (At2G32885; as per (Abarca et al., 2021)) GABI-Kat T-DNA insertion (GK_699G03.03, N467083) in the hemizygous state, but no effect on seed set in homozygous lines. Given reports of genomic rearrangements causing similar phenotypes (Alling and Galindo-Trigo, 2023), we describe here our phenotypic observations and genotyping in order to alert the Arabidopsis research community to issues with this specific plant line.
A ralf17-1 ralf20-1 cross was performed due to potential functions of the cognate proteins in pollen grain hydration and an unexpected reduction in seed number per silique was noted in the F1 generation (i.e. plants hemizygous for both T-DNA insertions) (Lau, 2023). Production of a homozygous double mutant was not possible due to the linkage of the two genes (AT2G32885 and AT2G34825). However, normal seed set was observed for each individual T-DNA insertion line in a homozygous state, indicating the observed phenotype was not due to lethality of one or other of the gene knockouts during gamete development.
To assess the extent of the seed development phenotype in the RALF17/ralf17-1 RALF20/ralf20-1 F1 plants, siliques were cleared and seeds counted in comparison to the homozygous single T-DNA lines and a Col-0 wildtype control. The F1 plants had significantly fewer seeds than the Col-0, ralf17-1/ralf17-1 or ralf20-1/ralf20-1 controls (Fig. 1A,B; Kruskal-Wallis test; Col-0 vs F1 p = 0.01, ralf17-1 vs F1 p = 0.002, ralf20-1 vs F1 p = 0.01), with a mean of 25.6 seeds per F1 silique compared to 62.7 in Col-0, 64.0 in ralf17-1 and 63.4 in ralf20-1. While the F1 plants produce fewer than half as many seeds, it was unclear which aspect of reproduction was affected (e.g. gamete development, pollen tube growth, pollen tube reception or seed development), and whether the RALF17 or RALF20 T-DNA insertion was the genetic determinant.
To determine which of the RALF17 or RALF20 T-DNA insertions was responsible for the observed reduction in seed set, the ralf17-1 and ralf20-1 homozygous lines were each backcrossed to Col-0 and seed numbers in the F1 generation counted. With seed counts in the RALF17/ralf17-1 plants averaging 22.0 compared to a mean of 58.8 in the RALF20/ralf20-1 plants (Fig. 1A,B), the RALF17 T-DNA insertion was determined to be causal.
Crosses with the wildtype Col-0 line further explored the genetics of the phenotype. As the two T-DNAs are linked, non-Mendelian inheritance in a 1:1 ratio is expected in the seeds of a cross to Col-0. Genotyping of 99 seedlings from the Col-0 (female) x RALF17/ralf17-1 RALF20/ralf20-1 (male) cross demonstrated equal transmission of the two T-DNAs via pollen (47 and 52 progeny hemizygous for the ralf17-1 and ralf20-1 T-DNAs, respectively; Chi-squared test p = 0.62). In contrast, transmission of the two T-DNA insertions via the female lineage in a RALF17/ralf17-1 RALF20/ralf20-1 x Col-0 cross indicated reduced inheritance of the ralf17-1 T-DNA (35 and 56 progeny inheriting the ralf17-1 and ralf20-1 T-DNAs, respectively; Chi-squared test p = 0.03). Thus, viable pollen grain formation is not significantly affected in the F1 RALF17/ralf17-1 RALF20/ralf20-1 plants, while ralf17-1 haploid ovules may have reduced viability.
To further understand the ralf17-1 hemizygous phenotype, we examined gamete development, including pollen grains despite the lack of transmission effect. Pollen structure was examined through imaging with a scanning electron microscope. The wildtype Col-0 line and both single mutants had elongated pollen grains with three evenly spaced apertures and a regular exine pattern. A high proportion of the pollen grains of the RALF17/ralf17-1 RALF20/ralf20-1 plants were much smaller and more rounded with wider, less regular apertures and an irregular, less defined exine pattern (Fig. 1C). The F1 RALF17/ralf17-1 had pollen grains similar to the double mutant, with many pollen grains having the smaller, irregular shape. RALF20/ralf20-1 pollen grains, however, were comparable to Col-0 or the single homozygous mutants. Therefore, although transmission of the T-DNA insertions via pollen appears unaffected by whether the haploid genome contains the ralf17-1 or ralf20-1 T-DNA insertion, pollen grain development is nonetheless affected by hemizygousity of the ralf17-1 T-DNA insertion in the parental plant.
Female gamete development was examined through callose staining of unfertilised carpels (48 hrs after emasculation to ensure mature ovules). Unfertilised, mature ovules in the RALF17/ralf17-1 RALF20/ralf20-1 plants could be separated into two categories - those with limited/no callose deposition in the embryo sac that are comparable to ovules of wildtype Col-0 and those with increased deposition of callose in the embryo sac (Fig. 1D,E). These two categories of embryo sacs were observed at 45% (normal) and 55% (increased callose) frequency in RALF17/ralf17-1 RALF20/ralf20-1 plants (Fig. 1F). Examining earlier stages of ovule development in Col-0, we did not observe callose deposition in the embryo sacs, indicating that this is ectopic callose deposition rather than a delay or cessation of ovule development. Combined with the T-DNA insertion transmission rates and seed set numbers presented above, the embryo sac phenotype does not appear to strictly correlate with a lack of viability of the ovules, as otherwise we would expect a much stronger effect on T-DNA insertion transmission via the female lineage and an inability to obtain homozygous ralf17-1 plants. Aberrant embryo sac development could alternatively be a function of genomic rearrangements which lead to developmental defects rather than arising from hemizygousity of the ralf17-1 T-DNA insertion per se.
Whole genome Illumina sequencing was undertaken to identify if a second T-DNA insertion is present in the ralf17-1 GABI-Kat line. As well as confirming the T-DNA insertion in RALF17 (Fig. 1G,H), a second insertion on chromosome 1 at AT1G51370 (encoding an uncharacterised F-box protein) was identified based on a gap in reads mapped to the Arabidopsis thaliana genome (Fig. 1I) and mapping of read contigs to the pGABI1 plasmid. This insertion, confirmed by PCR (Fig. 1J), consists of the plasmid backbone between the right and left T-DNA borders of the pGABI1 plasmid, explaining why it was not identified during standard T-DNA line characterisation. Our mapping approach cannot address whether there is a genomic rearrangement incorporating these two T-DNA insertions as individual reads do not span the insertions.
The ovules and pollen grain phenotypes we have observed in plants hemizygous for the ralf17-1 T-DNA insertion are consistent with phenotypes previously reported for other T-DNA insertion lines with genomic rearrangements. Reports of chromosomal translocations in non-T-DNA-containing plant lines of Datura and maize, that result in meiotic and gametophytic defects, date back a century (Belling and Blakeslee, 1926). With the advent of T-DNA lines for genetics research, genomic rearrangements became a more frequent pitfall. A number of studies have reported gametophytic defects and chromosomal translocations in individual Arabidopsis T-DNA lines (e.g. (Curtis et al., 2009, Alling and Galindo-Trigo, 2023)). One study of 64 SALK T-DNA lines found a 19% rate of chromosomal translocations (Clark and Krysan, 2010) indicating the prevalence of this issue. A smaller study which sequenced the genomes of 14 GABI-Kat T-DNA insertion lines identified chromosomal translocations in four lines, along with numerous T-DNA insertion sites that had not been annotated, concluding that GABI-Kat lines may contain an average of two T-DNA insertions (Pucker et al., 2021). The presence of multiple T-DNA insertions is not however required for chromosomal translocations to occur in insertion lines (reviewed in (Thomson et al., 2024)). As recently highlighted by (Raabe et al., 2024), the gametophytic effects of potential chromosomal rearrangements are of particular concern when studying plant reproduction, with screening of gametophyte phenotypes in F1 crosses of particular relevance. Here we would add our voice to those of others, urging caution when gametophytic phenotypes are observed in hemizygous T-DNA insertion lines but not cognate homozygous lines, with particular warning regarding the RALF17 GABI-Kat T-DNA insertion line GK_699G03.03, NASC N467083.
","references":[{"reference":"Abarca A, Franck CM, Zipfel C. 2021. Family-wide evaluation of RAPID ALKALINIZATION FACTOR peptides. Plant Physiology: kiab308. 1.","pubmedId":"","doi":"10.1093/plphys/kiab308"},{"reference":"Alling R, Galindo Trigo S. 2023. Reproductive defects in the abscission mutant ida-2 are caused by T-DNA–induced genomic rearrangements. Plant Physiology. 193: 2292–2297. 2.","pubmedId":"","doi":"10.1093/plphys/kiad449"},{"reference":"Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, et al., Ecker JR. 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 301: 653–7. 11.","pubmedId":"12893945","doi":"10.1126/science.1086391"},{"reference":"Belling J, Blakeslee AF. 1926. On the attachment of non-homologous chromosomes at the reduction division in certain 25-chromosome Daturas. Proceedings of the National Academy of Sciences. 12: 7–11. 4.","pubmedId":"","doi":"10.1073/pnas.12.1.7"},{"reference":"Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL. 2009. BLAST+: architecture and applications. BMC Bioinformatics. 10: 421. 19.","pubmedId":"20003500","doi":"10.1186/1471-2105-10-421"},{"reference":"Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 34: i884–i890. 14.","pubmedId":"30423086","doi":"10.1093/bioinformatics/bty560"},{"reference":"Clark KA, Krysan PJ. 2010. Chromosomal translocations are a common phenomenon in Arabidopsis thaliana T-DNA insertion lines. The Plant Journal. 64: 990–1001. 6.","pubmedId":"","doi":"10.1111/j.1365-313X.2010.04386.x"},{"reference":"Conrath U. 2024. Unlocking Precision in Callose Staining: Unveiling the Role of Sirofluor. Molecular Plant-Microbe Interactions®. 37: 595. 12.","pubmedId":"38739552","doi":"10.1094/mpmi-04-24-0038-le"},{"reference":"Curtis MJ, Belcram K, Bollmann SR, Tominey CM, Hoffman PD, Mercier R, Hays JB. 2009. Reciprocal chromosome translocation associated with TDNA-insertion mutation in Arabidopsis: genetic and cytological analyses of consequences for gametophyte development and for construction of doubly mutant lines. Planta. 229: 731–745. 5.","pubmedId":"","doi":"10.1007/s00425-008-0868-0"},{"reference":"Galindo Trigo S, Blanco Tourinan N, De Falco TA, Wells ES, Gray JE, Zipfel C, Smith LM. 2020. CrRLK1L receptor-like kinases HERK1 and ANJEA are female determinants of pollen tube reception. EMBO Reports. 21: e48466. 13.","pubmedId":"31867824","doi":"10.15252/embr.201948466"},{"reference":"Kleinboelting N, Huep G, Kloetgen A, Viehoever P, Weisshaar B. 2012. GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database. Nucleic Acids Res 40(Database issue): D1211-5.
","pubmedId":"22080561","doi":"10.1093/nar/gkr1047"},{"reference":"Lau YL. 2023. Functional analysis of Arabidopsis pollen coat proteins in the pollen-stigma interaction. 3.","pubmedId":"","doi":""},{"reference":"Li H, Durbin R. 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics. 26: 589–95. 15.","pubmedId":"20080505","doi":"10.1093/bioinformatics/btp698"},{"reference":"Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al., Genome Project Data Processing S. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25: 2078–9. 16.","pubmedId":"19505943","doi":"10.1093/bioinformatics/btp352"},{"reference":"Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. 2020. Using SPAdes De Novo Assembler. Curr Protoc Bioinformatics. 70: e102. 18.","pubmedId":"32559359","doi":"10.1002/cpbi.102"},{"reference":"Pucker B, Kleinbolting N, Weisshaar B. 2021. Large scale genomic rearrangements in selected Arabidopsis thaliana T-DNA lines are caused by T-DNA insertion mutagenesis. BMC genomics. 22: 1–21. 7.","pubmedId":"","doi":"10.1186/s12864-021-07877-8"},{"reference":"Raabe K, Sun L, Schindfessel C, Honys D, Geelen D. 2024. A word of caution: T-DNA-associated mutagenesis in plant reproduction research. Journal of Experimental Botany. 75: 3248–3258. 9.","pubmedId":"","doi":"10.1093/jxb/erae114"},{"reference":"Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrative genomics viewer. Nat Biotechnol. 29: 24–6. 17.","pubmedId":"21221095","doi":"10.1038/nbt.1754"},{"reference":"Thomson G, Dickinson L, Jacob Y. 2024. Genomic consequences associated with Agrobacterium-mediated transformation of plants. The Plant Journal. 117: 342–363. 8.","pubmedId":"","doi":"https://doi.org/10.1111/tpj.16496"}],"title":"An Arabidopsis RALF17 (AT2G32885) GABI-Kat T-DNA line with two insertions has reproductive defects in the hemizygous state, possibly due to a genomic rearrangement
","reviews":[],"curatorReviews":[]},{"id":"9084e7b9-4318-47b5-9533-9ca308147658","decision":"publish","abstract":"T-DNA insertion lines are reported to have a high probability of chromosomal rearrangements such as translocations, which can result in gametophytic developmental defects. Here we report pollen and ovule phenotypes in a RALF17 (AT2G32885) GABI-Kat line that are present only when the T-DNA is in a hemizygous state, including misshapen mature pollen and an accumulation of callose in the embryo sac. These observations are consistent with phenotypes resulting from chromosomal translocations, often associated with multiple T-DNAs, and we confirmed presence of a second T-DNA insertion. We urge the research community to use alternative knockout lines for reproductive studies of RALF17.
","acknowledgements":"We thank Andrew Fleming and Alice Baillie (University of Sheffield) for discussions at various stages of the project.
","authors":[{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["conceptualization","investigation","visualization","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"j.sloan@sheffield.ac.uk","firstName":"Jen","lastName":"Sloan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-0334-3722"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["conceptualization","investigation","writing_reviewEditing"],"email":"rl.liu2@siat.ac.cn","firstName":"Yui-Leung ","lastName":"Lau","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":" 0000-0002-1459-2639"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["investigation","writing_reviewEditing"],"email":"Amber.Gentle@jic.ac.uk","firstName":"Amber ","lastName":"Gentle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0006-1944-4754"},{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["investigation"],"email":"e.allwood@sheffield.ac.uk","firstName":"Ellen","lastName":"Allwood","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3825-4789"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["investigation"],"email":"V.Cevik@bath.ac.uk","firstName":"Volkan ","lastName":"Cevik","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3545-3179"},{"affiliations":["University of Bath"],"departments":["Department of Life Sciences"],"credit":["conceptualization","supervision","writing_reviewEditing"],"email":"bssjd@bath.ac.uk","firstName":"James","lastName":"Doughty","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-1459-2639"},{"affiliations":["University of Sheffield"],"departments":["School of Biosciences"],"credit":["dataCuration","supervision","fundingAcquisition","investigation","formalAnalysis","visualization","writing_originalDraft","writing_reviewEditing"],"email":"Lisa.m.smith@sheffield.ac.uk","firstName":"Lisa M","lastName":"Smith","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-2364-8187"}],"awards":[{"awardId":"BB/W013754/1","funderName":"Biotechnology and Biological Sciences Research Council (United Kingdom)","awardRecipient":"Lisa Smith"},{"awardId":"2019-056","funderName":"Leverhulme Trust (United Kingdom)","awardRecipient":"Lisa Smith"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/67ce49492a2e50bfdfa51e26354bb91c.jpg"},"imageCaption":"A: Cleared siliques of genotypes used in this study showing a reduced number of seeds in lines where the ralf17-1 GABI-Kat T-DNA insertion of stock line GK_699G03.03 is hemizygous but not homozygous. Scale bar 1 mm. B: Seeds counts for each genotype (6 plants per genotype, 7-8 siliques per plant) show lower numbers of seeds are produced when ralf17-1 is hemizygous in either a cross to wildtype Col-0 or the ralf20-1 T-DNA insertion. Letters refer to statistically similar groups based Kruskal-Wallis test with a post hoc Dunn’s multiple comparisons test. C: SEM images of pollen grains on mature anthers for each genotype showing pollen defects in the F1 progeny of ralf17-1/ralf17-1 x Col-0 and ralf17-1/ralf17-1 x ralf20-1/ralf20-1 crosses. Scale bar 100 μm. D: Composite image of aniline blue (sirofluor)-stained carpels of each genotype. Callose deposits can be observed in approximately half of the ovules in carpels from F1 progeny of ralf17-1/ralf17-1 x Col-0 and ralf17-1/ralf17-1 x ralf20-1/ralf20-1 crosses. Anthers were removed prior to dehiscence and carpels stained 48 hours after anther removal to ensure ovule maturity. E: Epifluorescence image of callose staining of two ovules from a RALF17/ralf17-1 RALF20/ralf20-1 plant showing abnormal callose deposition in the embryo sac of the upper ovule compared to a normal ovule below. F: Quantification of the number of ovules with abnormal vs normal callose levels in the embryo sac for each genotype used in this study. Ovules from 2-3 siliques per plant for 3 plants per line were categorised according to callose level. Means from each plant were used to calculate standard error of the mean. Significantly more ovules had abnormal levels of callose in the RALF17/ralf17-1 RALF20/ralf20-1 and RALF17/ralf17-1 plant compared to Col-0, with letters referring to statistically similar groups based on pair-wise Chi-squared tests with correction for multiple testing. G: Mapping of Illumina reads against the ralf17-1 gene model confirms insertion in the 5’ UTR. The upper grey histogram indicates read depth, with grey lines below showing individual reads. The gene model is shown below in blue, while a black arrow indicates the insertion site. H: PCR genotyping confirmed the GABI-Kat T-DNA insertion in RALF17 for three ralf17-1 plants, while only the wildtype allele is detected for three Col-0 plants. I: Mapping of Illumina reads indicates a second GABI-Kat insertion in the 5’ UTR of AT1G51370. As per G, the upper grey histogram indicates read depth, with grey lines below showing individual reads. The gene model is shown below in blue, while a black arrow indicates the insertion site. J: PCR genotyping confirmed presence of the GABI-Kat T-DNA backbone in AT1G51370 for three ralf17-1 plants.
","imageTitle":"The RALF17 GABI-Kat T-DNA insertion line has gametophytic defects when in a hemizygous state
","methods":"Plant growth
The ralf17-1 and ralf20-1 T-DNA insertion lines (GK_699G03.03 and SALK_089411C, respectively; (Alonso et al., 2003, Kleinboelting et al., 2012)) were acquired from the Nottingham Arabidopsis Stock Centre. Plants were grown in a 3:1 mix of Levington M3 compost:sand in a Conviron growth chamber. Set growth conditions were 22ºC, ~150 µmol-1m-2 light from LEDs for 16 hrs per day and 60% humidity. Genotyping used Qiagen multiplex PCR mix (catalogue number 206143) as per the manufacturer’s guidance, with primers as per the sequences below.
Developmental imaging
For seed counts, mature siliques (7-8 per plant from 6 plants per genotype) were cleared for 2-4 days in 0.4 M NaOH 1% Triton-X 100 at room temperature before photographs were taken. Seed counts were scored from the photographs.
For pollen imaging, anthers were mounted onto aluminium stubs with carbon tabs (Agar Scientific) and imaged using a Hitachi TM3030Plus benchtop scanning electron microscope in secondary electron mode at 15kV.
For aniline blue/sirofluor staining of ovules (Conrath, 2024), anthers were removed from the flowers (stage 16) prior to dehiscence and unpollinated carpels collected 48 hrs later to ensure ovule maturity. Staining and imaging with a Leica DM6 epifluorescence microscope were as described in (Galindo-Trigo et al., 2020). Ovule phenotypes were categorised for 2-3 carpels per plant and 3 plants per genotype.
Statistics
Seed counts were compared using a Kruskal-Wallis test with correction for multiple testing (Dunn’s multiple comparisons test) performed in GraphPad Prism v 10.0.2. T-DNA insertion transmission rates were analysed in Microsoft Excel (v 16.90.02) using a Chi-square test.
T-DNA insertion mapping
To identify T-DNA insertion sites in the ralf17-1 mutant, genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Maxi Kit (Qiagen). The DNA sample was submitted to Novagene for Illumina sequencing to generate 150-bp paired-end reads. The raw sequencing reads were processed using Fastp (Chen et al., 2018) to remove adapter sequences and trim low-quality bases. The resulting filtered reads were initially mapped to the Arabidopsis thaliana reference genome (TAIR10) using the Burrows-Wheeler Aligner (BWA; (Li and Durbin, 2010)). The resulting SAM files were converted to sorted BAM files using SAMtools (Li et al., 2009). The sorted BAM files were then visualised using Integrative Genomics Viewer (IGV), version 2.19.8 (Robinson et al., 2011), allowing the T-DNA integration site in ralf17-1 to be identified.
To determine whether additional T-DNA integrations were present in the mutant, the filtered Illumina sequencing reads were used to generate de novo genome assemblies for ralf17-1 using SPAdes Genome Assembler, version 4.3.0 (Prjibelski et al., 2020). The ralf17-1 assembly consisted of 4,728 contigs, with a total assembly length of 124,456,250 bp and an N50 of 100,402 bp.
The genome assembly was subsequently searched for sequences derived from the full-length pGABI1 plasmid sequence using BLAST+ (Camacho et al., 2009). BLAST hits corresponding to plasmid-derived sequences were then examined to identify contigs containing T-DNA sequences and to assess the possibility of additional T-DNA integration sites.
","reagents":"Genotype | Gene | ID | Source |
Col-0 | - | - |
|
Col-0 ralf17-1 | At2g32885 | GK_699G03.03 | NASC N467083 |
Col-0 ralf20-1 | At2g34825 | SALK_089411C | NASC N671676 |
Primer name | Primer sequence |
SALK T-DNA (for RALF20 genotyping) | ATTTTGCCGATTTCGGAAC |
GK T-DNA (for RALF17 genotyping) | CATTTTATAATAACGCTGCGGACATCTAC |
RALF17fw | AATGCTACCACATGAACTGGC |
RALF17rv | GTACCAGTCTCAGCTTGCTGC |
RALF20fw | TATCCTCTCACGATGGGACAC |
RALF20rv | TGATCATTTCTTTCACTGGCAG |
At1g51360fw | TGGAAGAAGCGAAATTGGAGA |
At1g51360rv | TGAAAGTCCCACAAACAACCA |
GK T-DNA for At1g51360 insertion | TCAAACCCGGCAGCTTAGTT |
While studying the effects of RALF peptides on reproduction in Arabidopsis, we noted reduced seed set in F1 lines containing a RALF17 (At2G32885; as per (Abarca et al., 2021)) GABI-Kat T-DNA insertion (GK_699G03.03, N467083) in the hemizygous state, but no effect on seed set in homozygous lines. Given reports of genomic rearrangements causing similar phenotypes (Alling and Galindo-Trigo, 2023), we describe here our phenotypic observations and genotyping in order to alert the Arabidopsis research community to issues with this specific plant line.
A ralf17-1 ralf20-1 cross was performed due to potential functions of the cognate proteins in pollen grain hydration and an unexpected reduction in seed number per silique was noted in the F1 generation (i.e. plants hemizygous for both T-DNA insertions) (Lau, 2023). Production of a homozygous double mutant was not possible due to the linkage of the two genes (AT2G32885 and AT2G34825). However, normal seed set was observed for each individual T-DNA insertion line in a homozygous state, indicating the observed phenotype was not due to lethality of one or other of the gene knockouts during gamete development.
To assess the extent of the seed development phenotype in the RALF17/ralf17-1 RALF20/ralf20-1 F1 plants, siliques were cleared and seeds counted in comparison to the homozygous single T-DNA lines and a Col-0 wildtype control. The F1 plants had significantly fewer seeds than the Col-0, ralf17-1/ralf17-1 or ralf20-1/ralf20-1 controls (Fig. 1A,B; Kruskal-Wallis test; Col-0 vs F1 p = 0.01, ralf17-1 vs F1 p = 0.002, ralf20-1 vs F1 p = 0.01), with a mean of 25.6 seeds per F1 silique compared to 62.7 in Col-0, 64.0 in ralf17-1 and 63.4 in ralf20-1. While the F1 plants produce fewer than half as many seeds, it was unclear which aspect of reproduction was affected (e.g. gamete development, pollen tube growth, pollen tube reception or seed development), and whether the RALF17 or RALF20 T-DNA insertion was the genetic determinant.
To determine which of the RALF17 or RALF20 T-DNA insertions was responsible for the observed reduction in seed set, the ralf17-1 and ralf20-1 homozygous lines were each backcrossed to Col-0 and seed numbers in the F1 generation counted. With seed counts in the RALF17/ralf17-1 plants averaging 22.0 compared to a mean of 58.8 in the RALF20/ralf20-1 plants (Fig. 1A,B), the RALF17 T-DNA insertion was determined to be causal.
Crosses with the wildtype Col-0 line further explored the genetics of the phenotype. As the two T-DNAs are linked, non-Mendelian inheritance in a 1:1 ratio is expected in the seeds of a cross to Col-0. Genotyping of 99 seedlings from the Col-0 (female) x RALF17/ralf17-1 RALF20/ralf20-1 (male) cross demonstrated equal transmission of the two T-DNAs via pollen (47 and 52 progeny hemizygous for the ralf17-1 and ralf20-1 T-DNAs, respectively; Chi-squared test p = 0.62). In contrast, transmission of the two T-DNA insertions via the female lineage in a RALF17/ralf17-1 RALF20/ralf20-1 x Col-0 cross indicated reduced inheritance of the ralf17-1 T-DNA (35 and 56 progeny inheriting the ralf17-1 and ralf20-1 T-DNAs, respectively; Chi-squared test p = 0.03). Thus, viable pollen grain formation is not significantly affected in the F1 RALF17/ralf17-1 RALF20/ralf20-1 plants, while ralf17-1 haploid ovules may have reduced viability.
To further understand the ralf17-1 hemizygous phenotype, we examined gamete development, including pollen grains despite the lack of transmission effect. Pollen structure was examined through imaging with a scanning electron microscope. The wildtype Col-0 line and both single mutants had elongated pollen grains with three evenly spaced apertures and a regular exine pattern. A high proportion of the pollen grains of the RALF17/ralf17-1 RALF20/ralf20-1 plants were much smaller and more rounded with wider, less regular apertures and an irregular, less defined exine pattern (Fig. 1C). The F1 RALF17/ralf17-1 had pollen grains similar to the double mutant, with many pollen grains having the smaller, irregular shape. RALF20/ralf20-1 pollen grains, however, were comparable to Col-0 or the single homozygous mutants. Therefore, although transmission of the T-DNA insertions via pollen appears unaffected by whether the haploid genome contains the ralf17-1 or ralf20-1 T-DNA insertion, pollen grain development is nonetheless affected by hemizygousity of the ralf17-1 T-DNA insertion in the parental plant.
Female gamete development was examined through callose staining of unfertilised carpels (48 hrs after emasculation to ensure mature ovules). Unfertilised, mature ovules in the RALF17/ralf17-1 RALF20/ralf20-1 plants could be separated into two categories - those with limited/no callose deposition in the embryo sac that are comparable to ovules of wildtype Col-0 and those with increased deposition of callose in the embryo sac (Fig. 1D,E). These two categories of embryo sacs were observed at 45% (normal) and 55% (increased callose) frequency in RALF17/ralf17-1 RALF20/ralf20-1 plants (Fig. 1F). Examining earlier stages of ovule development in Col-0, we did not observe callose deposition in the embryo sacs, indicating that this is ectopic callose deposition rather than a delay or cessation of ovule development. Combined with the T-DNA insertion transmission rates and seed set numbers presented above, the embryo sac phenotype does not appear to strictly correlate with a lack of viability of the ovules, as otherwise we would expect a much stronger effect on T-DNA insertion transmission via the female lineage and an inability to obtain homozygous ralf17-1 plants. Aberrant embryo sac development could alternatively be a function of genomic rearrangements which lead to developmental defects rather than arising from hemizygousity of the ralf17-1 T-DNA insertion per se.
Whole genome Illumina sequencing was undertaken to identify if a second T-DNA insertion is present in the ralf17-1 GABI-Kat line. As well as confirming the T-DNA insertion in RALF17 (Fig. 1G,H), a second insertion on chromosome 1 at AT1G51370 (encoding an uncharacterised F-box protein) was identified based on a gap in reads mapped to the Arabidopsis thaliana genome (Fig. 1I) and mapping of read contigs to the pGABI1 plasmid. This insertion, confirmed by PCR (Fig. 1J), consists of the plasmid backbone between the right and left T-DNA borders of the pGABI1 plasmid, explaining why it was not identified during standard T-DNA line characterisation. Our mapping approach cannot address whether there is a genomic rearrangement incorporating these two T-DNA insertions as individual reads do not span the insertions.
The ovules and pollen grain phenotypes we have observed in plants hemizygous for the ralf17-1 T-DNA insertion are consistent with phenotypes previously reported for other T-DNA insertion lines with genomic rearrangements. Reports of chromosomal translocations in non-T-DNA-containing plant lines of Datura and maize, that result in meiotic and gametophytic defects, date back a century (Belling and Blakeslee, 1926). With the advent of T-DNA lines for genetics research, genomic rearrangements became a more frequent pitfall. A number of studies have reported gametophytic defects and chromosomal translocations in individual Arabidopsis T-DNA lines (e.g. (Curtis et al., 2009, Alling and Galindo-Trigo, 2023)). One study of 64 SALK T-DNA lines found a 19% rate of chromosomal translocations (Clark and Krysan, 2010) indicating the prevalence of this issue. A smaller study which sequenced the genomes of 14 GABI-Kat T-DNA insertion lines identified chromosomal translocations in four lines, along with numerous T-DNA insertion sites that had not been annotated, concluding that GABI-Kat lines may contain an average of two T-DNA insertions (Pucker et al., 2021). The presence of multiple T-DNA insertions is not however required for chromosomal translocations to occur in insertion lines (reviewed in (Thomson et al., 2024)). As recently highlighted by (Raabe et al., 2024), the gametophytic effects of potential chromosomal rearrangements are of particular concern when studying plant reproduction, with screening of gametophyte phenotypes in F1 crosses of particular relevance. Here we would add our voice to those of others, urging caution when gametophytic phenotypes are observed in hemizygous T-DNA insertion lines but not cognate homozygous lines, with particular warning regarding the RALF17 GABI-Kat T-DNA insertion line GK_699G03.03, NASC N467083.
","references":[{"reference":"Abarca A, Franck CM, Zipfel C. 2021. Family-wide evaluation of RAPID ALKALINIZATION FACTOR peptides. Plant Physiology: kiab308. 1.","pubmedId":"","doi":"10.1093/plphys/kiab308"},{"reference":"Alling R, Galindo Trigo S. 2023. Reproductive defects in the abscission mutant ida-2 are caused by T-DNA–induced genomic rearrangements. Plant Physiology. 193: 2292–2297. 2.","pubmedId":"","doi":"10.1093/plphys/kiad449"},{"reference":"Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, et al., Ecker JR. 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 301: 653–7. 11.","pubmedId":"12893945","doi":"10.1126/science.1086391"},{"reference":"Belling J, Blakeslee AF. 1926. On the attachment of non-homologous chromosomes at the reduction division in certain 25-chromosome Daturas. Proceedings of the National Academy of Sciences. 12: 7–11. 4.","pubmedId":"","doi":"10.1073/pnas.12.1.7"},{"reference":"Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL. 2009. BLAST+: architecture and applications. BMC Bioinformatics. 10: 421. 19.","pubmedId":"20003500","doi":"10.1186/1471-2105-10-421"},{"reference":"Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 34: i884–i890. 14.","pubmedId":"30423086","doi":"10.1093/bioinformatics/bty560"},{"reference":"Clark KA, Krysan PJ. 2010. Chromosomal translocations are a common phenomenon in Arabidopsis thaliana T-DNA insertion lines. The Plant Journal. 64: 990–1001. 6.","pubmedId":"","doi":"10.1111/j.1365-313X.2010.04386.x"},{"reference":"Conrath U. 2024. Unlocking Precision in Callose Staining: Unveiling the Role of Sirofluor. Molecular Plant-Microbe Interactions®. 37: 595. 12.","pubmedId":"38739552","doi":"10.1094/mpmi-04-24-0038-le"},{"reference":"Curtis MJ, Belcram K, Bollmann SR, Tominey CM, Hoffman PD, Mercier R, Hays JB. 2009. Reciprocal chromosome translocation associated with TDNA-insertion mutation in Arabidopsis: genetic and cytological analyses of consequences for gametophyte development and for construction of doubly mutant lines. Planta. 229: 731–745. 5.","pubmedId":"","doi":"10.1007/s00425-008-0868-0"},{"reference":"Galindo Trigo S, Blanco Tourinan N, De Falco TA, Wells ES, Gray JE, Zipfel C, Smith LM. 2020. CrRLK1L receptor-like kinases HERK1 and ANJEA are female determinants of pollen tube reception. EMBO Reports. 21: e48466. 13.","pubmedId":"31867824","doi":"10.15252/embr.201948466"},{"reference":"Kleinboelting N, Huep G, Kloetgen A, Viehoever P, Weisshaar B. 2012. GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database. Nucleic Acids Res 40(Database issue): D1211-5.
","pubmedId":"22080561","doi":"10.1093/nar/gkr1047"},{"reference":"Lau YL. 2023. Functional analysis of Arabidopsis pollen coat proteins in the pollen-stigma interaction. 3.","pubmedId":"","doi":""},{"reference":"Li H, Durbin R. 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics. 26: 589–95. 15.","pubmedId":"20080505","doi":"10.1093/bioinformatics/btp698"},{"reference":"Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al., Genome Project Data Processing S. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25: 2078–9. 16.","pubmedId":"19505943","doi":"10.1093/bioinformatics/btp352"},{"reference":"Prjibelski A, Antipov D, Meleshko D, Lapidus A, Korobeynikov A. 2020. Using SPAdes De Novo Assembler. Curr Protoc Bioinformatics. 70: e102. 18.","pubmedId":"32559359","doi":"10.1002/cpbi.102"},{"reference":"Pucker B, Kleinbolting N, Weisshaar B. 2021. Large scale genomic rearrangements in selected Arabidopsis thaliana T-DNA lines are caused by T-DNA insertion mutagenesis. BMC genomics. 22: 1–21. 7.","pubmedId":"","doi":"10.1186/s12864-021-07877-8"},{"reference":"Raabe K, Sun L, Schindfessel C, Honys D, Geelen D. 2024. A word of caution: T-DNA-associated mutagenesis in plant reproduction research. Journal of Experimental Botany. 75: 3248–3258. 9.","pubmedId":"","doi":"10.1093/jxb/erae114"},{"reference":"Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrative genomics viewer. Nat Biotechnol. 29: 24–6. 17.","pubmedId":"21221095","doi":"10.1038/nbt.1754"},{"reference":"Thomson G, Dickinson L, Jacob Y. 2024. Genomic consequences associated with Agrobacterium-mediated transformation of plants. The Plant Journal. 117: 342–363. 8.","pubmedId":"","doi":"https://doi.org/10.1111/tpj.16496"}],"title":"An Arabidopsis RALF17 (AT2G32885) GABI-Kat T-DNA line with two insertions has reproductive defects in the hemizygous state, possibly due to a genomic rearrangement
","reviews":[],"curatorReviews":[]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"35613228-77a5-450a-a444-f6347bf62ad4","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}