Photoconvertible fluorescent proteins are used as a tool to study protein dynamics in vivo. Here, we directly compared the photoconvertible fluorophores Dendra2 and mKikGR in Caenorhabditis elegans. We endogenously tagged the brush border protein NRFL-1 and evaluated photoconversion rate, photostability, and brightness. We found that mKikGR has a higher photoconversion rate, while Dendra2 is brighter. Under common imaging conditions, there is no clear difference in photostability. Thus, for most applications, both mKikGR and Dendra2 are suitable, but Dendra2 may be advantageous for low-abundance proteins. We also show that mKikGR can be used for long-term analysis of NRFL-1 protein turnover.
","acknowledgements":"We thank W. Arkes for help with experiments. We also thank the Ruijtenberg and the Boxem lab members for their helpful discussions. This work utilised resources from Utrecht University. We also thank the Biology Imaging Center, Faculty of Sciences, of the Department of Biology at Utrecht University. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["conceptualization","formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing"],"email":"j.m.woeltjes@uu.nl","firstName":"Joren M","lastName":"Woeltjes","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-1434-750X"},{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["conceptualization","investigation","writing_originalDraft","writing_reviewEditing"],"email":"l.b.steller@uu.nl","firstName":"Loes B","lastName":"Steller","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-0601-0945"},{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["fundingAcquisition","conceptualization","supervision","writing_originalDraft","writing_reviewEditing"],"email":"s.a.ruijtenberg@uu.nl","firstName":"Suzan","lastName":"Ruijtenberg","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3534-1214"},{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["supervision","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"m.boxem@uu.nl","firstName":"Mike","lastName":"Boxem","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3966-4173"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Funding for this project was provided by the ERC Starting Grant 101219284 to S. Ruijtenberg
","image":{"url":"https://portal.micropublication.org/uploads/fce37a071be3a7fc6a4cad93323fdfbc.png"},"imageCaption":"(A) Schematic of C-terminal Dendra2 and mKikGR fusions to NRFL-1. (B) Representative images showing NRFL-1::Dendra2 and NRFL-1::mKikGR before (left) and after photoconversion. Animals were imaged prior to conversion, and every subsequent second. In between imaging, they were exposed to a 1 s pulse of 405 nm laser light to photoconvert Dendra2 or mKikGR from green to red. (C) Average fluorescence intensity levels plotted over time. N = 5 for each condition. Lines and shaded areas plot mean ± SD. Scale bars: 2 µm. (D) Green-to-red converted fraction of Dendra2 and mKikGR. Each dot represents a single animal, and line the mean. Mann-Whitney test: P = 0.0012. (E) Maximum green- and red-state fluorescence intensities for Dendra2 and mKikGR. Boxes show the median and interquartile range; whiskers extend from the minimum to the maximum. Each dot represents a single animal. Mann-Whitney test; green: P = 0.0012; red: P = 0.0023. (F) Graphical representation of the experimental set-up in G. (G) Relative red-state intensity after a total of 3 s of 561 nm light exposure (0.1 s pulses at 5 s intervals), interspersed with either 1 s pulses of 405 nm light or 100 ms pulses of 488 nm light. Bars plot the mean ± SD. Each dot represents a single animal. Mann-Whitney test: control: P = 0.0043; +405 nm pulses: P = 0.0159; +488 nm pulses: P = 0.4206. n is indicated in each bar. (H) Graphical representation of expected green state levels and dark state conversion, and measured green state levels during 2 s acquisition with a single 100 ms 405 nm pulse after 1 s. n = 1 (I) Total protein turnover of NRFL-1 measured up to 24 h. Green intensity was normalized to mean pre-conversion levels, and red intensity to the mean at the first timepoint. Dotted lines are simple linear regression fits. Each dot represents a single animal. n = 6, 6, 6, 5, 6 for the subsequent timepoints. Different animals were imaged at each timepoint.
","imageTitle":"Comparative assessment of Dendra2 and mKikGR
","methods":"C. elegans maintenance
C. elegans strains were cultured and maintained under standard conditions (Brenner, 1974). The animals were grown on nematode growth medium (NGM) plates seeded with the Escherichia coli strain OP50. All experiments were performed at 20 °C.
CRISPR/Cas9 genome editing
C. elegans codon-optimised Dendra2 and mKikGR were designed with the use of Wormbuilder (https://wormbuilder.org/transgenebuilder/) (Frøkjær-Jensen et al., 2016), and ordered as gBlock Gene Fragments through IDT. gBlocks were cloned into pBSK by blunt ligation to yield plasmids pSRG103 and pSRG104. A 4x Gly linker was placed between the fluorescent protein and NRFL-1. Silent mutations were introduced to prevent re-cutting after homologous recombination. The knock-in alleles were made using CRISPR/Cas9-mediated homology-directed repair in a wild-type animal (CGC1). The genomic nrfl-1 sequence was obtained from WormBase (Sternberg et al., 2024). Young adult animals were injected with the repair template for either Dendra2 or mKikGR and the Cas9 (Alt-R S.p. Cas9 Nuclease V3)-guide RNA complex (Ghanta et al., 2021). Progeny were selected by fluorescence, and the knock-in sequences were PCR amplified and sequenced, using Sanger sequencing.
Microscopy
The animals were handled in daylight settings, as this did not produce any measurable level of conversion. Animals were mounted on a 5% agarose pad and immobilised with 20 mM tetramisole solution in M9 (22 mM KH2PO4, 42 mM Na2HPO4, 85 mM NaCl, 1 mM MgSO4). Spinning disc confocal imaging was performed on a Nikon Ti-U microscope, equipped with a Yokogawa CSU-X1 spinning disc and a Prime BSI Express Scientific CMOS camera (Teledyne Photometrics). We used a Nikon CFI Plan Apo λ 100x/1.45 0.13mm WD OIL objective for the Dendra2 and mKikGR comparisons, and a Nikon CFI Plan Apo λ 60x/1.40 0.13mm WD OIL objective for the 24 h protein turnover analysis. Prior to imaging, the objective was manually focused on the middle of the intestine using only backlight, without the use of the lasers. Identical settings were used for both green and red channels.
Photoconversion
Green-to-red conversion for the Dendra2 and mKikGR comparisons was done on the Nikon spinning disc confocal microscope, using the 405 nm BFP laser at a measured power of 0.605 mW. For the 24 h protein turnover experiment, animals were converted on an Axio Zoom.V16 using blue 405 nm light for 10 seconds to ensure optimal green-to-red conversion at a measured power of 86.0 mW.
Image analysis
Image analysis was conducted in FIJI. A 5 pixel-wide line was drawn along sections of the brush border of the int2-4 cells, and the average intensity was measured. All images were corrected for background fluorescence by measuring an area outside of the animal and subtracting this value from the absolute measured fluorescence value.
Statistics
All statistical analyses were performed using GraphPad Prism (10.4.1). The sample sizes, statistical test used, and p values are indicated in the Figure and legend. No statistical method was used to pre-determine sample sizes. No samples or animals were excluded from analysis. The experiments were not randomised, and the investigators were not blinded to allocation during experiments and outcome assessment. All presented graphs were made using GraphPad Prism and Adobe Illustrator. All tests were two-tailed. All data were treated as non-normally distributed, and a Mann-Whitney test was used for all comparisons.
Data availability
All data supporting the findings of this study are available within the paper. Raw microscopy image files are available from the corresponding author upon reasonable request. C. elegans strains are available upon reasonable request.
","reagents":"Strain | Genotype | Source |
|---|---|---|
CGC1 | wild type | CGC |
BOX1335 | nrfl-1(mib377[nrfl-1::Dendra2]) IV | this study |
BOX1336 | nrfl-1(mib378[nrfl-1::mKikGR]) IV | this study |
Plasmid | Genotype | Description |
pSRG103 | pBSK::Dendra2 | |
pSRG104 | pBSK::mKikGR | |
Oligo | Sequence (5'-3') | Description |
nrfl-1 crRNA | CCTTAACGAGAAGTATCAAT | crRNA targeting nrfl-1; used for both knock-ins |
Forward RT nrfl-1::Dendra2 | ttgtagGCACGAGATGAGCCTTAACGAGAAGTATCAATTaGTaAGtAAtATGGGCGGTGGGGGAATGAACACTCCGGGGATCAATCTG | Forward primer for amplifying the nrfl-1::Dendra2 repair template (RT) |
Reverse RT nrfl-1::Dendra2 | aatagaagaaaataagaagaagttgcaaaagaTTACCAGACTTGGGATGGGAGTG | Reverse primer for amplifying the nrfl-1::Dendra2 repair template (RT) |
Forward RT nrfl-1::mKikGR | ttgtagGCACGAGATGAGCCTTAACGAGAAGTATCAATTaGTaAGtAatATGGGCGGTGGGGGAATGTCGGTGATCACTTCGGAAATG | Forward primer for amplifying the nrfl-1::mKikGR repair template (RT) |
Reverse RT nrfl-1::mKikGR | AatagaagaaaataagaagaagttgcaaaagaTTATGCCTCGAATTCGTACTTAGCTCC | Reverse primer for amplifying the nrfl-1::mKikGR repair template (RT) |
Forward (genotyping) | CCATTGAGCAATGGTTCCAGC | PCR amplification and Sanger sequencing of knock-in alleles; used for both knock-ins |
Reverse (genotyping) | cggtgtaagtaaagaatattgcacaacc | PCR amplification and Sanger sequencing of knock-in alleles; used for both knock-ins |
Photoconvertible fluorophores are a valuable tool for studying dynamic cellular processes, such as protein turnover and mobility, and for tracking cell lineages (Nemet et al., 2015). Unlike conventional fluorophores such as GFP, photoconvertible fluorophores can be irreversibly converted from one colour state to another upon illumination with a specific wavelength (Wiedenmann et al., 2004; Lešková et al., 2019). Multiple photoconvertible fluorophores have been developed over the past decades, including EosFP, Dendra, Kaede, and KikGR (Wiedenmann et al., 2004; Tsutsui et al., 2005; Gurskaya et al., 2006; Habuchi et al., 2008). As photoconvertible fluorophores can vary in conversion rate, convertible fraction, photostability, and brightness, comparing different variants can help us identify the most suitable fluorophore for a given application.
In the nematode Caenorhabditis elegans, Dendra2 and mKikGR have been used successfully (Hamer et al., 2010; So et al., 2024). Both are green-to-red photoconvertible fluorophores that convert upon illumination with UV or violet light (Tsutsui et al., 2005; Gurskaya et al., 2006; Habuchi et al., 2008). Previous data indicate that mKikGR has a high photoconversion rate and improved photostability over other photoconvertible proteins, which helps to reduce negative effects from phototoxicity (Habuchi et al., 2008; Turkowyd et al., 2017). However, in C. elegans a direct comparison between the mKikGR and Dendra2 photoconvertible fluorophores is lacking. Here, we aimed to directly compare the properties of these two fluorophores in vivo to determine their suitability for measuring protein turnover.
To determine the in vivo behaviour of Dendra2 and mKikGR in C. elegans, we generated endogenous CRISPR/Cas9-mediated fusions to NRFL-1, an abundant apical adapter protein that links the Ezrin/Radixin/Moesin ortholog ERM-1 to various other proteins (Figure 1A, Sepers et al., 2022). High expression levels and low turnover rates make NRFL-1 an ideal candidate to measure and compare photoconversion rates, convertible fraction, photostability, and brightness.
We first compared the kinetics of green-to-red photoconversion by exposing L2 larvae to repeated 1 s pulses of a 405 nm laser, interspersed with imaging of green and red fluorescence for 100 ms each. mKikGR converted from green to red faster than Dendra2 (Figure 1B, C). After a single 2 second blue laser pulse, green mKikGR levels decreased to less than 5% of initial levels, whereas Dendra2 required at least 8 seconds of exposure to reach a comparable reduction (Figure 1B, C). Despite this difference in conversion rate, the maximum fraction converted was similar for the two fluorophores (96.3% for Dendra2 vs. 97.5% for mKikGR) (Figure 1D).
Next, we compared the fluorescence intensity of NRFL-1 tagged with Dendra2 or mKikGR. We measured a higher fluorescence intensity for Dendra2, particularly in the green state, where its signal was approximately 3.5-fold higher than that of mKikGR (Figure 1E). This higher brightness may make Dendra2 advantageous for visualising low-abundance proteins. However, we cannot exclude the possibility that the two fusion proteins are expressed at different levels.
To test the photostability of Dendra2 and mKikGR, we performed an initial photoconversion (2 and 5 seconds of 405 nm light for NRFL-1::mKikGR and NRFL-1::Dendra2 respectively) followed by imaging of the red fluorescent channel at 5 second intervals (561 nm, 100 ms exposures). Additionally, we tested the effect of exposing animals to either 100 ms pulses of 488 nm light (mimicking imaging of a green fluorophore) or 1 s pulses of 405 nm light in between the image acquisition (Figure 1F). In all conditions, we measured remaining red fluorescence intensity after 3 s total exposure time to 561 nm light.
With post-conversion exposure to 561 nm light only, 88% of the red Dendra2 signal remained after 3 s total exposure, compared with only 53% for mKikGR. Interestingly, the additional exposures to 405 nm or 488 nm strongly affected the results. Exposure to 405 nm light caused a decrease in average red Dendra2 intensity from 0.88 to 0.07 a.u. (Figure 1G). Thus, Dendra2 photostability is dependent on the illumination wavelength, and reduced by exposure to 405 nm light. mKikGR was much less affected by exposure to 405 nm light. Surprisingly, however, mKikGR was more photostable when exposed to 488 nm pulses in addition to the 561 nm pulses (Figure 1G). One possibility is that red mKikGR enters a dark state upon exposure to 561 nm light, which is reversed by exposure to 488 nm light. This hypothesis is based on the observation that red EosFP switches to a dark state upon 561 nm light illumination, which can be reversed with either 405 or 488 nm light exposure (Nienhaus & Nienhaus, 2021; Wulffelé et al., 2025).
The presence of dark states may also explain a second observation we made during our analyses. We found that illumination with a 488 nm laser to focus the microscope resulted in a rapid decline in green signal intensity for both Dendra2 and mKikGR. This decrease might be attributable to conversion to reversible dark green states as opposed to bleaching, based on in-depth analyses of conformational states in the mechanistically related EosFP family and Dendra2 (De Zitter et al., 2019; De Zitter et al., 2020; Tao et al., 2020; Nienhaus & Nienhaus, 2021; Wulffelé et al., 2025). To test this, we exposed NRFL-1::Dendra2 and NRFL-1::mKikGR animals to a brief (100 ms) pulse of 405 nm light following an initial period of exposure to 488 nm light. If the loss of green intensity were due to bleaching, the 405 nm pulse would be expected to further decrease green signal due to green-to-red conversion. If, however, the loss of green intensity were due to conversion to a dark state, the 405 nm pulse would be expected to shift a portion of the protein back to the green state, in addition to the green-to-red conversion, potentially resulting in a net increase in green signal. We observed a partial recovery of green signal, consistent with the hypothesis that the decrease in green signal upon 488 nm light exposure is due to conversion to a dark conformational state (Figure 1H).
Finally, we examined whether mKikGR can be used for long-term tracking of NRFL-1 protein turnover in the intestine. We exposed L2 larvae to the 405 nm LED light source of a fluorescent binocular microscope for 10 s and imaged at specific timepoints thereafter. Red fluorescence corresponds to the pool of NRFL-1 present at photoconversion, whereas green fluorescence indicates newly synthesised protein. Red signal decreased by ~85% after 24 h, suggesting that protein turnover of NRFL-1 takes around 24 hours (Figure 1I). This observation is consistent with the slow turnover rate of NRFL-1 at the apical domain previously measured by fluorescence recovery after photobleaching (FRAP) (Sepers et al., 2022) and demonstrates that mKikGR is suitable for the long-term tracking of protein turnover.
In summary, we compared the in vivo properties of Dendra2 and mKikGR in C. elegans using endogenous NRFL-1 fusions, and showed that mKikGR enables tracking of protein turnover over long periods of time. mKikGR has a higher photoconversion rate than Dendra2, but is less bright, particularly in the green state. Under imaging conditions combining a brief 405 nm exposure for photoconversion with subsequent 488 nm and 561 nm imaging, we observed no difference in photobleaching between Dendra2 and mKikGR. Finally, we observed behaviour consistent with reversible dark green conformational states for mKikGR and Dendra2 under 488 nm illumination. This effect was stronger for mKikGR, making it more difficult to use when green fluorescence is essential to focus on the sample, or where obtaining pre-conversion images is essential. Ultimately, neither fluorophore consistently outperformed the other, and both are suitable for photoconversion studies in C. elegans.
","references":[{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 4052.","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"De Zitter E, Thedie D, Monkemoller V, Hugelier S, Beaudouin J, Adam V, et al., Bourgeois D. 2019. Mechanistic investigation of mEos4b reveals a strategy to reduce track. Nature Methods. 16: 707-710. 4020.","pubmedId":"","doi":"10.1038/s41592-019-0462-3"},{"reference":"De Zitter E, Ridard J, Thedie D, Adam V, Levy B, Byrdin M, et al., Bourgeois D. 2020. Mechanistic Investigations of Green mEos4b Reveal a Dynamic Long-Lived. Journal of the American Chemical Society. 142: 10978-10988. 4022.","pubmedId":"","doi":"10.1021/jacs.0c01880"},{"reference":"Frokjaer Jensen C, Jain N, Hansen L, Davis MW, Li Y, Zhao D, et al., Fire AZ. 2016. An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silenc. Cell. 166: 343-357. 4024.","pubmedId":"","doi":"10.1016/j.cell.2016.05.072"},{"reference":"Ghanta KS, Ishidate T, Mello CC. 2021. Microinjection for precision genome editing in Caenorhabditis elegans. STAR protocols. 2: 100748. 4026.","pubmedId":"","doi":"10.1016/j.xpro.2021.100748"},{"reference":"Gurskaya NG, Verkhusha VV, Shcheglov AS, Staroverov DB, Chepurnykh TV, Fradkov AF, Lukyanov S, Lukyanov KA. 2006. Engineering of a monomeric green-to-red photoactivatable fluorescent p. Nature Biotechnology. 24: 461-465. 4028.","pubmedId":"","doi":"10.1038/nbt1191"},{"reference":"Habuchi S, Tsutsui H, Kochaniak AB, Miyawaki A, Oijen AM. 2008. mKikGR, a monomeric photoswitchable fluorescent protein. PloS One. 3: e3944. 4030.","pubmedId":"","doi":"10.1371/journal.pone.0003944"},{"reference":"Hamer G, Matilainen O, Holmberg CI. 2010. A photoconvertible reporter of the ubiquitin-proteasome system in vivo. Nature Methods. 7: 473-478. 4032.","pubmedId":"","doi":"10.1038/nmeth.1460"},{"reference":"Leskova A, Kusa Z, Labajova M, Krausko M, Jasik J. 2019. The Photoconvertible Fluorescent Protein Dendra2 Tag as a Tool to Inve. Methods in Molecular Biology. 1992: 201-214. 4034.","pubmedId":"","doi":"10.1007/978-1-4939-9469-4_13"},{"reference":"Nemet I, Ropelewski P, Imanishi Y. 2015. Applications of phototransformable fluorescent proteins for tracking t. Photochemical & Photobiological Sciences: Official Journal of the Euro. 14: 1787-1806. 4036.","pubmedId":"","doi":"10.1039/c5pp00174a"},{"reference":"Nienhaus K, Nienhaus GU. 2021. Fluorescent proteins of the EosFP clade: intriguing marker tools with. RSC chemical biology. 2: 796-814. 4038.","pubmedId":"","doi":"10.1039/d1cb00014d"},{"reference":"Sepers JJ, Ramalho JJ, Kroll JR, Schmidt R, Boxem M. 2022. ERM-1 Phosphorylation and NRFL-1 Redundantly Control Lumen Formation i. Frontiers in Cell and Developmental Biology. 10: 769862. 1352.","pubmedId":"","doi":"10.3389/fcell.2022.769862"},{"reference":"So S, Asakawa M, Sawa H. 2024. Distinct functions of three Wnt proteins control mirror-symmetric orga. eLife. 13: e103035. 4040.","pubmedId":"","doi":"10.7554/eLife.103035"},{"reference":"Sternberg PW, Van Auken K, Wang Q, Wright A, Yook K, Zarowiecki M, et al., Stein L. 2024. WormBase 2024: status and transitioning to Alliance infrastructure. Genetics. 227: iyae050. 3606.","pubmedId":"","doi":"10.1093/genetics/iyae050"},{"reference":"Tao A, Zhang R, Yuan J. 2020. Characterization of Photophysical Properties of Photoactivatable Fluor. The Journal of Physical Chemistry. B. 124: 1892-1897. 4042.","pubmedId":"","doi":"10.1021/acs.jpcb.9b11028"},{"reference":"Tsutsui H, Karasawa S, Shimizu H, Nukina N, Miyawaki A. 2005. Semi-rational engineering of a coral fluorescent protein into an effic. EMBO reports. 6: 233-238. 4044.","pubmedId":"","doi":"10.1038/sj.embor.7400361"},{"reference":"Turkowyd B, Balinovic A, Virant D, Carnero HGG, Caldana F, Endesfelder M, Bourgeois D, Endesfelder U. 2017. A General Mechanism of Photoconversion of Green-to-Red Fluorescent Pro. Angewandte Chemie. 56: 11634-11639. 4046.","pubmedId":"","doi":"10.1002/anie.201702870"},{"reference":"Wiedenmann J, Ivanchenko S, Oswald F, Schmitt F, Rocker C, Salih A, Spindler KD, Nienhaus GU. 2004. EosFP, a fluorescent marker protein with UV-inducible green-to-red flu. Proceedings of the National Academy of Sciences of the United States o. 101: 15905-15910. 4048.","pubmedId":"","doi":"10.1073/pnas.0403668101"},{"reference":"Wulffele J, Maity A, Ayala I, Gambarelli S, Brutscher B, Bourgeois D. 2025. Light-Induced Conformational Heterogeneity Induces Positive Photoswitc. Journal of the American Chemical Society. 147: 10357-10368. 4050.","pubmedId":"","doi":"10.1021/jacs.4c17311"},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 4052.","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"De Zitter E, Thedie D, Monkemoller V, Hugelier S, Beaudouin J, Adam V, et al., Bourgeois D. 2019. Mechanistic investigation of mEos4b reveals a strategy to reduce track. Nature Methods. 16: 707-710. 4020.","pubmedId":"","doi":"10.1038/s41592-019-0462-3"},{"reference":"De Zitter E, Ridard J, Thedie D, Adam V, Levy B, Byrdin M, et al., Bourgeois D. 2020. Mechanistic Investigations of Green mEos4b Reveal a Dynamic Long-Lived. Journal of the American Chemical Society. 142: 10978-10988. 4022.","pubmedId":"","doi":"10.1021/jacs.0c01880"},{"reference":"Frokjaer Jensen C, Jain N, Hansen L, Davis MW, Li Y, Zhao D, et al., Fire AZ. 2016. An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silenc. Cell. 166: 343-357. 4024.","pubmedId":"","doi":"10.1016/j.cell.2016.05.072"},{"reference":"Ghanta KS, Ishidate T, Mello CC. 2021. Microinjection for precision genome editing in Caenorhabditis elegans. STAR protocols. 2: 100748. 4026.","pubmedId":"","doi":"10.1016/j.xpro.2021.100748"},{"reference":"Gurskaya NG, Verkhusha VV, Shcheglov AS, Staroverov DB, Chepurnykh TV, Fradkov AF, Lukyanov S, Lukyanov KA. 2006. Engineering of a monomeric green-to-red photoactivatable fluorescent p. Nature Biotechnology. 24: 461-465. 4028.","pubmedId":"","doi":"10.1038/nbt1191"},{"reference":"Habuchi S, Tsutsui H, Kochaniak AB, Miyawaki A, Oijen AM. 2008. mKikGR, a monomeric photoswitchable fluorescent protein. PloS One. 3: e3944. 4030.","pubmedId":"","doi":"10.1371/journal.pone.0003944"},{"reference":"Hamer G, Matilainen O, Holmberg CI. 2010. A photoconvertible reporter of the ubiquitin-proteasome system in vivo. Nature Methods. 7: 473-478. 4032.","pubmedId":"","doi":"10.1038/nmeth.1460"},{"reference":"Leskova A, Kusa Z, Labajova M, Krausko M, Jasik J. 2019. The Photoconvertible Fluorescent Protein Dendra2 Tag as a Tool to Inve. Methods in Molecular Biology. 1992: 201-214. 4034.","pubmedId":"","doi":"10.1007/978-1-4939-9469-4_13"},{"reference":"Nemet I, Ropelewski P, Imanishi Y. 2015. Applications of phototransformable fluorescent proteins for tracking t. Photochemical & Photobiological Sciences: Official Journal of the Euro. 14: 1787-1806. 4036.","pubmedId":"","doi":"10.1039/c5pp00174a"},{"reference":"Nienhaus K, Nienhaus GU. 2021. Fluorescent proteins of the EosFP clade: intriguing marker tools with. RSC chemical biology. 2: 796-814. 4038.","pubmedId":"","doi":"10.1039/d1cb00014d"},{"reference":"Sepers JJ, Ramalho JJ, Kroll JR, Schmidt R, Boxem M. 2022. ERM-1 Phosphorylation and NRFL-1 Redundantly Control Lumen Formation i. Frontiers in Cell and Developmental Biology. 10: 769862. 1352.","pubmedId":"","doi":"10.3389/fcell.2022.769862"},{"reference":"So S, Asakawa M, Sawa H. 2024. Distinct functions of three Wnt proteins control mirror-symmetric orga. eLife. 13: e103035. 4040.","pubmedId":"","doi":"10.7554/eLife.103035"},{"reference":"Sternberg PW, Van Auken K, Wang Q, Wright A, Yook K, Zarowiecki M, et al., Stein L. 2024. WormBase 2024: status and transitioning to Alliance infrastructure. Genetics. 227: iyae050. 3606.","pubmedId":"","doi":"10.1093/genetics/iyae050"},{"reference":"Tao A, Zhang R, Yuan J. 2020. Characterization of Photophysical Properties of Photoactivatable Fluor. The Journal of Physical Chemistry. B. 124: 1892-1897. 4042.","pubmedId":"","doi":"10.1021/acs.jpcb.9b11028"},{"reference":"Tsutsui H, Karasawa S, Shimizu H, Nukina N, Miyawaki A. 2005. Semi-rational engineering of a coral fluorescent protein into an effic. EMBO reports. 6: 233-238. 4044.","pubmedId":"","doi":"10.1038/sj.embor.7400361"},{"reference":"Turkowyd B, Balinovic A, Virant D, Carnero HGG, Caldana F, Endesfelder M, Bourgeois D, Endesfelder U. 2017. A General Mechanism of Photoconversion of Green-to-Red Fluorescent Pro. Angewandte Chemie. 56: 11634-11639. 4046.","pubmedId":"","doi":"10.1002/anie.201702870"},{"reference":"Wiedenmann J, Ivanchenko S, Oswald F, Schmitt F, Rocker C, Salih A, Spindler KD, Nienhaus GU. 2004. EosFP, a fluorescent marker protein with UV-inducible green-to-red flu. Proceedings of the National Academy of Sciences of the United States o. 101: 15905-15910. 4048.","pubmedId":"","doi":"10.1073/pnas.0403668101"},{"reference":"Wulffele J, Maity A, Ayala I, Gambarelli S, Brutscher B, Bourgeois D. 2025. Light-Induced Conformational Heterogeneity Induces Positive Photoswitc. Journal of the American Chemical Society. 147: 10357-10368. 4050.","pubmedId":"","doi":"10.1021/jacs.4c17311"}],"title":"Comparative assessment of Dendra2 and mKikGR for in vivo analysis of protein turnover in Caenorhabditis elegans
","reviews":[{"reviewer":{"displayName":"Christian Frøkjær-Jensen"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"2220ddf5-46fc-437f-b3f1-4778178b3d8b","decision":"accept","abstract":"Photoconvertible fluorescent proteins are used as a tool to study protein dynamics in vivo. Here, we directly compared the photoconvertible fluorophores Dendra2 and mKikGR in Caenorhabditis elegans. We endogenously tagged the brush border protein NRFL-1 and evaluated photoconversion rate, photostability, and brightness. We found that mKikGR has a higher photoconversion rate, while Dendra2 is brighter. Under common imaging conditions, there is no clear difference in photostability. Thus, for most applications, both mKikGR and Dendra2 are suitable, but Dendra2 may be advantageous for low-abundance proteins. We also show that mKikGR can be used for long-term analysis of NRFL-1 protein turnover.
","acknowledgements":"We thank W. Arkes for help with experiments. We also thank the Ruijtenberg and the Boxem lab members for their helpful discussions. This work utilised resources from Utrecht University. We also thank the Biology Imaging Center, Faculty of Sciences, of the Department of Biology at Utrecht University. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["conceptualization","formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing"],"email":"j.m.woeltjes@uu.nl","firstName":"Joren M","lastName":"Woeltjes","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-1434-750X"},{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["conceptualization","investigation","writing_originalDraft","writing_reviewEditing"],"email":"l.b.steller@uu.nl","firstName":"Loes B","lastName":"Steller","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-0601-0945"},{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["fundingAcquisition","conceptualization","supervision","writing_originalDraft","writing_reviewEditing"],"email":"s.a.ruijtenberg@uu.nl","firstName":"Suzan","lastName":"Ruijtenberg","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3534-1214"},{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["supervision","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"m.boxem@uu.nl","firstName":"Mike","lastName":"Boxem","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3966-4173"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Funding for this project was provided by the ERC Starting Grant 101219284 to S. Ruijtenberg
","image":{"url":"https://portal.micropublication.org/uploads/fce37a071be3a7fc6a4cad93323fdfbc.png"},"imageCaption":"(A) Schematic of C-terminal Dendra2 and mKikGR fusions to NRFL-1. (B) Representative images showing NRFL-1::Dendra2 and NRFL-1::mKikGR before (left) and after photoconversion. Animals were imaged prior to conversion, and every subsequent second. In between imaging, they were exposed to a 1 s pulse of 405 nm laser light to photoconvert Dendra2 or mKikGR from green to red. (C) Average fluorescence intensity levels plotted over time. N = 5 for each condition. Lines and shaded areas plot mean ± SD. Scale bars: 2 µm. (D) Green-to-red converted fraction of Dendra2 and mKikGR. The converted fraction was determined as the average loss of green signal over a 10 second time window after the maximum red emission time point. Each dot represents a single animal, and line the mean. Mann-Whitney test: P = 0.0012. (E) Maximum green- and red-state fluorescence intensities for Dendra2 and mKikGR. Boxes show the median and interquartile range; whiskers extend from the minimum to the maximum. Each dot represents a single animal. Mann-Whitney test; green: P = 0.0012; red: P = 0.0023. (F) Graphical representation of the experimental set-up in G. (G) Relative red-state intensity after a total of 3 s of 561 nm light exposure (0.1 s pulses at 5 s intervals), interspersed with either 1 s pulses of 405 nm light or 100 ms pulses of 488 nm light. Bars plot the mean ± SD. Each dot represents a single animal. Mann-Whitney test: control: P = 0.0043; +405 nm pulses: P = 0.0159; +488 nm pulses: P = 0.4206. n is indicated in each bar. (H) Graphical representation of expected green state levels and dark state conversion, and measured green state levels during 2 s acquisition with a single 100 ms 405 nm pulse after 1 s. n = 1 (I) Total protein turnover of NRFL-1 measured up to 24 h. Green intensity was normalized to mean pre-conversion levels, and red intensity to the mean at the first timepoint. Dotted lines are simple linear regression fits. Each dot represents a single animal. n = 6, 6, 6, 5, 6 for the subsequent timepoints. Different animals were imaged at each timepoint.
","imageTitle":"Comparative assessment of Dendra2 and mKikGR
","methods":"C. elegans maintenance
C. elegans strains were cultured and maintained under standard conditions (Brenner, 1974). The animals were grown on nematode growth medium (NGM) plates seeded with the Escherichia coli strain OP50. All experiments were performed at 20 °C.
CRISPR/Cas9 genome editing
C. elegans codon-optimised Dendra2 and mKikGR were designed with the use of Wormbuilder (https://wormbuilder.org/transgenebuilder/) (Frøkjær-Jensen et al., 2016), and ordered as gBlock Gene Fragments through IDT. gBlocks were cloned into pBSK by blunt ligation to yield plasmids pSRG103 and pSRG104. A 4x Gly linker was placed between the fluorescent protein and NRFL-1. Silent mutations were introduced to prevent re-cutting after homologous recombination. The knock-in alleles were made using CRISPR/Cas9-mediated homology-directed repair in a wild-type animal (CGC1). The genomic nrfl-1 sequence was obtained from WormBase (Sternberg et al., 2024). Young adult animals were injected with the repair template for either Dendra2 or mKikGR and the Cas9 (Alt-R S.p. Cas9 Nuclease V3)-guide RNA complex (Ghanta et al., 2021). Progeny were selected by fluorescence, and the knock-in sequences were PCR amplified and sequenced, using Sanger sequencing.
Microscopy
The animals were handled in daylight settings, as this did not produce any measurable level of conversion. Animals were mounted on a 5% agarose pad and immobilised with 20 mM tetramisole solution in M9 (22 mM KH2PO4, 42 mM Na2HPO4, 85 mM NaCl, 1 mM MgSO4). Spinning disc confocal imaging was performed on a Nikon Ti-U microscope, equipped with a Yokogawa CSU-X1 spinning disc and a Prime BSI Express Scientific CMOS camera (Teledyne Photometrics). We used a Nikon CFI Plan Apo λ 100x/1.45 0.13mm WD OIL objective for the Dendra2 and mKikGR comparisons, and a Nikon CFI Plan Apo λ 60x/1.40 0.13mm WD OIL objective for the 24 h protein turnover analysis. Prior to imaging, the objective was manually focused on the middle of the intestine using only backlight, without the use of the lasers. Identical settings were used for both green and red channels.
Photoconversion
Green-to-red conversion for the Dendra2 and mKikGR comparisons was done on the Nikon spinning disc confocal microscope, using the 405 nm BFP laser at a measured power of 0.605 mW. For the 24 h protein turnover experiment, animals were converted on an Axio Zoom.V16 using blue 405 nm light for 10 seconds to ensure optimal green-to-red conversion at a measured power of 86.0 mW.
Image analysis
Image analysis was conducted in FIJI. A 5 pixel-wide line was drawn along sections of the brush border of the int2-4 cells, and the average intensity was measured. All images were corrected for background fluorescence by measuring an area outside of the animal and subtracting this value from the absolute measured fluorescence value.
Statistics
All statistical analyses were performed using GraphPad Prism (10.4.1). The sample sizes, statistical test used, and p values are indicated in the Figure and legend. No statistical method was used to pre-determine sample sizes. No samples or animals were excluded from analysis. The experiments were not randomised, and the investigators were not blinded to allocation during experiments and outcome assessment. All presented graphs were made using GraphPad Prism and Adobe Illustrator. All tests were two-tailed. All data were treated as non-normally distributed, and a Mann-Whitney test was used for all comparisons.
Data availability
All data supporting the findings of this study are available within the paper. Raw microscopy image files are available from the corresponding author upon reasonable request. C. elegans strains are available upon reasonable request.
","reagents":"Strain | Genotype | Source |
|---|---|---|
wild type | CGC | |
this study | ||
this study | ||
Plasmid | Genotype | Description |
pSRG103 | pBSK::Dendra2 | |
pSRG104 | pBSK::mKikGR | |
Oligo | Sequence (5'-3') | Description |
nrfl-1 crRNA | CCTTAACGAGAAGTATCAAT | crRNA targeting nrfl-1; used for both knock-ins |
Forward RT nrfl-1::Dendra2 | ttgtagGCACGAGATGAGCCTTAACGAGAAGTATCAATTaGTaAGtAAtATGGGCGGTGGGGGAATGAACACTCCGGGGATCAATCTG | Forward primer for amplifying the nrfl-1::Dendra2 repair template (RT) |
Reverse RT nrfl-1::Dendra2 | aatagaagaaaataagaagaagttgcaaaagaTTACCAGACTTGGGATGGGAGTG | Reverse primer for amplifying the nrfl-1::Dendra2 repair template (RT) |
Forward RT nrfl-1::mKikGR | ttgtagGCACGAGATGAGCCTTAACGAGAAGTATCAATTaGTaAGtAatATGGGCGGTGGGGGAATGTCGGTGATCACTTCGGAAATG | Forward primer for amplifying the nrfl-1::mKikGR repair template (RT) |
Reverse RT nrfl-1::mKikGR | AatagaagaaaataagaagaagttgcaaaagaTTATGCCTCGAATTCGTACTTAGCTCC | Reverse primer for amplifying the nrfl-1::mKikGR repair template (RT) |
Forward (genotyping) | CCATTGAGCAATGGTTCCAGC | PCR amplification and Sanger sequencing of knock-in alleles; used for both knock-ins |
Reverse (genotyping) | cggtgtaagtaaagaatattgcacaacc | PCR amplification and Sanger sequencing of knock-in alleles; used for both knock-ins |
Photoconvertible fluorophores are a valuable tool for studying dynamic cellular processes, such as protein turnover and mobility, and for tracking cell lineages (Nemet et al., 2015). Unlike conventional fluorophores such as GFP, photoconvertible fluorophores can be irreversibly converted from one colour state to another upon illumination with a specific wavelength (Wiedenmann et al., 2004; Lešková et al., 2019). Multiple photoconvertible fluorophores have been developed over the past decades, including EosFP, Dendra, Kaede, and KikGR (Wiedenmann et al., 2004; Tsutsui et al., 2005; Gurskaya et al., 2006; Habuchi et al., 2008). As photoconvertible fluorophores can vary in conversion rate, convertible fraction, photostability, and brightness, comparing different variants can help us identify the most suitable fluorophore for a given application.
In the nematode Caenorhabditis elegans, Dendra2 and mKikGR have been used successfully (Hamer et al., 2010; So et al., 2024). Both are green-to-red photoconvertible fluorophores that convert upon illumination with UV (100-400 nm) or violet light (405 nm) (Tsutsui et al., 2005; Gurskaya et al., 2006; Habuchi et al., 2008). Previous data indicate that mKikGR has a high photoconversion rate and improved photostability over other photoconvertible proteins, which helps to reduce negative effects from phototoxicity (Habuchi et al., 2008; Turkowyd et al., 2017). However, in C. elegans a direct comparison between the mKikGR and Dendra2 photoconvertible fluorophores is lacking. Here, we aimed to directly compare the properties of these two fluorophores in vivo to determine their suitability for measuring protein turnover.
To determine the in vivo behaviour of Dendra2 and mKikGR in C. elegans, we generated endogenous CRISPR/Cas9-mediated fusions to NRFL-1, an abundant apical adapter protein that links the Ezrin/Radixin/Moesin ortholog ERM-1 to various other proteins (Figure 1A, Sepers et al., 2022). High expression levels and low turnover rates make NRFL-1 an ideal candidate to measure and compare photoconversion rates, convertible fraction, photostability, and brightness.
We first compared the kinetics of green-to-red photoconversion by exposing L2 larvae to repeated 1 s pulses of a 405 nm laser, interspersed with imaging of green and red fluorescence for 100 ms each. mKikGR converted from green to red faster than Dendra2 (Figure 1B, C). After two 1 s pulses of 405 nm laser exposure, green mKikGR levels decreased to less than 5% of initial levels, whereas Dendra2 required at least 8 consecutive 1 s pulses of 405 nm laser exposure to reach a comparable reduction (Figure 1B, C). The maximum fraction converted was significantly higher for mKikGR (96.3% for Dendra2 vs. 97.5% for mKikGR, P = 0.0012), although the absolute difference was modest (Figure 1D).
Next, we compared the fluorescence intensity of NRFL-1 tagged with Dendra2 or mKikGR. We measured a higher fluorescence intensity for Dendra2, particularly in the green state, where its signal was approximately 3.5-fold higher than that of mKikGR (Figure 1E). This higher brightness may make Dendra2 advantageous for visualising low-abundance proteins. However, we cannot exclude the possibility that the two fusion proteins are expressed at different levels.
To test the photostability of Dendra2 and mKikGR, we performed an initial photoconversion (2 and 5 seconds of 405 nm light for NRFL-1::mKikGR and NRFL-1::Dendra2 respectively) followed by imaging of the red fluorescent channel at 5 second intervals (561 nm, 100 ms exposures). Additionally, we tested the effect of exposing animals to either 100 ms pulses of 488 nm (blue) light (mimicking imaging of a green fluorophore) or 1 s pulses of 405 nm light in between the image acquisition (Figure 1F). In all conditions, we measured remaining red fluorescence intensity after 3 s total exposure time to 561 nm (green) light.
With post-conversion exposure to 561 nm light only, 88% of the red Dendra2 signal remained after 3 s total exposure, compared with only 53% for mKikGR. Interestingly, the additional exposures to 405 nm or 488 nm strongly affected the results. Exposure to 405 nm light caused a decrease in average red Dendra2 intensity from 0.88 to 0.07 a.u. (Figure 1G). Thus, Dendra2 photostability is dependent on the illumination wavelength, and reduced by exposure to 405 nm light. mKikGR was much less affected by exposure to 405 nm light. Surprisingly, however, mKikGR was more photostable when exposed to 488 nm pulses in addition to the 561 nm pulses (Figure 1G). One possibility is that red mKikGR enters a dark state upon exposure to 561 nm light, which is reversed by exposure to 488 nm light. This hypothesis is based on the observation that red EosFP switches to a dark state upon 561 nm light illumination, which can be reversed with either 405 or 488 nm light exposure (Nienhaus & Nienhaus, 2021; Wulffelé et al., 2025).
The presence of dark states may also explain a second observation we made during our analyses. We found that illumination with a 488 nm laser to focus the microscope resulted in a rapid decline in green signal intensity for both Dendra2 and mKikGR. This decrease might be attributable to conversion to reversible dark green states as opposed to bleaching, based on in-depth analyses of conformational states in the mechanistically related EosFP family and Dendra2 (De Zitter et al., 2019; De Zitter et al., 2020; Tao et al., 2020; Nienhaus & Nienhaus, 2021; Wulffelé et al., 2025). To test this, we exposed NRFL-1::Dendra2 and NRFL-1::mKikGR animals to a brief (100 ms) pulse of 405 nm light following an initial period of exposure to 488 nm light. If the loss of green intensity were due to bleaching, the 405 nm pulse would be expected to further decrease green signal due to green-to-red conversion. If, however, the loss of green intensity were due to conversion to a dark state, the 405 nm pulse would be expected to shift a portion of the protein back to the green state, in addition to the green-to-red conversion, potentially resulting in a net increase in green signal. We observed a partial recovery of green signal, consistent with the hypothesis that the decrease in green signal upon 488 nm light exposure is due to conversion to a dark conformational state (Figure 1H).
Finally, we examined whether mKikGR can be used for long-term tracking of NRFL-1 protein turnover in the intestine. We exposed L2 larvae to the 405 nm LED light source of a fluorescent binocular microscope for 10 s and imaged at specific timepoints thereafter. Red fluorescence corresponds to the pool of NRFL-1 present at photoconversion, whereas green fluorescence indicates newly synthesised protein. Red signal decreased by ~85% after 24 h, suggesting that protein turnover of NRFL-1 takes around 24 hours (Figure 1I). This observation is consistent with the slow turnover rate of NRFL-1 at the apical domain previously measured by fluorescence recovery after photobleaching (FRAP) (Sepers et al., 2022) and demonstrates that mKikGR is suitable for the long-term tracking of protein turnover.
In summary, we compared the in vivo properties of Dendra2 and mKikGR in C. elegans using endogenous NRFL-1 fusions, and showed that mKikGR enables tracking of protein turnover over long periods of time. mKikGR has a higher photoconversion rate than Dendra2, but is less bright, particularly in the green state. Under imaging conditions combining a brief 405 nm exposure for photoconversion with subsequent red and green state imaging, we observed no difference in photobleaching between Dendra2 and mKikGR. Finally, we observed behaviour consistent with reversible dark green conformational states for mKikGR and Dendra2 under 488 nm illumination. This effect was stronger for mKikGR, making it more difficult to use when green fluorescence is essential to focus on the sample, or where obtaining pre-conversion images is essential. Ultimately, neither fluorophore consistently outperformed the other, and both are suitable for photoconversion studies in C. elegans.
","references":[{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 4052.","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"De Zitter E, Thedie D, Monkemoller V, Hugelier S, Beaudouin J, Adam V, et al., Bourgeois D. 2019. Mechanistic investigation of mEos4b reveals a strategy to reduce track. Nature Methods. 16: 707-710. 4020.","pubmedId":"","doi":"10.1038/s41592-019-0462-3"},{"reference":"De Zitter E, Ridard J, Thedie D, Adam V, Levy B, Byrdin M, et al., Bourgeois D. 2020. Mechanistic Investigations of Green mEos4b Reveal a Dynamic Long-Lived. Journal of the American Chemical Society. 142: 10978-10988. 4022.","pubmedId":"","doi":"10.1021/jacs.0c01880"},{"reference":"Frokjaer Jensen C, Jain N, Hansen L, Davis MW, Li Y, Zhao D, et al., Fire AZ. 2016. An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silenc. Cell. 166: 343-357. 4024.","pubmedId":"","doi":"10.1016/j.cell.2016.05.072"},{"reference":"Ghanta KS, Ishidate T, Mello CC. 2021. Microinjection for precision genome editing in Caenorhabditis elegans. STAR protocols. 2: 100748. 4026.","pubmedId":"","doi":"10.1016/j.xpro.2021.100748"},{"reference":"Gurskaya NG, Verkhusha VV, Shcheglov AS, Staroverov DB, Chepurnykh TV, Fradkov AF, Lukyanov S, Lukyanov KA. 2006. Engineering of a monomeric green-to-red photoactivatable fluorescent p. Nature Biotechnology. 24: 461-465. 4028.","pubmedId":"","doi":"10.1038/nbt1191"},{"reference":"Habuchi S, Tsutsui H, Kochaniak AB, Miyawaki A, Oijen AM. 2008. mKikGR, a monomeric photoswitchable fluorescent protein. PloS One. 3: e3944. 4030.","pubmedId":"","doi":"10.1371/journal.pone.0003944"},{"reference":"Hamer G, Matilainen O, Holmberg CI. 2010. A photoconvertible reporter of the ubiquitin-proteasome system in vivo. Nature Methods. 7: 473-478. 4032.","pubmedId":"","doi":"10.1038/nmeth.1460"},{"reference":"Leskova A, Kusa Z, Labajova M, Krausko M, Jasik J. 2019. The Photoconvertible Fluorescent Protein Dendra2 Tag as a Tool to Inve. Methods in Molecular Biology. 1992: 201-214. 4034.","pubmedId":"","doi":"10.1007/978-1-4939-9469-4_13"},{"reference":"Nemet I, Ropelewski P, Imanishi Y. 2015. Applications of phototransformable fluorescent proteins for tracking t. Photochemical & Photobiological Sciences: Official Journal of the Euro. 14: 1787-1806. 4036.","pubmedId":"","doi":"10.1039/c5pp00174a"},{"reference":"Nienhaus K, Nienhaus GU. 2021. Fluorescent proteins of the EosFP clade: intriguing marker tools with. RSC chemical biology. 2: 796-814. 4038.","pubmedId":"","doi":"10.1039/d1cb00014d"},{"reference":"Sepers JJ, Ramalho JJ, Kroll JR, Schmidt R, Boxem M. 2022. ERM-1 Phosphorylation and NRFL-1 Redundantly Control Lumen Formation i. Frontiers in Cell and Developmental Biology. 10: 769862. 1352.","pubmedId":"","doi":"10.3389/fcell.2022.769862"},{"reference":"So S, Asakawa M, Sawa H. 2024. Distinct functions of three Wnt proteins control mirror-symmetric orga. eLife. 13: e103035. 4040.","pubmedId":"","doi":"10.7554/eLife.103035"},{"reference":"Sternberg PW, Van Auken K, Wang Q, Wright A, Yook K, Zarowiecki M, et al., Stein L. 2024. WormBase 2024: status and transitioning to Alliance infrastructure. Genetics. 227: iyae050. 3606.","pubmedId":"","doi":"10.1093/genetics/iyae050"},{"reference":"Tao A, Zhang R, Yuan J. 2020. Characterization of Photophysical Properties of Photoactivatable Fluor. The Journal of Physical Chemistry. B. 124: 1892-1897. 4042.","pubmedId":"","doi":"10.1021/acs.jpcb.9b11028"},{"reference":"Tsutsui H, Karasawa S, Shimizu H, Nukina N, Miyawaki A. 2005. Semi-rational engineering of a coral fluorescent protein into an effic. EMBO reports. 6: 233-238. 4044.","pubmedId":"","doi":"10.1038/sj.embor.7400361"},{"reference":"Turkowyd B, Balinovic A, Virant D, Carnero HGG, Caldana F, Endesfelder M, Bourgeois D, Endesfelder U. 2017. A General Mechanism of Photoconversion of Green-to-Red Fluorescent Pro. Angewandte Chemie. 56: 11634-11639. 4046.","pubmedId":"","doi":"10.1002/anie.201702870"},{"reference":"Wiedenmann J, Ivanchenko S, Oswald F, Schmitt F, Rocker C, Salih A, Spindler KD, Nienhaus GU. 2004. EosFP, a fluorescent marker protein with UV-inducible green-to-red flu. Proceedings of the National Academy of Sciences of the United States o. 101: 15905-15910. 4048.","pubmedId":"","doi":"10.1073/pnas.0403668101"},{"reference":"Wulffele J, Maity A, Ayala I, Gambarelli S, Brutscher B, Bourgeois D. 2025. Light-Induced Conformational Heterogeneity Induces Positive Photoswitc. Journal of the American Chemical Society. 147: 10357-10368. 4050.","pubmedId":"","doi":"10.1021/jacs.4c17311"}],"title":"Comparative assessment of Dendra2 and mKikGR for in vivo analysis of protein turnover in Caenorhabditis elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1793392027307"}]},{"id":"0f41bef0-1211-4480-bcbc-746320215d8d","decision":"publish","abstract":"Photoconvertible fluorescent proteins are used as a tool to study protein dynamics in vivo. Here, we directly compared the photoconvertible fluorophores Dendra2 and mKikGR in Caenorhabditis elegans. We endogenously tagged the brush border protein NRFL-1 and evaluated photoconversion rate, photostability, and brightness. We found that mKikGR has a higher photoconversion rate, while Dendra2 is brighter. Under common imaging conditions, there is no clear difference in photostability. Thus, for most applications, both mKikGR and Dendra2 are suitable, but Dendra2 may be advantageous for low-abundance proteins. We also show that mKikGR can be used for long-term analysis of NRFL-1 protein turnover.
","acknowledgements":"We thank W. Arkes for help with experiments. We also thank the Ruijtenberg and the Boxem lab members for their helpful discussions. This work utilised resources from Utrecht University. We also thank the Biology Imaging Center, Faculty of Sciences, of the Department of Biology at Utrecht University. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["conceptualization","formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing"],"email":"j.m.woeltjes@uu.nl","firstName":"Joren M","lastName":"Woeltjes","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0002-1434-750X"},{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["conceptualization","investigation","writing_originalDraft","writing_reviewEditing"],"email":"l.b.steller@uu.nl","firstName":"Loes B","lastName":"Steller","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0000-0601-0945"},{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["fundingAcquisition","conceptualization","supervision","writing_originalDraft","writing_reviewEditing"],"email":"s.a.ruijtenberg@uu.nl","firstName":"Suzan","lastName":"Ruijtenberg","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3534-1214"},{"affiliations":["Utrecht University, Utrecht, UT, The Netherlands"],"departments":["1.\tInstitute of Biodynamics and Biocomplexity, Department of Biology"],"credit":["supervision","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"m.boxem@uu.nl","firstName":"Mike","lastName":"Boxem","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3966-4173"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Funding for this project was provided by the ERC Starting Grant 101219284 to S. Ruijtenberg
","image":{"url":"https://portal.micropublication.org/uploads/fce37a071be3a7fc6a4cad93323fdfbc.png"},"imageCaption":"(A) Schematic of C-terminal Dendra2 and mKikGR fusions to NRFL-1. (B) Representative images showing NRFL-1::Dendra2 and NRFL-1::mKikGR before (left) and after photoconversion. Animals were imaged prior to conversion, and every subsequent second. In between imaging, they were exposed to a 1 second pulse of 405 nm laser light to photoconvert Dendra2 or mKikGR from green to red. (C) Average fluorescence intensity levels plotted over time. N = 5 for each condition. Lines and shaded areas plot mean ± SD. Scale bars: 2 µm. (D) Green-to-red converted fraction of Dendra2 and mKikGR. The converted fraction was determined as the average loss of green signal over a 10 second time window after the maximum red emission time point. Each dot represents a single animal, and line the mean. Mann-Whitney test: P = 0.0012. (E) Maximum green- and red-state fluorescence intensities for Dendra2 and mKikGR. Boxes show the median and interquartile range; whiskers extend from the minimum to the maximum. Each dot represents a single animal. Mann-Whitney test; green: P = 0.0012; red: P = 0.0023. (F) Graphical representation of the experimental set-up in G. (G) Relative red-state intensity after a total of 3 seconds of 561 nm light exposure (0.1 second pulses at 5 second intervals), interspersed with either 1 second pulses of 405 nm light or 100 ms pulses of 488 nm light. Bars plot the mean ± SD. Each dot represents a single animal. Mann-Whitney test: control: P = 0.0043; +405 nm pulses: P = 0.0159; +488 nm pulses: P = 0.4206. n is indicated in each bar. (H) Graphical representation of expected green state levels and dark state conversion, and measured green state levels during 2 second acquisition with a single 100 ms 405 nm pulse after 1 s. n = 1 (I) Total protein turnover of NRFL-1 measured up to 24 h. Green intensity was normalized to mean pre-conversion levels, and red intensity to the mean at the first timepoint. Dotted lines are simple linear regression fits. Each dot represents a single animal. n = 6, 6, 6, 5, 6 for the subsequent timepoints. Different animals were imaged at each timepoint.
","imageTitle":"Comparative assessment of Dendra2 and mKikGR
","methods":"C. elegans maintenance
C. elegans strains were cultured and maintained under standard conditions (Brenner, 1974). The animals were grown on nematode growth medium (NGM) plates seeded with the Escherichia coli strain OP50. All experiments were performed at 20 °C.
CRISPR/Cas9 genome editing
C. elegans codon-optimised Dendra2 and mKikGR were designed with the use of Wormbuilder (https://wormbuilder.org/transgenebuilder/) (Frøkjær-Jensen et al., 2016), and ordered as gBlock Gene Fragments through IDT. gBlocks were cloned into pBSK by blunt ligation to yield plasmids pSRG103 and pSRG104. A 4x Gly linker was placed between the fluorescent protein and NRFL-1. Silent mutations were introduced to prevent re-cutting after homologous recombination. The knock-in alleles were made using CRISPR/Cas9-mediated homology-directed repair in a wild-type animal (CGC1). The genomic nrfl-1 sequence was obtained from WormBase (Sternberg et al., 2024). Young adult animals were injected with the repair template for either Dendra2 or mKikGR and the Cas9 (Alt-R S.p. Cas9 Nuclease V3)-guide RNA complex (Ghanta et al., 2021). Progeny were selected by fluorescence, and the knock-in sequences were PCR amplified and sequenced, using Sanger sequencing.
Microscopy
The animals were handled in daylight settings, as this did not produce any measurable level of conversion. Animals were mounted on a 5% agarose pad and immobilised with 20 mM tetramisole solution in M9 (22 mM KH2PO4, 42 mM Na2HPO4, 85 mM NaCl, 1 mM MgSO4). Spinning disc confocal imaging was performed on a Nikon Ti-U microscope, equipped with a Yokogawa CSU-X1 spinning disc and a Prime BSI Express Scientific CMOS camera (Teledyne Photometrics). We used a Nikon CFI Plan Apo λ 100x/1.45 0.13mm WD OIL objective for the Dendra2 and mKikGR comparisons, and a Nikon CFI Plan Apo λ 60x/1.40 0.13mm WD OIL objective for the 24 h protein turnover analysis. Prior to imaging, the objective was manually focused on the middle of the intestine using only backlight, without the use of the lasers. Identical settings were used for both green and red channels.
Photoconversion
Green-to-red conversion for the Dendra2 and mKikGR comparisons was done on the Nikon spinning disc confocal microscope, using the 405 nm BFP laser at a measured power of 0.605 mW. For the 24 h protein turnover experiment, animals were converted on an Axio Zoom.V16 using blue 405 nm light for 10 seconds to ensure optimal green-to-red conversion at a measured power of 86.0 mW.
Image analysis
Image analysis was conducted in FIJI. A 5 pixel-wide line was drawn along sections of the brush border of the int2-4 cells, and the average intensity was measured. All images were corrected for background fluorescence by measuring an area outside of the animal and subtracting this value from the absolute measured fluorescence value.
Statistics
All statistical analyses were performed using GraphPad Prism (10.4.1). The sample sizes, statistical test used, and p values are indicated in the Figure and legend. No statistical method was used to pre-determine sample sizes. No samples or animals were excluded from analysis. The experiments were not randomised, and the investigators were not blinded to allocation during experiments and outcome assessment. All presented graphs were made using GraphPad Prism and Adobe Illustrator. All tests were two-tailed. All data were treated as non-normally distributed, and a Mann-Whitney test was used for all comparisons.
Data availability
All data supporting the findings of this study are available within the paper. Raw microscopy image files are available from the corresponding author upon reasonable request. C. elegans strains are available upon reasonable request.
","reagents":"Strain | Genotype | Source |
|---|---|---|
wild type | CGC | |
this study | ||
this study | ||
Plasmid | Genotype | Description |
pSRG103 | pBSK::Dendra2 | |
pSRG104 | pBSK::mKikGR | |
Oligo | Sequence (5'-3') | Description |
nrfl-1 crRNA | CCTTAACGAGAAGTATCAAT | crRNA targeting nrfl-1; used for both knock-ins |
Forward RT nrfl-1::Dendra2 | ttgtagGCACGAGATGAGCCTTAACGAGAAGTATCAATTaGTaAGtAAtATGGGCGGTGGGGGAATGAACACTCCGGGGATCAATCTG | Forward primer for amplifying the nrfl-1::Dendra2 repair template (RT) |
Reverse RT nrfl-1::Dendra2 | aatagaagaaaataagaagaagttgcaaaagaTTACCAGACTTGGGATGGGAGTG | Reverse primer for amplifying the nrfl-1::Dendra2 repair template (RT) |
Forward RT nrfl-1::mKikGR | ttgtagGCACGAGATGAGCCTTAACGAGAAGTATCAATTaGTaAGtAatATGGGCGGTGGGGGAATGTCGGTGATCACTTCGGAAATG | Forward primer for amplifying the nrfl-1::mKikGR repair template (RT) |
Reverse RT nrfl-1::mKikGR | AatagaagaaaataagaagaagttgcaaaagaTTATGCCTCGAATTCGTACTTAGCTCC | Reverse primer for amplifying the nrfl-1::mKikGR repair template (RT) |
Forward (genotyping) | CCATTGAGCAATGGTTCCAGC | PCR amplification and Sanger sequencing of knock-in alleles; used for both knock-ins |
Reverse (genotyping) | cggtgtaagtaaagaatattgcacaacc | PCR amplification and Sanger sequencing of knock-in alleles; used for both knock-ins |
Photoconvertible fluorophores are a valuable tool for studying dynamic cellular processes, such as protein turnover and mobility, and for tracking cell lineages (Nemet et al., 2015). Unlike conventional fluorophores such as GFP, photoconvertible fluorophores can be irreversibly converted from one colour state to another upon illumination with a specific wavelength (Wiedenmann et al., 2004; Lešková et al., 2019). Multiple photoconvertible fluorophores have been developed over the past decades, including EosFP, Dendra, Kaede, and KikGR (Wiedenmann et al., 2004; Tsutsui et al., 2005; Gurskaya et al., 2006; Habuchi et al., 2008). As photoconvertible fluorophores can vary in conversion rate, convertible fraction, photostability, and brightness, comparing different variants can help us identify the most suitable fluorophore for a given application.
In the nematode Caenorhabditis elegans, Dendra2 and mKikGR have been used successfully (Hamer et al., 2010; So et al., 2024). Both are green-to-red photoconvertible fluorophores that convert upon illumination with UV (100-400 nm) or violet light (405 nm) (Tsutsui et al., 2005; Gurskaya et al., 2006; Habuchi et al., 2008). Previous data indicate that mKikGR has a high photoconversion rate and improved photostability over other photoconvertible proteins, which helps to reduce negative effects from phototoxicity (Habuchi et al., 2008; Turkowyd et al., 2017). However, in C. elegans a direct comparison between the mKikGR and Dendra2 photoconvertible fluorophores is lacking. Here, we aimed to directly compare the properties of these two fluorophores in vivo to determine their suitability for measuring protein turnover.
To determine the in vivo behaviour of Dendra2 and mKikGR in C. elegans, we generated endogenous CRISPR/Cas9-mediated fusions to NRFL-1, an abundant apical adapter protein that links the Ezrin/Radixin/Moesin ortholog ERM-1 to various other proteins (Figure 1A, Sepers et al., 2022). High expression levels and low turnover rates make NRFL-1 an ideal candidate to measure and compare photoconversion rates, convertible fraction, photostability, and brightness.
We first compared the kinetics of green-to-red photoconversion by exposing L2 larvae to repeated 1 second pulses of a 405 nm laser, interspersed with imaging of green and red fluorescence for 100 ms each. mKikGR converted from green to red faster than Dendra2 (Figure 1B, C). After two 1 second pulses of 405 nm laser exposure, green mKikGR levels decreased to less than 5% of initial levels, whereas Dendra2 required at least 8 consecutive 1 second pulses of 405 nm laser exposure to reach a comparable reduction (Figure 1B, C). The maximum fraction converted was significantly higher for mKikGR (96.3% for Dendra2 vs. 97.5% for mKikGR, P = 0.0012), although the absolute difference was modest (Figure 1D).
Next, we compared the fluorescence intensity of NRFL-1 tagged with Dendra2 or mKikGR. We measured a higher fluorescence intensity for Dendra2, particularly in the green state, where its signal was approximately 3.5-fold higher than that of mKikGR (Figure 1E). This higher brightness may make Dendra2 advantageous for visualising low-abundance proteins. However, we cannot exclude the possibility that the two fusion proteins are expressed at different levels.
To test the photostability of Dendra2 and mKikGR, we performed an initial photoconversion (2 and 5 seconds of 405 nm light for NRFL-1::mKikGR and NRFL-1::Dendra2 respectively) followed by imaging of the red fluorescent channel at 5 second intervals (561 nm, 100 ms exposures). Additionally, we tested the effect of exposing animals to either 100 ms pulses of 488 nm (blue) light (mimicking imaging of a green fluorophore) or 1 second pulses of 405 nm light in between the image acquisition (Figure 1F). In all conditions, we measured remaining red fluorescence intensity after 3 seconds total exposure time to 561 nm (green) light.
With post-conversion exposure to 561 nm light only, 88% of the red Dendra2 signal remained after 3 second total exposure, compared with only 53% for mKikGR. Interestingly, the additional exposures to 405 nm or 488 nm strongly affected the results. Exposure to 405 nm light caused a decrease in average red Dendra2 intensity from 0.88 to 0.07 a.u. (Figure 1G). Thus, Dendra2 photostability is dependent on the illumination wavelength, and reduced by exposure to 405 nm light. mKikGR was much less affected by exposure to 405 nm light. Surprisingly, however, mKikGR was more photostable when exposed to 488 nm pulses in addition to the 561 nm pulses (Figure 1G). One possibility is that red mKikGR enters a dark state upon exposure to 561 nm light, which is reversed by exposure to 488 nm light. This hypothesis is based on the observation that red EosFP switches to a dark state upon 561 nm light illumination, which can be reversed with either 405 or 488 nm light exposure (Nienhaus & Nienhaus, 2021; Wulffelé et al., 2025).
The presence of dark states may also explain a second observation we made during our analyses. We found that illumination with a 488 nm laser to focus the microscope resulted in a rapid decline in green signal intensity for both Dendra2 and mKikGR. This decrease might be attributable to conversion to reversible dark green states as opposed to bleaching, based on in-depth analyses of conformational states in the mechanistically related EosFP family and Dendra2 (De Zitter et al., 2019; De Zitter et al., 2020; Tao et al., 2020; Nienhaus & Nienhaus, 2021; Wulffelé et al., 2025). To test this, we exposed NRFL-1::Dendra2 and NRFL-1::mKikGR animals to a brief (100 ms) pulse of 405 nm light following an initial period of exposure to 488 nm light. If the loss of green intensity were due to bleaching, the 405 nm pulse would be expected to further decrease green signal due to green-to-red conversion. If, however, the loss of green intensity were due to conversion to a dark state, the 405 nm pulse would be expected to shift a portion of the protein back to the green state, in addition to the green-to-red conversion, potentially resulting in a net increase in green signal. We observed a partial recovery of green signal, consistent with the hypothesis that the decrease in green signal upon 488 nm light exposure is due to conversion to a dark conformational state (Figure 1H).
Finally, we examined whether mKikGR can be used for long-term tracking of NRFL-1 protein turnover in the intestine. We exposed L2 larvae to the 405 nm LED light source of a fluorescent binocular microscope for 10 seconds and imaged at specific timepoints thereafter. Red fluorescence corresponds to the pool of NRFL-1 present at photoconversion, whereas green fluorescence indicates newly synthesised protein. Red signal decreased by ~85% after 24 h, suggesting that protein turnover of NRFL-1 takes around 24 hours (Figure 1I). This observation is consistent with the slow turnover rate of NRFL-1 at the apical domain previously measured by fluorescence recovery after photobleaching (FRAP) (Sepers et al., 2022) and demonstrates that mKikGR is suitable for the long-term tracking of protein turnover.
In summary, we compared the in vivo properties of Dendra2 and mKikGR in C. elegans using endogenous NRFL-1 fusions, and showed that mKikGR enables tracking of protein turnover over long periods of time. mKikGR has a higher photoconversion rate than Dendra2, but is less bright, particularly in the green state. Under imaging conditions combining a brief 405 nm exposure for photoconversion with subsequent red and green state imaging, we observed no difference in photobleaching between Dendra2 and mKikGR. Finally, we observed behaviour consistent with reversible dark green conformational states for mKikGR and Dendra2 under 488 nm illumination. This effect was stronger for mKikGR, making it more difficult to use when green fluorescence is essential to focus on the sample, or where obtaining pre-conversion images is essential. Ultimately, neither fluorophore consistently outperformed the other, and both are suitable for photoconversion studies in C. elegans.
","references":[{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 4052.","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"De Zitter E, Thedie D, Monkemoller V, Hugelier S, Beaudouin J, Adam V, et al., Bourgeois D. 2019. Mechanistic investigation of mEos4b reveals a strategy to reduce track. Nature Methods. 16: 707-710. 4020.","pubmedId":"","doi":"10.1038/s41592-019-0462-3"},{"reference":"De Zitter E, Ridard J, Thedie D, Adam V, Levy B, Byrdin M, et al., Bourgeois D. 2020. Mechanistic Investigations of Green mEos4b Reveal a Dynamic Long-Lived. Journal of the American Chemical Society. 142: 10978-10988. 4022.","pubmedId":"","doi":"10.1021/jacs.0c01880"},{"reference":"Frokjaer Jensen C, Jain N, Hansen L, Davis MW, Li Y, Zhao D, et al., Fire AZ. 2016. An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silenc. Cell. 166: 343-357. 4024.","pubmedId":"","doi":"10.1016/j.cell.2016.05.072"},{"reference":"Ghanta KS, Ishidate T, Mello CC. 2021. Microinjection for precision genome editing in Caenorhabditis elegans. STAR protocols. 2: 100748. 4026.","pubmedId":"","doi":"10.1016/j.xpro.2021.100748"},{"reference":"Gurskaya NG, Verkhusha VV, Shcheglov AS, Staroverov DB, Chepurnykh TV, Fradkov AF, Lukyanov S, Lukyanov KA. 2006. Engineering of a monomeric green-to-red photoactivatable fluorescent p. Nature Biotechnology. 24: 461-465. 4028.","pubmedId":"","doi":"10.1038/nbt1191"},{"reference":"Habuchi S, Tsutsui H, Kochaniak AB, Miyawaki A, Oijen AM. 2008. mKikGR, a monomeric photoswitchable fluorescent protein. PloS One. 3: e3944. 4030.","pubmedId":"","doi":"10.1371/journal.pone.0003944"},{"reference":"Hamer G, Matilainen O, Holmberg CI. 2010. A photoconvertible reporter of the ubiquitin-proteasome system in vivo. Nature Methods. 7: 473-478. 4032.","pubmedId":"","doi":"10.1038/nmeth.1460"},{"reference":"Leskova A, Kusa Z, Labajova M, Krausko M, Jasik J. 2019. The Photoconvertible Fluorescent Protein Dendra2 Tag as a Tool to Inve. Methods in Molecular Biology. 1992: 201-214. 4034.","pubmedId":"","doi":"10.1007/978-1-4939-9469-4_13"},{"reference":"Nemet I, Ropelewski P, Imanishi Y. 2015. Applications of phototransformable fluorescent proteins for tracking t. Photochemical & Photobiological Sciences: Official Journal of the Euro. 14: 1787-1806. 4036.","pubmedId":"","doi":"10.1039/c5pp00174a"},{"reference":"Nienhaus K, Nienhaus GU. 2021. Fluorescent proteins of the EosFP clade: intriguing marker tools with. RSC chemical biology. 2: 796-814. 4038.","pubmedId":"","doi":"10.1039/d1cb00014d"},{"reference":"Sepers JJ, Ramalho JJ, Kroll JR, Schmidt R, Boxem M. 2022. ERM-1 Phosphorylation and NRFL-1 Redundantly Control Lumen Formation i. Frontiers in Cell and Developmental Biology. 10: 769862. 1352.","pubmedId":"","doi":"10.3389/fcell.2022.769862"},{"reference":"So S, Asakawa M, Sawa H. 2024. Distinct functions of three Wnt proteins control mirror-symmetric orga. eLife. 13: e103035. 4040.","pubmedId":"","doi":"10.7554/eLife.103035"},{"reference":"Sternberg PW, Van Auken K, Wang Q, Wright A, Yook K, Zarowiecki M, et al., Stein L. 2024. WormBase 2024: status and transitioning to Alliance infrastructure. Genetics. 227: iyae050. 3606.","pubmedId":"","doi":"10.1093/genetics/iyae050"},{"reference":"Tao A, Zhang R, Yuan J. 2020. Characterization of Photophysical Properties of Photoactivatable Fluor. The Journal of Physical Chemistry. B. 124: 1892-1897. 4042.","pubmedId":"","doi":"10.1021/acs.jpcb.9b11028"},{"reference":"Tsutsui H, Karasawa S, Shimizu H, Nukina N, Miyawaki A. 2005. Semi-rational engineering of a coral fluorescent protein into an effic. EMBO reports. 6: 233-238. 4044.","pubmedId":"","doi":"10.1038/sj.embor.7400361"},{"reference":"Turkowyd B, Balinovic A, Virant D, Carnero HGG, Caldana F, Endesfelder M, Bourgeois D, Endesfelder U. 2017. A General Mechanism of Photoconversion of Green-to-Red Fluorescent Pro. Angewandte Chemie. 56: 11634-11639. 4046.","pubmedId":"","doi":"10.1002/anie.201702870"},{"reference":"Wiedenmann J, Ivanchenko S, Oswald F, Schmitt F, Rocker C, Salih A, Spindler KD, Nienhaus GU. 2004. EosFP, a fluorescent marker protein with UV-inducible green-to-red flu. Proceedings of the National Academy of Sciences of the United States o. 101: 15905-15910. 4048.","pubmedId":"","doi":"10.1073/pnas.0403668101"},{"reference":"Wulffele J, Maity A, Ayala I, Gambarelli S, Brutscher B, Bourgeois D. 2025. Light-Induced Conformational Heterogeneity Induces Positive Photoswitc. Journal of the American Chemical Society. 147: 10357-10368. 4050.","pubmedId":"","doi":"10.1021/jacs.4c17311"}],"title":"Comparative assessment of Dendra2 and mKikGR for in vivo analysis of protein turnover in Caenorhabditis elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"431f5619-56b7-4592-93a4-3da8e8609e08","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}