For Macharios MM, Hernandez YD, Breen PC, Dowen RH. 2025. Partial loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans. microPublication Biology. 10.17912/micropub.biology.001789, the authors have discovered genotyping anomalies for the vit-2(ok3211) allele used in their publication. The discovery impacts the genotype of two strains used in their study. The authors requested corrections to the article to update the genotypes of the strains used, and to rephrase the phenotypes reported in the context of the partial loss of vitellogenin function. The corrections made to the article are as follows:
Title
Original: \"Loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans\"
Corrected: \"Partial loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans\"
Abstract
Original: \"Using Caenorhabditis elegans, we tested whether vitellogenesis, or the deposition of lipid-rich yolk into oocytes, is required for reproductive output and metabolic balance by creating a strain lacking all six vitellogenin genes (vit-1-6).\"
Corrected: \"Using Caenorhabditis elegans, we tested whether vitellogenesis, or the deposition of lipid-rich yolk into oocytes, is required for reproductive output and metabolic balance by creating a strain lacking five of the six vitellogenin genes (vit-1/3/4/5/6).\"
Original: \"However, progeny survival during L1 starvation was impaired in vit-1-6 animals.\"
Corrected: \"However, progeny survival during L1 starvation was impaired in vit-1/3/4/5/6 animals.\"
Figure Title
Original: “Creation and characterization of a strain carrying mutations in all six vitellogenin” genes
Corrected: “Creation and characterization of a strain carrying mutations in five of the six vitellogenin genes”
Figure Legend
Original: “The vit-3-6 mutations were introduced into the vit-2(ok3211) vit-1(ok2616) double mutant to generate the vit-1-6 sextuple mutant.”
Corrected: “The vit-3-6 mutations were introduced into the vit-1(ok2616) mutant to generate the vit-1/3/4/5/6 quintuple mutant.”
Original: “(B) An SDS-PAGE gel containing protein lysates from wild-type, rme-2(b1008), vit-2(ok3211) vit-1(ok2616), and vit-1-6 animals (25 individuals per lane) stained with Coomassie blue R-250.”
Corrected: “(B) An SDS-PAGE gel containing protein lysates from wild-type, rme-2(b1008), vit-2(ok2616) vit-1(ok3211), and vit-1/3/4/5/6 animals (25 individuals per lane) stained with Coomassie blue R-250.”
Original: “(D) Brood size measurements for wild-type, rme-2(b1008), vit-2(ok3211) vit-1(ok2616), and vit-1-6 animals.”
Corrected: “(D) Brood size measurements for wild-type, rme-2(b1008), vit-2(ok2616) vit-1(ok3211), and vit-1/3/4/5/6 animals.”
Description
Original: “To further understand the physiological consequence of total loss of vitellogenin protein, we generated a novel strain that contains loss-of-function mutations in all six vitellogenin genes (vit-1-6).”
Corrected: “To further understand the physiological consequence of partial loss of vitellogenin protein, we generated a novel strain that contains loss-of-function mutations in five of the six vitellogenin genes (vit-1/3/4/5/6).”
Original: “These nonsense mutations were introduced into the vit-2(ok3211) vit-1(ok2616) double mutant, yielding the vit-1-5 mutant.”
Corrected: “These nonsense mutations were introduced into the vit-1(ok2616) mutant, yielding the vit-1/3/4/5 mutant.”
Original: “After verifying the quintuple mutant strain by genotyping and Sanger sequencing of each locus, we engineered a premature stop codon mutation into the vit-6 locus via CRISPR/Cas9 (Figure 1A), thereby generating the vit-1-6 mutant.”
Corrected: “After verifying the quadruple mutant strain by genotyping and Sanger sequencing of each locus, we engineered a premature stop codon mutation into the vit-6 locus via CRISPR/Cas9 (Figure 1A), thereby generating the vit-1/3/4/5/6 quintuple mutant.
Original: “To validate that our loss-of-function alleles impaired VIT protein production, we stained SDS-PAGE gels containing protein lysates from wild-type animals, the rme-2(b1008) mutant, the vit-2 vit-1 double mutant, and the vit-1-6 sextuple mutant with Coomassie blue to visualize the highly abundant yolk proteins (Figure 1B).”
Corrected: “To validate that our loss-of-function alleles reduced VIT protein production, we stained SDS-PAGE gels containing protein lysates from wild-type animals, the rme-2(b1008) mutant, the vit-2 vit-1 double mutant, and the vit-1/3/4/5/6 quintuple mutant with Coomassie blue to visualize the highly abundant yolk proteins (Figure 1B).”
Original: “In contrast, the vit-1-6 sextuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B).”
Corrected: “In contrast, the vit-1/3/4/5/6 quintuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B).”
Original: “While we are confident that the vit-1-6 mutations severely decrease yolk production, we are unable to eliminate the possibility that some VIT protein is synthesized in these animals due to stop codon readthrough.”
Corrected: “While we are confident that the vit-1/3/4/5/6 mutations severely decrease yolk production, we predict that synthesis of YP170B, encoded by the vit-2 gene, remains unaffected in this strain. Moreover, we are unable to eliminate the possibility that some VIT-3/4/5/6 protein is synthesized in these animals due to stop codon readthrough.”
Original: “Given that yolk is responsible for the deposition of lipids into the mature oocyte, we hypothesized that loss of the vit genes would result in lower amounts of embryonic lipids.”
Corrected: “Given that yolk is responsible for the deposition of lipids into the mature oocyte, we hypothesized that partial loss of the vit genes would result in lower amounts of embryonic lipids.”
Original: “Notably, we only found an average reduction of 32% and 21% in Nile Red staining for the vit-1-6 and the rme-2 mutant, respectively, suggesting that additional mechanisms of lipid deposition or de novo synthesis compensate for loss of vitellogenesis.”
Corrected: ” Notably, we only found an average reduction of 32% and 21% in Nile Red staining for the vit-1/3/4/5/6 and the rme-2 mutant, respectively, suggesting that additional mechanisms of lipid deposition or de novo synthesis compensate for loss of vitellogenesis.
Original: “Therefore, we measured the brood size of the vit-2 vit-1 double mutant and the vit-1-6 sextuple mutant and compared them to the broods produced by wild-type and rme-2 animals (Figure 1D).”
Corrected: “Therefore, we measured the brood size of the vit-2 vit-1 double mutant and the vit-1/3/4/5/6 quintuple mutant and compared them to the broods produced by wild-type and rme-2 animals (Figure 1D).”
Original: “Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009).”
Corrected: ”Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009; Grant and Hirsh 1999).”
Original: “Indeed, the vit-1-6 mutant exhibited lower L1 survival (54%) compared to wild-type (91%) at day 10 of starvation, which persisted to day 15 (Figure 1E).”
Corrected: “Indeed, the vit-1/3/4/5/6 mutant exhibited lower L1 survival (54%) compared to wild-type (91%) at day 10 of starvation, which persisted to day 15 (Figure 1E).”
Original: “The vit-1-6 survival phenotype was more severe than that of the vit-2 vit-1 double mutant; however, no mutant reached the levels of rme-2 mutant, which had a mean survival of 5% by day 10 and no surviving progeny by day 15 (Figure 1E).”
Corrected: “The vit-1/3/4/5/6 survival phenotype was more severe than that of the vit-2 vit-1 double mutant; however, no mutant reached the levels of rme-2 mutant, which had a mean survival of 5% by day 10 and no surviving progeny by day 15 (Figure 1E).”
Original: “Together, these data indicate that loss of yolk provisioning, conferred by either mutation of the six vit genes or rme-2, impairs L1 starvation survival.”
Corrected: “Together, these data indicate that reduced yolk provisioning, conferred by either mutation of the vit-1/3/4/5/6 genes or rme-2, impairs L1 starvation survival.”
Original: “It is surprising that the vit-1-6 mutant does not closely phenocopy the rme-2 mutant, as both mutations result in failure to provision yolk to the offspring.”
Corrected: “It is surprising that the vit-1/3/4/5/6 mutant does not closely phenocopy the rme-2 mutant, as both mutants display a deficit in yolk provisioning to the offspring.”
Original: “The dramatic difference in brood size can perhaps be attributed to a defect in the spermatheca valve leading to oocyte damage in the rme-2 mutant (Chi and Reinke 2009); however, an explanation for why the rme-2 mutant displays more severe L1 survival phenotypes compared to the vit-1-6 mutant requires additional studies.”
Corrected: “The dramatic difference in brood size can perhaps be accredited to a defect in the spermatheca valve leading to oocyte damage in the rme-2 mutant (Chi and Reinke 2009); however, an explanation for why the rme-2 mutant displays more severe L1 survival phenotypes compared to the vit-1/3/4/5/6 mutant requires additional studies.”
Original: “The vit-1-6 mutant strain provides a useful avenue to explore the metabolic dysfunction in vitellogenin-depleted animals.”
Corrected: “The vit-1/3/4/5/6 mutant strain provides a useful avenue to explore the metabolic dysfunction in vitellogenin-depleted animals.”
Original: “Using Nile Red staining, we found that upon loss of the vitellogenin proteins, embryos still have a substantial amount of lipids, suggesting that multiple lipid synthesis pathways contribute to maternal nutrient provisioning.”
Corrected: “Using Nile Red staining, we found that upon reduction of vitellogenin protein, embryos still have a substantial amount of lipids, suggesting that multiple lipid synthesis pathways contribute to maternal nutrient provisioning.”
Original: “One alternative mechanism for maternal deposition of lipids into the C. elegans germline is through the delivery of malonyl-CoA via gap junctions.”
Corrected: “It is possible that VIT-2 alone is sufficient to deliver lipids to oocytes in the vit-1/3/4/5/6 mutant via the established vitellogenesis pathway. However, an alternative mechanism for maternal deposition of lipids into the C. elegans germline is through the delivery of malonyl-CoA via gap junctions.”
Original: “Perhaps this pathway is heavily utilized when yolk protein expression or function is impaired, as in the vit-1-6 or rme-2 mutants.”
Corrected: “Perhaps this pathway is heavily utilized when yolk protein expression is reduced, as in the vit-1/3/4/5/6 or rme-2 mutants.”
Original: “Here, we used CRISPR-Cas9 genome editing to generate a novel mutant strain containing nonsense mutations in the vit-3, vit-4, vit-5, and vit-6 genes, which were combined with the previously established loss-of-function mutations vit-1(ok2616) and vit-2(ok3211), to yield the sextuple vit-1-6 mutant.”
Corrected: “Here, we used CRISPR-Cas9 genome editing to generate a novel mutant strain containing nonsense mutations in the vit-3, vit-4, vit-5, and vit-6 genes, which were combined with the previously established vit-1(ok2616) loss-of-function mutation, to yield the quintuple vit-1/3/4/5/6 mutant.”
Original: “Our results indicate that depletion of all six vitellogenin proteins does not confer an abnormal brood size, but rather, the progeny exhibit a reduction in fitness during L1 starvation.”
Corrected: “Our results indicate that depletion of five of the six vitellogenin proteins does not confer an abnormal brood size, but rather, the progeny exhibit a reduction in fitness during L1 starvation.”
Methods
Original: “The sextuple mutant vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X was generated using CRISPR/Cas9 genomic editing.”
Corrected: “The quintuple mutant vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-1(ok2616) X was generated using CRISPR/Cas9 genomic editing.”
Original: “The Cas9::crRNA:tracrRNA complexes, as well as the ssODN repair template, were microinjected into the germline of DLS882 to generate DLS976 as previously described (Ghanta and Mello 2020).”
Corrected: “The Cas9::crRNA:tracrRNA complexes, as well as the ssODN repair template, were microinjected into the germline of vit-1(ok2616) animals to generate DLS976 as previously described (Ghanta and Mello 2020).”
Reagents
Original:
Genotyping:
Alleles | Primer Sequences | Expected Band Sizes (bp) |
vit-1(ok2616) | For: AGCGTGAGCTCAAGGAGAAG | WT: 3325 |
vit-2(ok3211) | For: ATGGAGCACGCTCTTGCTAT | WT: 1378 |
vit-3(rhd320) | For: TCCGCTTTTTGCAAAGTATC | - EcoRI: 845 |
vit-4(rhd321) | For: TACTTTCAGGTCTCTGGACC | - EcoRI: 599 |
vit-5(rhd322) | For: CAGCACACAAGTTTTCAGGT | - EcoRI: 361 |
vit-6(rhd332) | For: CGCACCCTCGAAGGAGAATG | - EcoRI: 820 |
Corrected:
Primers
Gene | Primer Pair | Annealing Temp (ºC) | Expected Band Sizes (bps) |
vit-1(ok2616) | For: ATCAGTTGTCCGCGGAATTG | 59 | WT: 2399 |
vit-1(ok2616) | For: CATCCTCCCAGTCGATACCC | 59 | WT: 1445 |
vit-2(ok3211) | For: TCACATGGAAAACGAGGACA | 59 | WT: 1321 |
vit-3(rhd320) | For: TCCGCTTTTTGCAAAGTATC | 56 | - EcoRI: 845 |
vit-4(rhd321) | For: TACTTTCAGGTCTCTGGACC | 57 | - EcoRI: 599 |
vit-5(rhd322) | For: CAGCACACAAGTTTTCAGGT | 56 | - EcoRI: 361 |
vit-6(rhd332) | For: CGCACCCTCGAAGGAGAATG | 59 | - EcoRI: 820 |
Original:
CRISPR Edits
Gene | crRNA Sequence | ssODN Repair Sequence |
vit-3, vit-4, vit-5 | ACUUGUCAUUGAAACCACAU | GTTCAACTTGTCATTGAAACCGAATTCTAAG TGGCTGGAACCAAGAACACCATTCAACAC |
vit-6 | UCUACAACCAGGAAUCCGAA | CCGAGCTTGTCTACAACCAGGAATTCGAATA GGCTGAGCAACAATGGGCTCAAACTGGAG |
Corrected:
CRISPR
Gene(s) | crRNA | ssODN |
vit-3, vit-4, vit-5 | ACTTGTCATTGAAACCGAAT | GTTCAACTTGTCATTGAAACCGAATTCTAA GTGGCTGGAACCAAGAACACCATTCAACAC |
vit-6 | TCTACAACCAGGAATTCGAA | CCGAGCTTGTCTACAACCAGGAATTCGAAT AGGCTGAGCAACAATGGGCTCAAACTGGAG |
Original:
Strains
Strain Name | Genotype | Available From |
N2 | Wild-type | CGC |
DH1390 | rme-2(b1008) IV | CGC |
RB1982 | vit-1(ok2616) X | CGC |
RB2365 | vit-2(ok3211) X | CGC |
DLS882 | vit-2(ok3211) vit-1(ok2616) X | Upon request |
DLS976 | vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X | Upon request |
DLS1004 | vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X | Upon request |
Corrected:
Strains
Strain | Genotype | Available From |
N2 | Wild-type | CGC |
DH1390 | rme-2(b1008) IV | CGC |
RB1982 | vit-1(ok2616) X | CGC |
RB2365 | vit-2(ok3211) X | CGC |
DLS882 | vit-2(ok3211) vit-1(ok2616) X | Upon request |
DLS976 | vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-1(ok2616) X | Upon request |
DLS1004 | vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-1(ok2616) X | Upon request |
Dear Dr. Robert H. Dowen,
Your article \"Loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans\" has been accepted, with minor modifications. Please find the reviewer's response below.
We kindly ask you to address each point and summarize your changes in line with the reviewer's response in the 'Comments to Editor' section on the platform. In order to expedite the processing of your revised manuscript, please be as specific as possible in your responses.
Best regards,
The microPublication Editorial Team
Reviewer's response:
This is a well-conducted and well-written report of a valuable new resource to the field: a mutant lacking all genes encoding yolk proteins, and the authors show that despite this, the animals maintain significant offspring numbers.
Only a few minor suggestions:
- Figure 1 caption: please remove line break and spacing between caption title and caption text
- Figure 1E does not show survival rate, but survival itself. Please adjust in caption text. Also, a more precise/appropriate statistical test such as Cox proportional hazards would be advisable, over the somewhat vaguely formulated one-way ANOVA \"based on the area under the curve\".
- Please use consistent naming of the double mutant: vit-2 vit-1 is indeed correct, please adjust uses of vit-1 vit-2 to the correct order.
- Both the (first-paragraph) initial Perez and Lehner citations are somewhat misused in my opinion, because this information was known long before. It would be more correct to give credit to older work, e.g. by Kimble/Sharrock/Grant/Hirsh.
- \"To date, the vit genes have only been studied individually or tested in tandem using double loss-of-function mutants or RNAi.\" misses citations.
- \"After verifying the quintuple mutant strain by genotyping and Sanger sequencing of each locus\": vit 3-5 are highly similar and located closely together on the chromosome. Was the entire region sequenced for verification of the edits as well as their background, in that locus? It would be valuable to describe with a little more detail how well the strain has been characterized (could be added to the methods).
- vit-2 vit-1 would be expected to have increased YP115 and YP88 according to Sornda et al. 2019, or wt levels according to Geens et al. 2023. Here lower levels are reported - how to make sense of that?
- Please correctly cite Grant & Hirsh 1999 for the original observation of reduced brood size of rme-2, instead of Dowen 2019.
- \"Furthermore, our data suggest that RME-2 may serve additional roles in the germline, which could include functioning in spermathecal valve dilation and ovulation (Chi and Reinke 2009).\" Please rephrase; the data presented here do fit with the work of Chi and Reinke, but they do not suffice to suggest additional roles in the germline (which is based on literature, not on the current experimental data).
- L1 survival: Geens et al. 2023 suggested that vit-6 does not contribute much to this, and it would mainly depend on YP170 proteins. Would you agree?
","decision":"revise","submitted":true,"abstract":"Organismal homeostasis relies on balancing cellular metabolic decisions with environmental conditions, especially during reproduction. Using Caenorhabditis elegans, we tested whether vitellogenesis, or the deposition of lipid-rich yolk into oocytes, is required for reproductive output and metabolic balance by creating a strain lacking all six vitellogenin genes (vit-1-6). This mutant produced embryos with reduced lipid content compared to wild-type, but the total brood size remained unaffected, unlike the rme-2 mutant, which lacks the yolk receptor. However, progeny survival during L1 starvation was impaired in vit-1-6 animals. This strain offers a new model for studying how vitellogenesis impacts reproductive and organismal fitness.
","acknowledgements":"The authors would like to thank the Caenorhabditis Genetics Center (CGC), supported by the NIH Office of Research Infrastructure Programs (P40 OD010440), for providing essential strains for this study. We also extend our sincere thanks to Dr. Gidi Shemer, the Department of Biology, and the Office of Undergraduate Research at UNC Chapel Hill for their continued commitment to and support of undergraduate research.
","authors":[{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing"],"email":"macha@email.unc.edu","firstName":"Monica M. ","lastName":"Macharios","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-5150-7089"},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["investigation"],"email":"yasminee@email.unc.edu","firstName":"Yasmine D. ","lastName":"Hernandez","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["supervision","investigation","writing_reviewEditing"],"email":"petbreen@email.unc.edu","firstName":"Peter C.","lastName":"Breen","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["conceptualization","writing_reviewEditing","supervision","fundingAcquisition","project","dataCuration"],"email":"dowen@email.unc.edu","firstName":"Robert H.","lastName":"Dowen","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3421-5192"}],"comments":"","dataTable":null,"disclaimer":true,"funding":"Supported by National Institute of General Medical Sciences grant R35GM137985 to Robert H. Dowen.
","image":{"name":"Figure.png","url":"https://portal.micropublication.org/uploads/551f35bf3108443f2efd1135b7555ccc.png"},"imageCaption":"(A) A schematic illustrating the nonsense mutations introduced into the vit-3, vit-4, vit-5, and vit-6 genes by CRISPR/Cas9 editing. The edits to vit-3, vit-4, and vit-5 were performed simultaneously using a single crRNA that targeted the same sequence in all three genes. The vit-3-6 mutations were introduced into the vit-2(ok3211) vit-1(ok2616) double mutant to generate the vit-1-6 sextuple mutant. (B) An SDS-PAGE gel containing protein lysates from wild-type, rme-2(b1008), vit-2(ok2616) vit-1(ok3211), and vit-1-6 animals (25 individuals per lane) stained with Coomassie blue R-250. The arrows indicate bands corresponding to the major yolk proteins (YP170, YP115, and YP88). (C) Quantification of Nile Red fluorescence in embryos from three independent experiments (mean ± SD; n=50/genotype; ns, not significant, *, P<0.05, **, P<0.01, ***, P<0.001, ****, P<0.0001, one-way ANOVA). (D) Brood size measurements for wild-type, rme-2(b1008), vit-2(ok2616) vit-1(ok3211), and vit-1-6 animals. Eleven individual broods were counted for each genotype (mean ± SD; ns, not significant, **, P<0.01, ****, P<0.0001, one-way ANOVA). (E) A time course of survival rates during L1 starvation (3 independent trials, mean ± SEM reported; P values were calculated based on the area under the curve, one-way ANOVA).
","imageTitle":"Creation and characterization of a strain carrying mutations in all six vitellogenin genes
","laboratory":{"name":"DLS","WBId":""},"methods":"Maintenance and generation of C. elegans strains
Animals were reared at 20°C on agar plates containing Nematode Growth Media (Brenner 1974). Plates were seeded with E. coli OP50 grown overnight in 2xYT at 37°C. The vit-2(ok2616) vit-1(ok3211) double mutant was created by standard genetic crossing. PCR using locus-specific primers and Sanger sequencing were used to ensure that all mutations were homozygous.
CRISPR/Cas9 genome editing
The sextuple mutant vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X was generated using CRISPR/Cas9 genomic editing. First, the T391E/L392F/A393* mutations were simultaneously introduced into the vit-3, vit-4, and vit-5 loci using a single crRNA, with the T391E/L392F mutations creating a novel EcoRI restriction site within each locus, which facilitated validation of the edit by PCR followed by EcoRI digestion. The Cas9::crRNA:tracrRNA complexes, as well as the ssODN repair template, were microinjected into the germline of DLS882 to generate DLS976 as previously described (Ghanta and Mello 2020). Next, the vit-6 locus was edited in DLS976 using the same CRISPR strategy to generate DLS1004 containing the S320F/W322* mutations, which also produce a novel EcoRI restriction site within the vit-6 locus. Sanger sequencing was performed on all CRISPR mutations to confirm proper editing and to verify homozygosity.
Coomassie blue staining
For each genotype, 25 worms (day 2 adults) were harvested into 26 µL of M9 media by picking, snap frozen in liquid nitrogen, and stored at -80ºC. Then, 10 µL of 4X Laemmli sample buffer (Bio-Rad, 1610747) and 4 µL of 1 M Dithiothreitol (DTT) were added to the samples before incubating them at 100°C for 5 minutes. Protein samples were sonicated for 10 minutes using a Bioruptor Pico instrument (Diagenode), incubated at 100°C for an additional 5 minutes, and briefly centrifuged. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was performed using 4–20% precast gels (Bio-Rad, 4568094) and Tris/Glycine/SDS running buffer (Bio-Rad, 1610732). Gels were stained with 0.5% Coomassie brilliant blue R-250 (in 45% ethanol, 9% glacial acetic acid, 45% water) with gentle shaking, destained in a 50% methanol, 10% glacial acetic acid, 40% water solution, and finally rinsed in deionized water for at least 1 hour. Gels were imaged using the ImageQuant LAS 4000 instrument (GE Healthcare) and protein bands were identified based on previously published analyses (Sornda et al., 2019). The experiment was performed three times with similar results.
Nile Red staining
Nile Red staining was performed on embryos harvested by hypochlorite treatment as previously described (Escorcia et al., 2018). Isopropanol-fixed embryos were stained for 2 hours with a freshly prepared Nile Red/isopropanol solution (60 μL of 0.5 mg/mL Nile Red stock in 940 µL of 40% isopropanol). The embryos were immediately washed, mounted on agar pads, and imaged using a 20X objective on a Nikon Ti2 widefield microscope equipped with a Hamamatsu ORCA-Fusion BT camera. For image quantification, average fluorescence intensities (mean gray values) were measured by manually circling the embryos (n=50 per genotype) using Fiji (version 2.14.0/1.54f). No background subtraction was performed due to a lack of background fluorescence. The data were plotted as the mean ± SD, outlier data were removed using default parameters, and a one-way ANOVA followed by a Bonferroni's multiple comparisons correction was performed using Prism 10. The experiment was independently replicated three times.
Brood size assay
Twelve animals per genotype were singled to individual plates each day for five days and allowed to lay embryos. Two days after each transfer, when progeny had grown to the L4 stage, the plate was scored for hatched animals. Any mothers that died prior to the final transfer were censored. The total number of hatched progeny was calculated, the data were plotted as the mean ± SD, and a one-way ANOVA followed by a Bonferroni's multiple comparisons correction was performed using Prism 10.
Starvation assays
Hypochlorite treatment was used to isolate embryos from gravid adults and L1s were synchronized in M9 media by overnight rotation at 20°C. The L1 animals were maintained in 15 mL conical tubes containing M9 media (~8 worms/µL) with rotation at 20°C until scoring. On days one, three, five, ten, and fifteen, 100 worms per genotype were dropped onto unseeded plates and scored for movement. Animals that displayed no movement after 10 seconds were considered dead. The experiment was performed three times. The percentage of animals alive at each time point was plotted as the mean ± SEM using Prism 10. The area under the curve (AUC) was calculated for each replicate and a one-way ANOVA followed by a Bonferroni's multiple comparisons correction was performed to calculate statistical significance.
","reagents":"Genotyping: | ||
Alleles | Primer Sequences | Expected Band Sizes (bp) |
For: AGCGTGAGCTCAAGGAGAAG Rev: AGCTTCGTATCCACGACGAC | WT: 3325 MT: 1528 | |
For: ATGGAGCACGCTCTTGCTAT Rev: TGGGATCTTTCCAGAGATGG | WT: 1378 MT: 525 | |
For: TCCGCTTTTTGCAAAGTATC Rev: TGGTTGACGTGGATCTTGGA | - EcoRI: 845 + EcoRI: 386 & 409 | |
For: TACTTTCAGGTCTCTGGACC Rev: TTTGTCTAGATGCTGGGCGG | - EcoRI: 599 + EcoRI: 342 & 257 | |
For: CAGCACACAAGTTTTCAGGT Rev: GATGCTCTTCTTCTCGAAGT | - EcoRI: 361 + EcoRI: 351 & 10 | |
For: CGCACCCTCGAAGGAGAATG Rev: CAAGAGATGGGTAGCGCATG | - EcoRI: 820 + EcoRI: 405 & 415 | |
CRISPR Edits: | ||
Gene | crRNA Sequence | ssODN Repair Sequence |
ACUUGUCAUUGAAACCACAU | GTTCAACTTGTCATTGAAACCGAATTCTAAGTGGCTGGAACCAAGAACACCATTCAACAC | |
UCUACAACCAGGAAUCCGAA | CCGAGCTTGTCTACAACCAGGAATTCGAATAGGCTGAGCAACAATGGGCTCAAACTGGAG | |
Strains: | ||
Strain Name | Genotype | Available From |
Wild-type | CGC | |
CGC | ||
CGC | ||
CGC | ||
Upon request | ||
vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X | Upon request | |
vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X | Upon request |
Vitellogenesis is the process by which nutrients are provisioned to an animal's progeny in the form of yolk, comprised of lipids and vitellogenin lipoproteins (Perez and Lehner 2019). The nematode C. elegans possesses six vitellogenin-encoding (vit) genes, which produce proteins YP170B, encoded by vit-2, YP170A, encoded by vit-3, vit-4, and vit-5, and YP115 and YP88 formed from the cleaved vit-6 gene product (Perez and Lehner 2019). The vit-1 gene is 82% identical to vit-2 (Perez and Lehner 2019); however, it remains unclear if the mature VIT-1 protein is also 170 kDa. The VIT proteins recruit and transport phospholipids, free fatty acids, and cholesterol in the form of lipoprotein particles from the animal's intestine to the mature oocytes in the gonad (Kimble and Sharrock 1983; Perez and Lehner 2019). Lipoproteins are internalized by oocytes via the RME-2 receptor through receptor-mediated endocytosis (Grant and Hirsh 1999). Together, the vitellogenin proteins, which are functional orthologues of the human low-density lipoprotein ApoB (Baker 1988), are required for proper delivery of yolk to the progeny. To date, the vit genes have only been studied individually or tested in tandem using double loss-of-function mutants or RNAi.
To further understand the physiological consequence of total loss of vitellogenin protein, we generated a novel strain that contains loss-of-function mutations in all six vitellogenin genes (vit-1-6). Taking advantage of the high sequence similarity of the vit-3, vit-4, and vit-5 genes, we simultaneously engineered a premature stop codon into these three vit genes using CRISPR/Cas9 genome editing (Figure 1A). These nonsense mutations were introduced into the vit-1(ok2616) vit-2(ok3211) double mutant, yielding the vit-1-5 mutant. After verifying the quintuple mutant strain by genotyping and Sanger sequencing of each locus, we engineered a premature stop codon mutation into the vit-6 locus via CRISPR/Cas9 (Figure 1A), thereby generating the vit-1-6 mutant.
To validate that our loss-of-function alleles impaired VIT protein production, we stained SDS-PAGE gels containing protein lysates from wild-type animals, the rme-2(b1008) mutant, the vit-1 vit-2 double mutant, and the vit-1-6 sextuple mutant with Coomassie blue to visualize the highly abundant yolk proteins (Figure 1B). Yolk proteins have established molecular weights of 170 kDa (YP170A and YP170B), 115 kDa (YP115), and 88 kDa (YP88) and are easily visualized by Coomassie staining of SDS-PAGE gels (Sharrock 1983). The rme-2(b1008) mutant displayed increased VIT protein levels compared to wild-type, which is expected given that oocytes lacking the RME-2 receptor are unable to clear yolk from the body cavity (Grant and Hirsh 1999). Both the vit-1 vit-2 double mutant and vit-1-6 sextuple mutant displayed severe reductions in VIT protein levels compared to wild-type, with vit-1-6 animals showing the most dramatic reduction in yolk synthesis across the strains we tested (Figure 1B). These results are consistent with previous studies, where animals subjected to vit-5 and/or vit-6 RNAi showed a decrease in the amount of yolk proteins relative to controls when analyzed by Coomassie blue staining (Sornda et al., 2019). While we are confident that the vit-1-6 mutations severely decrease yolk production, we are unable to eliminate the possibility that some VIT protein is synthesized in these animals due to stop codon readthrough.
Given that yolk is responsible for the deposition of lipids into the mature oocyte, we hypothesized that loss of the vit genes would result in lower amounts of embryonic lipids. Using Nile Red to stain neutral lipids and triglycerides, we found that the vit mutant embryos exhibited lower amounts of Nile Red fluorescence relative to wild-type across three independent experiments, indicating that lipid levels were reduced in vit mutant embryos (Figure 1C). We observed a similar phenotype in the rme-2 mutant. Notably, we only found an average reduction of 32% and 21% in Nile Red staining for the vit-1-6 and the rme-2 mutant, respectively, suggesting that additional mechanisms of lipid deposition or de novo synthesis compensate for loss of vitellogenesis.
Despite its role in intergenerational nutrient allocation, it has been previously reported that reduced vitellogenin gene expression does not dramatically alter progeny production (Dowen 2019; Van Rompay et al., 2015). However, animals lacking rme-2 have dramatically reduced brood sizes (Dowen 2019). Therefore, we measured the brood size of the vit-1 vit-2 double mutant and the vit-1-6 sextuple mutant and compared them to the broods produced by wild-type and rme-2 animals (Figure 1D). Intriguingly, the vit mutants produced near wild-type broods while the rme-2 mutant was nearly sterile, suggesting that the brood size defect of rme-2 animals is not solely explained by the lack of yolk protein delivery. These results are consistent with those previously described for other vitellogenesis mutants, such as vrp-1 and ceh-60 (Dowen 2019; Van Rompay et al., 2015). Furthermore, our data suggest that RME-2 may serve additional roles in the germline, which could include functioning in spermathecal valve dilation and ovulation (Chi and Reinke 2009).
Some vitellogenesis mutants have been shown to have deficiencies in maintaining progeny fitness, including a reduced ability to survive starvation at the L1 larval stage (Chotard et al., 2010; Geens et al., 2023; Van Rompay et al., 2015). Consistently, wild-type larvae that receive a lower dose of yolk as embryos have reduced fitness relative to their siblings that receive higher doses (Perez et al., 2017). Thus, we tested whether our vit mutants displayed reduced survival during L1 starvation. Indeed, the vit-1-6 mutant exhibited lower L1 survival (54%) compared to wild-type (91%) at day 10 of starvation, which persisted to day 15 (Figure 1E). The vit-1-6 survival phenotype was more severe than that of the vit-1 vit-2 double mutant; however, no mutant reached the levels of rme-2 mutant, which had a mean survival of 5% by day 10 and no surviving progeny by day 15 (Figure 1E). Together, these data indicate that loss of yolk provisioning, conferred by either mutation of the six vit genes or rme-2, impairs L1 starvation survival.
It is surprising that the vit-1-6 mutant does not closely phenocopy the rme-2 mutant, as both mutations result in failure to provision yolk to the offspring. The dramatic difference in brood size can perhaps be accredited to a defect in the spermatheca valve leading to oocyte damage in the rme-2 mutant (Chi and Reinke 2009); however, an explanation for why the rme-2 mutant displays more severe L1 survival phenotypes compared to the vit-1-6 mutant requires additional studies. One intriguing possibility is that the RME-2 receptor facilitates the uptake of molecules other than yolk. A recent study found that 5-carboxyfluorescein (5-CF), a small membrane-impermeable fluorescent molecule, can be transported from the intestine to the oocyte via RME-2 (Turmel-Couture et al., 2024). While it is possible that 5-CF is transported to the germline within yolk particles, it is also possible that RME-2 mediates the uptake of molecules independent of yolk. Thus, additional research is needed to elucidate the full suite of molecules that can be endocytosed by RME-2 in the oocytes.
The vit-1-6 mutant strain provides a useful avenue to explore the metabolic dysfunction in vitellogenin-depleted animals. Using Nile Red staining, we found that upon loss of the vitellogenin proteins, embryos still have a substantial amount of lipids, suggesting that multiple lipid synthesis pathways contribute to maternal nutrient provisioning. One alternative mechanism for maternal deposition of lipids into the C. elegans germline is through the delivery of malonyl-CoA via gap junctions. Malonyl-CoA is produced in the somatic sheath cells and transported out of the somatic cells by the INX-8/INX-9 hemichannels and into the germline by the INX-14/INX-21 hemichannels (Starich et al., 2020). Malonyl-CoA can then be used in the germline and embryos to fuel fatty acid synthesis via de novo lipogenesis, which is critical for proper embryonic development (Starich et al., 2020). Perhaps this pathway is heavily utilized when yolk protein expression is impaired, as in the vit-1-6 or rme-2 mutants.
Here, we used CRISPR-Cas9 genome editing to generate a novel mutant strain containing nonsense mutations in the vit-3, vit-4, vit-5, and vit-6 genes, which were combined with the previously established loss-of-function mutations vit-1(ok2616) and vit-2(ok3211), to yield the sextuple vit-1-6 mutant. Our results indicate that depletion of all six vitellogenin proteins does not confer an abnormal brood size, but rather, the progeny exhibit a reduction in fitness during L1 starvation. While our well-fed conditions support efficient propagation of this strain in the laboratory, it is likely that these animals would be at a severe disadvantage in the wild where maternal provisioning of lipids is likely crucial for progeny survival during adverse or stressful conditions. This strain will be a useful resource to other research labs interested in investigating the metabolic tradeoffs during development, reproduction, and aging.
","references":[{"reference":"Baker ME. 1988. Is vitellogenin an ancestor of apolipoprotein B-100 of human low-density lipoprotein and human lipoprotein lipase? Biochem J 255(3): 1057-60.
","pubmedId":"3145737","doi":""},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77(1): 71-94.
","pubmedId":"4366476","doi":""},{"reference":"Chi W, Reinke V. 2009. DPL-1 (DP) acts in the germ line to coordinate ovulation and fertilization in C. elegans. Mech Dev 126(5-6): 406-16.
","pubmedId":"19368797","doi":""},{"reference":"Chotard L, Skorobogata O, Sylvain MA, Shrivastava S, Rocheleau CE. 2010. TBC-2 is required for embryonic yolk protein storage and larval survival during L1 diapause in Caenorhabditis elegans. PLoS One 5(12): e15662.
","pubmedId":"21203392","doi":""},{"reference":"Dowen RH. 2019. CEH-60/PBX and UNC-62/MEIS Coordinate a Metabolic Switch that Supports Reproduction in C. elegans. Dev Cell 49(2): 235-250.e7.
","pubmedId":"30956009","doi":""},{"reference":"Escorcia W, Ruter DL, Nhan J, Curran SP. 2018. Quantification of Lipid Abundance and Evaluation of Lipid Distribution in Caenorhabditis elegans by Nile Red and Oil Red O Staining. J Vis Exp(133): 10.3791/57352.
","pubmedId":"29553519","doi":""},{"reference":"Geens E, Van de Walle P, Caroti F, Jelier R, Steuwe C, Schoofs L, Temmerman L. 2023. Yolk-deprived Caenorhabditis elegans secure brood size at the expense of competitive fitness. Life Sci Alliance 6(6): 10.26508/lsa.202201675.
","pubmedId":"37059473","doi":""},{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics 216(3): 643-650.
","pubmedId":"32963112","doi":""},{"reference":"Grant B, Hirsh D. 1999. Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol Biol Cell 10(12): 4311-26.
","pubmedId":"10588660","doi":""},{"reference":"Kimble J, Sharrock WJ. 1983. Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans. Dev Biol 96(1): 189-96.
","pubmedId":"6825952","doi":""},{"reference":"Perez MF, Francesconi M, Hidalgo-Carcedo C, Lehner B. 2017. Maternal age generates phenotypic variation in Caenorhabditis elegans. Nature 552(7683): 106-109.
","pubmedId":"29186117","doi":""},{"reference":"Perez MF, Lehner B. 2019. Vitellogenins - Yolk Gene Function and Regulation in Caenorhabditis elegans. Front Physiol 10: 1067.
","pubmedId":"31551797","doi":""},{"reference":"Sharrock WJ. 1983. Yolk proteins of Caenorhabditis elegans. Dev Biol 96(1): 182-8.
","pubmedId":"6337890","doi":""},{"reference":"Sornda T, Ezcurra M, Kern C, Galimov ER, Au C, de la Guardia Y, Gems D. 2019. Production of YP170 Vitellogenins Promotes Intestinal Senescence in Caenorhabditis elegans. J Gerontol A Biol Sci Med Sci 74(8): 1180-1188.
","pubmedId":"30854561","doi":""},{"reference":"Starich TA, Bai X, Greenstein D. 2020. Gap junctions deliver malonyl-CoA from soma to germline to support embryogenesis in Caenorhabditis elegans. Elife 9: 10.7554/eLife.58619.
","pubmedId":"32735213","doi":""},{"reference":"Turmel-Couture S, Martel PO, Beaulieu L, Lechasseur X, Fotso Dzuna LV, Narbonne P. 2024. Bidirectional transfer of a small membrane-impermeable molecule between the Caenorhabditis elegans intestine and germline. J Biol Chem 300(12): 107963.
","pubmedId":"39510179","doi":""},{"reference":"Van Rompay L, Borghgraef C, Beets I, Caers J, Temmerman L. 2015. New genetic regulators question relevance of abundant yolk protein production in C. elegans. Sci Rep 5: 16381.
","pubmedId":"26553710","doi":""}],"suggestedReviewer":{"name":"Liesbet Temmerman, 0000-0002-1249-3995, liesbet.temmerman@kuleuven.be
Barth Grant, grant@dls.rutgers.edu
","WBId":""},"title":"Loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans
","reviews":[{"reviewer":{"displayName":"Liesbet Temmerman"},"openAcknowledgement":true,"status":{"submitted":true}}]},{"id":"d1f0e953-b191-4542-add5-3f6183580c96","decisionLetter":"Dear Dr. Robert H. Dowen,
We are happy to let you know that your article has been accepted for publication. Congratulations!
Please take a careful look at the production proofs of your article: proof download.
Please make sure there are no typos, errors or omissions in your article, including your title, author names, affiliations, reagents, etc. in addition to your reported results. These are little things that if wrong will still require a separate corrigendum article if they need correction after publication.
Please make any change or approve the current version by following this link.
Please return your corrections within 72 hours. If you are unable to return your corrections within 72 hours, let us know.
Please submit your payment here. If you are unable to submit your payment, require a waiver, or have any questions regarding billing please contact us at billing@micropublication.org.
Your invoice (#001789) can be downloaded here.
Do not hesitate to contact us if you have any questions.
We look forward to publishing your work.
Best wishes,
The microPublication Editorial Team
","decision":"accept","submitted":true,"abstract":"Organismal homeostasis relies on balancing cellular metabolic decisions with environmental conditions, especially during reproduction. Using Caenorhabditis elegans, we tested whether vitellogenesis, or the deposition of lipid-rich yolk into oocytes, is required for reproductive output and metabolic balance by creating a strain lacking all six vitellogenin genes (vit-1-6). This mutant produced embryos with reduced lipid content compared to wild-type, but the total brood size remained unaffected, unlike the rme-2 mutant, which lacks the yolk receptor. However, progeny survival during L1 starvation was impaired in vit-1-6 animals. This strain offers a new model for studying how vitellogenesis impacts reproductive and organismal fitness.
","acknowledgements":"The authors would like to thank the Caenorhabditis Genetics Center (CGC), supported by the NIH Office of Research Infrastructure Programs (P40 OD010440), for providing essential strains for this study. We also extend our sincere thanks to Dr. Gidi Shemer, the Department of Biology, and the Office of Undergraduate Research at UNC Chapel Hill for their continued commitment to and support of undergraduate research.
","authors":[{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing"],"email":"macha@email.unc.edu","firstName":"Monica M. ","lastName":"Macharios","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-5150-7089"},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["investigation"],"email":"yasminee@email.unc.edu","firstName":"Yasmine D. ","lastName":"Hernandez","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["supervision","investigation","writing_reviewEditing"],"email":"petbreen@email.unc.edu","firstName":"Peter C.","lastName":"Breen","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["conceptualization","writing_reviewEditing","supervision","fundingAcquisition","project","dataCuration"],"email":"dowen@email.unc.edu","firstName":"Robert H.","lastName":"Dowen","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3421-5192"}],"comments":"Please find below our response to the Reviewer's comments:
Only a few minor suggestions:
- Figure 1 caption: please remove line break and spacing between caption title and caption text
To our knowledge, we have no control over this formatting. We have entered the caption title and caption text in the appropriate boxes in the submission portal.
- Figure 1E does not show survival rate, but survival itself. Please adjust in caption text. Also, a more precise/appropriate statistical test such as Cox proportional hazards would be advisable, over the somewhat vaguely formulated one-way ANOVA \"based on the area under the curve\".
The term “survival rate” has been replaced with “survival” in the caption text. Also, we have now applied a logrank (Mantel-Cox) test to our survival data based on previously published studies that have similarly tested L1 survival across multiple independent experiments. All curves are now significantly different from the wild-type control. We have described this analysis approach in detail in the methods section and have cited previous studies that have employed this technique. The caption text has also been modified to reflect this change.
- Please use consistent naming of the double mutant: vit-2 vit-1 is indeed correct, please adjust uses of vit-1 vit-2 to the correct order.
All references to the vit-1 vit-2 double mutant in the manuscript are now referred to as “vit-2 vit-1” in the correct order based on their genomic position on chromosome X.
- Both the (first-paragraph) initial Perez and Lehner citations are somewhat misused in my opinion, because this information was known long before. It would be more correct to give credit to older work, e.g. by Kimble/Sharrock/Grant/Hirsh.
We have added several citations to the first paragraph, which have replaced, or have been added to, the Perez and Lehner citation. This includes early work from Kimble, Sharrock, Grant, and Hirsh.
- \"To date, the vit genes have only been studied individually or tested in tandem using double loss-of-function mutants or RNAi.\" misses citations.
We have added several citations that have used this genetic approach and that are relevant to our study.
- \"After verifying the quintuple mutant strain by genotyping and Sanger sequencing of each locus\": vit 3-5 are highly similar and located closely together on the chromosome. Was the entire region sequenced for verification of the edits as well as their background, in that locus? It would be valuable to describe with a little more detail how well the strain has been characterized (could be added to the methods).
We have provided additional genotyping details for the vit-3, vit-4, and vit-5 loci to the methods section: “The vit-3, vit-4, and vit-5 edits were independently verified by PCR using locus-specific primer pairs (each with distinct annealing temperatures) followed by an EcoRI digestion, which yielded a unique set of DNA fragments for each locus.”
- vit-2 vit-1 would be expected to have increased YP115 and YP88 according to Sornda et al. 2019, or wt levels according to Geens et al. 2023. Here lower levels are reported - how to make sense of that?
As the Reviewer points out, Sornda et al. 2019 showed that knockdown of vit-5 increases YP115 and YP88 levels; however, this phenotype was only observed in older adults (days 4-11 of adulthood but not day 1). We assayed day 2 adults, which were also tested in the Geens et al. 2023 paper, and we found little difference in YP115/YP88 levels between wild-type (lane 1) and vit-2 vit-1 animals (lane 3). This was also true in our replicate experiments. Thus, our observations are in line with the Geens paper, where loss of vit-2 vit-1 does not dramatically impact YP115/YP88 levels early in adulthood. We have revised our text to read:
“In contrast, the vit-1-6 sextuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B). These results are consistent with previous studies, where animals subjected to vit-5 and/or vit-6 RNAi showed a decrease in the amount of yolk proteins relative to controls when analyzed by Coomassie blue staining (Geens et al., 2023; Sornda et al., 2019). Notably, the vit-2 vit-1 double mutant showed little impairment in yolk protein synthesis, suggesting that vit-3-6 may compensate for their loss. Furthermore, we did not observe an increase in YP115 or YP88 levels in the vit-2 vit-1 double mutant, which has been previously observed in older adult animals subjected to vit-5 RNAi (Sornda et al., 2019).”
- Please correctly cite Grant & Hirsh 1999 for the original observation of reduced brood size of rme-2, instead of Dowen 2019.
We have added the Grant & Hirsh 1999 citation to the text describing the reduced brood size of rme-2 mutant animals. We have decided to keep the Dowen 2019 citation as well, since progeny production of the rme-2(b1008) mutant was quantified in the 2019 study and produced similar results as shown in this current study.
- \"Furthermore, our data suggest that RME-2 may serve additional roles in the germline, which could include functioning in spermathecal valve dilation and ovulation (Chi and Reinke 2009).\" Please rephrase; the data presented here do fit with the work of Chi and Reinke, but they do not suffice to suggest additional roles in the germline (which is based on literature, not on the current experimental data).
We agree with the reviewer and have clarified this statement in the text: “Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009).”
- L1 survival: Geens et al. 2023 suggested that vit-6 does not contribute much to this, and it would mainly depend on YP170 proteins. Would you agree?
We appreciate the Reviewer’s comments and agree that role of vit-6 in L1 starvation is poorly defined. However, we are unable to comment on the role of vit-6 in L1 starvation survival since we did not test the vit-6 single mutant or compare the vit-2 vit-1 double mutant to the vit-2 vit-1 vit-6 triple mutant. This comparison was not performed because we generated the vit-6 mutation in our existing vit-1-5 mutant via CRISPR editing. Therefore, we have avoided speculating on the specific function of vit-6 in L1 survival in the revised manuscript.
","dataTable":null,"disclaimer":true,"funding":"Supported by National Institute of General Medical Sciences grant R35GM137985 to Robert H. Dowen.
","image":{"name":"Figure_R1.png","url":"https://portal.micropublication.org/uploads/ed3af131ba1444ea3a8c84e0673152fc.png"},"imageCaption":"(A) A schematic illustrating the nonsense mutations introduced into the vit-3, vit-4, vit-5, and vit-6 genes by CRISPR/Cas9 editing. The edits to vit-3, vit-4, and vit-5 were performed simultaneously using a single crRNA that targeted the same sequence in all three genes. The vit-3-6 mutations were introduced into the vit-2(ok3211) vit-1(ok2616) double mutant to generate the vit-1-6 sextuple mutant. (B) An SDS-PAGE gel containing protein lysates from wild-type, rme-2(b1008), vit-2(ok2616) vit-1(ok3211), and vit-1-6 animals (25 individuals per lane) stained with Coomassie blue R-250. The arrows indicate bands corresponding to the major yolk proteins (YP170, YP115, and YP88). (C) Quantification of Nile Red fluorescence in embryos from three independent experiments (mean ± SD; n=50/genotype; ns, not significant, *, P<0.05, **, P<0.01, ***, P<0.001, ****, P<0.0001, one-way ANOVA). (D) Brood size measurements for wild-type, rme-2(b1008), vit-2(ok2616) vit-1(ok3211), and vit-1-6 animals. Eleven individual broods were counted for each genotype (mean ± SD; ns, not significant, **, P<0.01, ****, P<0.0001, one-way ANOVA). (E) A time course of survival during L1 starvation (3 independent trials, mean ± SEM reported; P values were calculated using a Mantel-Cox log-rank test).
","imageTitle":"Creation and characterization of a strain carrying mutations in all six vitellogenin genes
","laboratory":{"name":"DLS","WBId":""},"methods":"Maintenance and generation of C. elegans strains
Animals were reared at 20°C on agar plates containing Nematode Growth Media (Brenner 1974). Plates were seeded with E. coli OP50 grown overnight in 2xYT at 37°C. The vit-2(ok2616) vit-1(ok3211) double mutant was created by standard genetic crossing. PCR using locus-specific primers and Sanger sequencing were used to ensure that all mutations were homozygous.
CRISPR/Cas9 genome editing
The sextuple mutant vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X was generated using CRISPR/Cas9 genomic editing. First, the T391E/L392F/A393* mutations were simultaneously introduced into the vit-3, vit-4, and vit-5 loci using a single crRNA, with the T391E/L392F mutations creating a novel EcoRI restriction site within each locus. The Cas9::crRNA:tracrRNA complexes, as well as the ssODN repair template, were microinjected into the germline of DLS882 to generate DLS976 as previously described (Ghanta and Mello 2020). The vit-3, vit-4, and vit-5 edits were independently verified by PCR using locus-specific primer pairs (each with distinct annealing temperatures) followed by an EcoRI digestion, which yielded a unique set of DNA fragments for each locus. The PCR amplicons were also subjected to Sanger sequencing. Next, the vit-6 locus was edited in DLS976 using the same CRISPR strategy to generate DLS1004 containing the S320F/W322* mutations, which also produce a novel EcoRI restriction site within the vit-6 locus. Sanger sequencing was performed on all CRISPR mutations to confirm proper editing and to verify homozygosity.
Coomassie blue staining
For each genotype, 25 worms (day 2 adults) were harvested into 26 µL of M9 media by picking, snap frozen in liquid nitrogen, and stored at -80ºC. Then, 10 µL of 4X Laemmli sample buffer (Bio-Rad, 1610747) and 4 µL of 1 M Dithiothreitol (DTT) were added to the samples before incubating them at 100°C for 5 minutes. Protein samples were sonicated for 10 minutes using a Bioruptor Pico instrument (Diagenode), incubated at 100°C for an additional 5 minutes, and briefly centrifuged. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was performed using 4–20% precast gels (Bio-Rad, 4568094) and Tris/Glycine/SDS running buffer (Bio-Rad, 1610732). Gels were stained with 0.5% Coomassie brilliant blue R-250 (in 45% ethanol, 9% glacial acetic acid, 45% water) with gentle shaking, destained in a 50% methanol, 10% glacial acetic acid, 40% water solution, and finally rinsed in deionized water for at least 1 hour. Gels were imaged using the ImageQuant LAS 4000 instrument (GE Healthcare) and protein bands were identified based on previously published analyses (Sornda et al., 2019). The experiment was performed three times with similar results.
Nile Red staining
Nile Red staining was performed on embryos harvested by hypochlorite treatment as previously described (Escorcia et al., 2018). Isopropanol-fixed embryos were stained for 2 hours with a freshly prepared Nile Red/isopropanol solution (60 μL of 0.5 mg/mL Nile Red stock in 940 µL of 40% isopropanol). The embryos were immediately washed, mounted on agar pads, and imaged using a 20X objective on a Nikon Ti2 widefield microscope equipped with a Hamamatsu ORCA-Fusion BT camera. For image quantification, average fluorescence intensities (mean gray values) were measured by manually circling the embryos (n=50 per genotype) using Fiji (version 2.14.0/1.54f). No background subtraction was performed due to a lack of background fluorescence. The data were plotted as the mean ± SD, outlier data were removed using default parameters, and a one-way ANOVA followed by a Bonferroni's multiple comparisons correction was performed using Prism 10. The experiment was independently replicated three times.
Brood size assay
Twelve animals per genotype were singled to individual plates each day for five days and allowed to lay embryos. Two days after each transfer, when progeny had grown to the L4 stage, the plate was scored for hatched animals. Any mothers that died prior to the final transfer were censored. The total number of hatched progeny was calculated, the data were plotted as the mean ± SD, and a one-way ANOVA followed by a Bonferroni's multiple comparisons correction was performed using Prism 10.
Starvation assays
Hypochlorite treatment was used to isolate embryos from gravid adults and L1s were synchronized in M9 media by overnight rotation at 20°C. The L1 animals were maintained in 15 mL conical tubes containing M9 media without cholesterol (~8 worms/µL) with rotation at 20°C until scoring. On days one, three, five, ten, and fifteen, 100 worms per genotype were dropped onto unseeded plates and scored for movement. Animals that displayed no movement after 10 seconds were considered dead. The experiment was performed three independent times. The percentage of animals alive at each time point was plotted as the mean ± SEM using Prism 10. To compare the survival curves between wild-type and each mutant, we simulated the survival of each genotype for 100 arbitrary individual worms based on the average population-level survival percentages measured at each timepoint and performed a Mantel-Cox log-rank test in Prism, as previously described (Lee and Ashrafi 2008; Zhang et al., 2011).
","reagents":"Genotyping: | ||
Alleles | Primer Sequences | Expected Band Sizes (bp) |
For: AGCGTGAGCTCAAGGAGAAG Rev: AGCTTCGTATCCACGACGAC | WT: 3325 MT: 1528 | |
For: ATGGAGCACGCTCTTGCTAT Rev: TGGGATCTTTCCAGAGATGG | WT: 1378 MT: 525 | |
For: TCCGCTTTTTGCAAAGTATC Rev: TGGTTGACGTGGATCTTGGA | - EcoRI: 845 + EcoRI: 386 & 409 | |
For: TACTTTCAGGTCTCTGGACC Rev: TTTGTCTAGATGCTGGGCGG | - EcoRI: 599 + EcoRI: 342 & 257 | |
For: CAGCACACAAGTTTTCAGGT Rev: GATGCTCTTCTTCTCGAAGT | - EcoRI: 361 + EcoRI: 351 & 10 | |
For: CGCACCCTCGAAGGAGAATG Rev: CAAGAGATGGGTAGCGCATG | - EcoRI: 820 + EcoRI: 405 & 415 | |
CRISPR Edits: | ||
Gene | crRNA Sequence | ssODN Repair Sequence |
ACUUGUCAUUGAAACCACAU | GTTCAACTTGTCATTGAAACCGAATTCTAAGTGGCTGGAACCAAGAACACCATTCAACAC | |
UCUACAACCAGGAAUCCGAA | CCGAGCTTGTCTACAACCAGGAATTCGAATAGGCTGAGCAACAATGGGCTCAAACTGGAG | |
Strains: | ||
Strain Name | Genotype | Available From |
Wild-type | CGC | |
CGC | ||
CGC | ||
CGC | ||
Upon request | ||
vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X | Upon request | |
vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X | Upon request |
Vitellogenesis is the process by which nutrients are provisioned to an animal's progeny in the form of yolk, comprised of lipids and vitellogenin lipoproteins (Kimble and Sharrock 1983; Klass et al., 1979; Sharrock 1983; Sharrock et al., 1990). The nematode C. elegans possesses six vitellogenin-encoding (vit) genes, which produce proteins YP170B, encoded by vit-2, YP170A, encoded by vit-3, vit-4, and vit-5, and YP115 and YP88 formed from the cleaved vit-6 gene product (Sharrock 1983; Sharrock et al., 1990). The vit-1 gene is 82% identical to vit-2 (Blumenthal et al., 1984; Perez and Lehner 2019); however, it remains unclear if the mature VIT-1 protein is also 170 kDa. The VIT proteins recruit and transport phospholipids, free fatty acids, and cholesterol in the form of lipoprotein particles from the animal's intestine to the mature oocytes in the gonad (Grant and Hirsh 1999; Hall et al., 1999; Kimble and Sharrock 1983; Perez and Lehner 2019; Sharrock et al., 1990). Lipoproteins are internalized by oocytes via the RME-2 receptor through receptor-mediated endocytosis (Grant and Hirsh 1999). Together, the vitellogenin proteins, which are functional orthologues of the human low-density lipoprotein ApoB (Baker 1988), are required for proper delivery of yolk to the progeny. To date, the vit genes have only been studied individually or tested in tandem using double loss-of-function mutants or RNAi (Ezcurra et al., 2018; Geens et al., 2023; Murphy et al., 2003; Seah et al., 2016; Sornda et al., 2019).
To further understand the physiological consequence of total loss of vitellogenin protein, we generated a novel strain that contains loss-of-function mutations in all six vitellogenin genes (vit-1-6). Taking advantage of the high sequence similarity of the vit-3, vit-4, and vit-5 genes, we simultaneously engineered a premature stop codon into these three vit genes using CRISPR/Cas9 genome editing (Figure 1A). These nonsense mutations were introduced into the vit-2(ok3211) vit-1(ok2616) double mutant, yielding the vit-1-5 mutant. After verifying the quintuple mutant strain by genotyping and Sanger sequencing of each locus, we engineered a premature stop codon mutation into the vit-6 locus via CRISPR/Cas9 (Figure 1A), thereby generating the vit-1-6 mutant.
To validate that our loss-of-function alleles impaired VIT protein production, we stained SDS-PAGE gels containing protein lysates from wild-type animals, the rme-2(b1008) mutant, the vit-2 vit-1 double mutant, and the vit-1-6 sextuple mutant with Coomassie blue to visualize the highly abundant yolk proteins (Figure 1B). Yolk proteins have established molecular weights of 170 kDa (YP170A and YP170B), 115 kDa (YP115), and 88 kDa (YP88) and are easily visualized by Coomassie staining of SDS-PAGE gels (Sharrock 1983). The rme-2(b1008) mutant displayed increased VIT protein levels compared to wild-type, which is expected given that oocytes lacking the RME-2 receptor are unable to clear yolk from the body cavity (Grant and Hirsh 1999). In contrast, the vit-1-6 sextuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B). These results are consistent with previous studies, where animals subjected to vit-5 and/or vit-6 RNAi showed a decrease in the amount of yolk proteins relative to controls when analyzed by Coomassie blue staining (Geens et al., 2023; Sornda et al., 2019). Notably, the vit-2 vit-1 double mutant showed little impairment in yolk protein synthesis, suggesting that vit-3-6 may compensate for their loss. Furthermore, we did not observe any increase in YP115 or YP88 levels in the vit-2 vit-1 double mutant, which has been previously observed in older adult animals subjected to vit-5 RNAi (Sornda et al., 2019). While we are confident that the vit-1-6 mutations severely decrease yolk production, we are unable to eliminate the possibility that some VIT protein is synthesized in these animals due to stop codon readthrough.
Given that yolk is responsible for the deposition of lipids into the mature oocyte, we hypothesized that loss of the vit genes would result in lower amounts of embryonic lipids. Using Nile Red to stain neutral lipids and triglycerides, we found that the vit mutant embryos exhibited lower amounts of Nile Red fluorescence relative to wild-type across three independent experiments, indicating that lipid levels were reduced in vit mutant embryos (Figure 1C). We observed a similar phenotype in the rme-2 mutant. Notably, we only found an average reduction of 32% and 21% in Nile Red staining for the vit-1-6 and the rme-2 mutant, respectively, suggesting that additional mechanisms of lipid deposition or de novo synthesis compensate for loss of vitellogenesis.
Despite its role in intergenerational nutrient allocation, it has been previously reported that reduced vitellogenin gene expression does not dramatically alter progeny production (Dowen 2019; Ezcurra et al., 2018; Van Rompay et al., 2015). However, animals lacking rme-2 have dramatically reduced brood sizes (Dowen 2019; Grant and Hirsh 1999). Therefore, we measured the brood size of the vit-2 vit-1 double mutant and the vit-1-6 sextuple mutant and compared them to the broods produced by wild-type and rme-2 animals (Figure 1D). Intriguingly, the vit mutants produced near wild-type broods while the rme-2 mutant was nearly sterile, suggesting that the brood size defect of rme-2 animals is not solely explained by the lack of yolk protein delivery. These results are consistent with those previously described for other vitellogenesis mutants, such as vrp-1 and ceh-60 (Dowen 2019; Van Rompay et al., 2015). Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009).
Some vitellogenesis mutants have been shown to have deficiencies in maintaining progeny fitness, including a reduced ability to survive starvation at the L1 larval stage (Chotard et al., 2010; Geens et al., 2023; Van Rompay et al., 2015). Consistently, wild-type larvae that receive a lower dose of yolk as embryos have reduced fitness relative to their siblings that receive higher doses (Perez et al., 2017). Thus, we tested whether our vit mutants displayed reduced survival during L1 starvation. Indeed, the vit-1-6 mutant exhibited lower L1 survival (54%) compared to wild-type (91%) at day 10 of starvation, which persisted to day 15 (Figure 1E). The vit-1-6 survival phenotype was more severe than that of the vit-2 vit-1 double mutant; however, no mutant reached the levels of rme-2 mutant, which had a mean survival of 5% by day 10 and no surviving progeny by day 15 (Figure 1E). Together, these data indicate that loss of yolk provisioning, conferred by either mutation of the six vit genes or rme-2, impairs L1 starvation survival.
It is surprising that the vit-1-6 mutant does not closely phenocopy the rme-2 mutant, as both mutations result in failure to provision yolk to the offspring. The dramatic difference in brood size can perhaps be accredited to a defect in the spermatheca valve leading to oocyte damage in the rme-2 mutant (Chi and Reinke 2009); however, an explanation for why the rme-2 mutant displays more severe L1 survival phenotypes compared to the vit-1-6 mutant requires additional studies. One intriguing possibility is that the RME-2 receptor facilitates the uptake of molecules other than yolk. A recent study found that 5-carboxyfluorescein (5-CF), a small membrane-impermeable fluorescent molecule, can be transported from the intestine to the oocyte via RME-2 (Turmel-Couture et al., 2024). While it is possible that 5-CF is transported to the germline within yolk particles, it is also possible that RME-2 mediates the uptake of molecules independent of yolk. Thus, additional research is needed to elucidate the full suite of molecules that can be endocytosed by RME-2 in the oocytes.
The vit-1-6 mutant strain provides a useful avenue to explore the metabolic dysfunction in vitellogenin-depleted animals. Using Nile Red staining, we found that upon loss of the vitellogenin proteins, embryos still have a substantial amount of lipids, suggesting that multiple lipid synthesis pathways contribute to maternal nutrient provisioning. One alternative mechanism for maternal deposition of lipids into the C. elegans germline is through the delivery of malonyl-CoA via gap junctions. Malonyl-CoA is produced in the somatic sheath cells and transported out of the somatic cells by the INX-8/INX-9 hemichannels and into the germline by the INX-14/INX-21 hemichannels (Starich et al., 2020). Malonyl-CoA can then be used in the germline and embryos to fuel fatty acid synthesis via de novo lipogenesis, which is critical for proper embryonic development (Starich et al., 2020). Perhaps this pathway is heavily utilized when yolk protein expression is impaired, as in the vit-1-6 or rme-2 mutants.
Here, we used CRISPR-Cas9 genome editing to generate a novel mutant strain containing nonsense mutations in the vit-3, vit-4, vit-5, and vit-6 genes, which were combined with the previously established loss-of-function mutations vit-1(ok2616) and vit-2(ok3211), to yield the sextuple vit-1-6 mutant. Our results indicate that depletion of all six vitellogenin proteins does not confer an abnormal brood size, but rather, the progeny exhibit a reduction in fitness during L1 starvation. While our well-fed conditions support efficient propagation of this strain in the laboratory, it is likely that these animals would be at a severe disadvantage in the wild where maternal provisioning of lipids is likely crucial for progeny survival during adverse or stressful conditions. This strain will be a useful resource to other research labs interested in investigating the metabolic tradeoffs during development, reproduction, and aging.
","references":[{"reference":"Baker ME. 1988. Is vitellogenin an ancestor of apolipoprotein B-100 of human low-density lipoprotein and human lipoprotein lipase? Biochem J 255(3): 1057-60.
","pubmedId":"3145737","doi":""},{"reference":"Blumenthal T, Squire M, Kirtland S, Cane J, Donegan M, Spieth J, Sharrock W. 1984. Cloning of a yolk protein gene family from Caenorhabditis elegans. J Mol Biol 174(1): 1-18.
","pubmedId":"6546952","doi":""},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77(1): 71-94.
","pubmedId":"4366476","doi":""},{"reference":"Chi W, Reinke V. 2009. DPL-1 (DP) acts in the germ line to coordinate ovulation and fertilization in C. elegans. Mech Dev 126(5-6): 406-16.
","pubmedId":"19368797","doi":""},{"reference":"Chotard L, Skorobogata O, Sylvain MA, Shrivastava S, Rocheleau CE. 2010. TBC-2 is required for embryonic yolk protein storage and larval survival during L1 diapause in Caenorhabditis elegans. PLoS One 5(12): e15662.
","pubmedId":"21203392","doi":""},{"reference":"Dowen RH. 2019. CEH-60/PBX and UNC-62/MEIS Coordinate a Metabolic Switch that Supports Reproduction in C. elegans. Dev Cell 49(2): 235-250.e7.
","pubmedId":"30956009","doi":""},{"reference":"Escorcia W, Ruter DL, Nhan J, Curran SP. 2018. Quantification of Lipid Abundance and Evaluation of Lipid Distribution in Caenorhabditis elegans by Nile Red and Oil Red O Staining. J Vis Exp(133): 10.3791/57352.
","pubmedId":"29553519","doi":""},{"reference":"Ezcurra M, Benedetto A, Sornda T, Gilliat AF, Au C, Zhang Q, et al., Gems D. 2018. C. elegans Eats Its Own Intestine to Make Yolk Leading to Multiple Senescent Pathologies. Curr Biol 28(16): 2544-2556.e5.
","pubmedId":"30100339","doi":""},{"reference":"Geens E, Van de Walle P, Caroti F, Jelier R, Steuwe C, Schoofs L, Temmerman L. 2023. Yolk-deprived Caenorhabditis elegans secure brood size at the expense of competitive fitness. Life Sci Alliance 6(6): 10.26508/lsa.202201675.
","pubmedId":"37059473","doi":""},{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics 216(3): 643-650.
","pubmedId":"32963112","doi":""},{"reference":"Grant B, Hirsh D. 1999. Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol Biol Cell 10(12): 4311-26.
","pubmedId":"10588660","doi":""},{"reference":"Hall DH, Winfrey VP, Blaeuer G, Hoffman LH, Furuta T, Rose KL, Hobert O, Greenstein D. 1999. Ultrastructural features of the adult hermaphrodite gonad of Caenorhabditis elegans: relations between the germ line and soma. Dev Biol 212(1): 101-23.
","pubmedId":"10419689","doi":""},{"reference":"Kimble J, Sharrock WJ. 1983. Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans. Dev Biol 96(1): 189-96.
","pubmedId":"6825952","doi":""},{"reference":"Klass MR, Wolf N, Hirsh D. 1979. Further characterization of a temperature-sensitive transformation mutant in Caenorhabditis elegans. Dev Biol 69(1): 329-35.
","pubmedId":"446897","doi":""},{"reference":"Lee BH, Ashrafi K. 2008. A TRPV channel modulates C. elegans neurosecretion, larval starvation survival, and adult lifespan. PLoS Genet 4(10): e1000213.
","pubmedId":"18846209","doi":""},{"reference":"Murphy CT, McCarroll SA, Bargmann CI, Fraser A, Kamath RS, Ahringer J, Li H, Kenyon C. 2003. Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature 424(6946): 277-83.
","pubmedId":"12845331","doi":""},{"reference":"Perez MF, Francesconi M, Hidalgo-Carcedo C, Lehner B. 2017. Maternal age generates phenotypic variation in Caenorhabditis elegans. Nature 552(7683): 106-109.
","pubmedId":"29186117","doi":""},{"reference":"Perez MF, Lehner B. 2019. Vitellogenins - Yolk Gene Function and Regulation in Caenorhabditis elegans. Front Physiol 10: 1067.
","pubmedId":"31551797","doi":""},{"reference":"Seah NE, de Magalhaes Filho CD, Petrashen AP, Henderson HR, Laguer J, Gonzalez J, et al., Lapierre LR. 2016. Autophagy-mediated longevity is modulated by lipoprotein biogenesis. Autophagy 12(2): 261-72.
","pubmedId":"26671266","doi":""},{"reference":"Sharrock WJ. 1983. Yolk proteins of Caenorhabditis elegans. Dev Biol 96(1): 182-8.
","pubmedId":"6337890","doi":""},{"reference":"Sharrock WJ, Sutherlin ME, Leske K, Cheng TK, Kim TY. 1990. Two distinct yolk lipoprotein complexes from Caenorhabditis elegans. J Biol Chem 265(24): 14422-31.
","pubmedId":"2387862","doi":""},{"reference":"Sornda T, Ezcurra M, Kern C, Galimov ER, Au C, de la Guardia Y, Gems D. 2019. Production of YP170 Vitellogenins Promotes Intestinal Senescence in Caenorhabditis elegans. J Gerontol A Biol Sci Med Sci 74(8): 1180-1188.
","pubmedId":"30854561","doi":""},{"reference":"Starich TA, Bai X, Greenstein D. 2020. Gap junctions deliver malonyl-CoA from soma to germline to support embryogenesis in Caenorhabditis elegans. Elife 9: 10.7554/eLife.58619.
","pubmedId":"32735213","doi":""},{"reference":"Turmel-Couture S, Martel PO, Beaulieu L, Lechasseur X, Fotso Dzuna LV, Narbonne P. 2024. Bidirectional transfer of a small membrane-impermeable molecule between the Caenorhabditis elegans intestine and germline. J Biol Chem 300(12): 107963.
","pubmedId":"39510179","doi":""},{"reference":"Van Rompay L, Borghgraef C, Beets I, Caers J, Temmerman L. 2015. New genetic regulators question relevance of abundant yolk protein production in C. elegans. Sci Rep 5: 16381.
","pubmedId":"26553710","doi":""},{"reference":"Zhang X, Zabinsky R, Teng Y, Cui M, Han M. 2011. microRNAs play critical roles in the survival and recovery of Caenorhabditis elegans from starvation-induced L1 diapause. Proc Natl Acad Sci U S A 108(44): 17997-8002.
","pubmedId":"22011579","doi":""}],"suggestedReviewer":{"name":"Liesbet Temmerman, 0000-0002-1249-3995, liesbet.temmerman@kuleuven.be
Barth Grant, grant@dls.rutgers.edu
","WBId":""},"title":"Loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans
","reviews":[]},{"id":"e1908fb6-c8e2-46fb-a9d9-d6aa77669755","decisionLetter":"Dear Authors,
Congratulations on your new publication! We are pleased to let you know that your microPublication is now available online. You can access it here: https://micropublication.org/journals/biology/micropub-biology-001789
Your article will be sent to PubMed Central in 2 weeks. Please make sure there are no typos, errors or omissions in your article, including your title, author names, affiliations, reagents, etc. in addition to your reported results. If you want to make corrections, contact us with the title of your article and your requested edits at editors@micropublication.org.
After two weeks, any correction will require a separate corrigendum article at the editor's discretion.
Thank you for submitting your data to us. We look forward to working with you again.
For your records, this is your article's citation:
\"Macharios MM, Hernandez YD, Breen PC, Dowen RH. 2025. Loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans. microPublication Biology. 10.17912/micropub.biology.001789.\"
Best wishes,
The microPublication Team
","decision":"publish","submitted":true,"abstract":"Organismal homeostasis relies on balancing cellular metabolic decisions with environmental conditions, especially during reproduction. Using Caenorhabditis elegans, we tested whether vitellogenesis, or the deposition of lipid-rich yolk into oocytes, is required for reproductive output and metabolic balance by creating a strain lacking all six vitellogenin genes (vit-1-6). This mutant produced embryos with reduced lipid content compared to wild-type, but the total brood size remained unaffected, unlike the rme-2 mutant, which lacks the yolk receptor. However, progeny survival during L1 starvation was impaired in vit-1-6 animals. This strain offers a new model for studying how vitellogenesis impacts reproductive and organismal fitness.
","acknowledgements":"The authors would like to thank the Caenorhabditis Genetics Center (CGC), supported by the NIH Office of Research Infrastructure Programs (P40 OD010440), for providing essential strains for this study. We also extend our sincere thanks to Dr. Gidi Shemer, the Department of Biology, and the Office of Undergraduate Research at UNC Chapel Hill for their continued commitment to and support of undergraduate research.
","authors":[{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing"],"email":"macha@email.unc.edu","firstName":"Monica M. ","lastName":"Macharios","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-5150-7089"},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["investigation"],"email":"yasminee@email.unc.edu","firstName":"Yasmine D. ","lastName":"Hernandez","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["supervision","investigation","writing_reviewEditing"],"email":"petbreen@email.unc.edu","firstName":"Peter C.","lastName":"Breen","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["conceptualization","writing_reviewEditing","supervision","fundingAcquisition","project","dataCuration"],"email":"dowen@email.unc.edu","firstName":"Robert H.","lastName":"Dowen","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3421-5192"}],"comments":"We have reviewed the proofs and have fixed a couple of typos. All corrections have been applied.
Please find below our response to the Reviewer's comments:
Only a few minor suggestions:
- Figure 1 caption: please remove line break and spacing between caption title and caption text
To our knowledge, we have no control over this formatting. We have entered the caption title and caption text in the appropriate boxes in the submission portal.
- Figure 1E does not show survival rate, but survival itself. Please adjust in caption text. Also, a more precise/appropriate statistical test such as Cox proportional hazards would be advisable, over the somewhat vaguely formulated one-way ANOVA \"based on the area under the curve\".
The term “survival rate” has been replaced with “survival” in the caption text. Also, we have now applied a logrank (Mantel-Cox) test to our survival data based on previously published studies that have similarly tested L1 survival across multiple independent experiments. All curves are now significantly different from the wild-type control. We have described this analysis approach in detail in the methods section and have cited previous studies that have employed this technique. The caption text has also been modified to reflect this change.
- Please use consistent naming of the double mutant: vit-2 vit-1 is indeed correct, please adjust uses of vit-1 vit-2 to the correct order.
All references to the vit-1 vit-2 double mutant in the manuscript are now referred to as “vit-2 vit-1” in the correct order based on their genomic position on chromosome X.
- Both the (first-paragraph) initial Perez and Lehner citations are somewhat misused in my opinion, because this information was known long before. It would be more correct to give credit to older work, e.g. by Kimble/Sharrock/Grant/Hirsh.
We have added several citations to the first paragraph, which have replaced, or have been added to, the Perez and Lehner citation. This includes early work from Kimble, Sharrock, Grant, and Hirsh.
- \"To date, the vit genes have only been studied individually or tested in tandem using double loss-of-function mutants or RNAi.\" misses citations.
We have added several citations that have used this genetic approach and that are relevant to our study.
- \"After verifying the quintuple mutant strain by genotyping and Sanger sequencing of each locus\": vit 3-5 are highly similar and located closely together on the chromosome. Was the entire region sequenced for verification of the edits as well as their background, in that locus? It would be valuable to describe with a little more detail how well the strain has been characterized (could be added to the methods).
We have provided additional genotyping details for the vit-3, vit-4, and vit-5 loci to the methods section: “The vit-3, vit-4, and vit-5 edits were independently verified by PCR using locus-specific primer pairs (each with distinct annealing temperatures) followed by an EcoRI digestion, which yielded a unique set of DNA fragments for each locus.”
- vit-2 vit-1 would be expected to have increased YP115 and YP88 according to Sornda et al. 2019, or wt levels according to Geens et al. 2023. Here lower levels are reported - how to make sense of that?
As the Reviewer points out, Sornda et al. 2019 showed that knockdown of vit-5 increases YP115 and YP88 levels; however, this phenotype was only observed in older adults (days 4-11 of adulthood but not day 1). We assayed day 2 adults, which were also tested in the Geens et al. 2023 paper, and we found little difference in YP115/YP88 levels between wild-type (lane 1) and vit-2 vit-1 animals (lane 3). This was also true in our replicate experiments. Thus, our observations are in line with the Geens paper, where loss of vit-2 vit-1 does not dramatically impact YP115/YP88 levels early in adulthood. We have revised our text to read:
“In contrast, the vit-1-6 sextuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B). These results are consistent with previous studies, where animals subjected to vit-5 and/or vit-6 RNAi showed a decrease in the amount of yolk proteins relative to controls when analyzed by Coomassie blue staining (Geens et al., 2023; Sornda et al., 2019). Notably, the vit-2 vit-1 double mutant showed little impairment in yolk protein synthesis, suggesting that vit-3-6 may compensate for their loss. Furthermore, we did not observe an increase in YP115 or YP88 levels in the vit-2 vit-1 double mutant, which has been previously observed in older adult animals subjected to vit-5 RNAi (Sornda et al., 2019).”
- Please correctly cite Grant & Hirsh 1999 for the original observation of reduced brood size of rme-2, instead of Dowen 2019.
We have added the Grant & Hirsh 1999 citation to the text describing the reduced brood size of rme-2 mutant animals. We have decided to keep the Dowen 2019 citation as well, since progeny production of the rme-2(b1008) mutant was quantified in the 2019 study and produced similar results as shown in this current study.
- \"Furthermore, our data suggest that RME-2 may serve additional roles in the germline, which could include functioning in spermathecal valve dilation and ovulation (Chi and Reinke 2009).\" Please rephrase; the data presented here do fit with the work of Chi and Reinke, but they do not suffice to suggest additional roles in the germline (which is based on literature, not on the current experimental data).
We agree with the reviewer and have clarified this statement in the text: “Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009).”
- L1 survival: Geens et al. 2023 suggested that vit-6 does not contribute much to this, and it would mainly depend on YP170 proteins. Would you agree?
We appreciate the Reviewer’s comments and agree that role of vit-6 in L1 starvation is poorly defined. However, we are unable to comment on the role of vit-6 in L1 starvation survival since we did not test the vit-6 single mutant or compare the vit-2 vit-1 double mutant to the vit-2 vit-1 vit-6 triple mutant. This comparison was not performed because we generated the vit-6 mutation in our existing vit-1-5 mutant via CRISPR editing. Therefore, we have avoided speculating on the specific function of vit-6 in L1 survival in the revised manuscript.
","dataTable":null,"disclaimer":true,"funding":"Supported by National Institute of General Medical Sciences grant R35GM137985 to Robert H. Dowen.
","image":{"name":"Figure_R1.png","url":"https://portal.micropublication.org/uploads/ed3af131ba1444ea3a8c84e0673152fc.png"},"imageCaption":"(A) A schematic illustrating the nonsense mutations introduced into the vit-3, vit-4, vit-5, and vit-6 genes by CRISPR/Cas9 editing. The edits to vit-3, vit-4, and vit-5 were performed simultaneously using a single crRNA that targeted the same sequence in all three genes. The vit-3-6 mutations were introduced into the vit-2(ok3211) vit-1(ok2616) double mutant to generate the vit-1-6 sextuple mutant. (B) An SDS-PAGE gel containing protein lysates from wild-type, rme-2(b1008), vit-2(ok3211) vit-1(ok2616), and vit-1-6 animals (25 individuals per lane) stained with Coomassie blue R-250. The arrows indicate bands corresponding to the major yolk proteins (YP170, YP115, and YP88). (C) Quantification of Nile Red fluorescence in embryos from three independent experiments (mean ± SD; n=50/genotype; ns, not significant, *, P<0.05, **, P<0.01, ***, P<0.001, ****, P<0.0001, one-way ANOVA). (D) Brood size measurements for wild-type, rme-2(b1008), vit-2(ok3211) vit-1(ok2616), and vit-1-6 animals. Eleven individual broods were counted for each genotype (mean ± SD; ns, not significant, **, P<0.01, ****, P<0.0001, one-way ANOVA). (E) A time course of survival during L1 starvation (3 independent trials, mean ± SEM reported; P values were calculated using a Mantel-Cox log-rank test).
","imageTitle":"Creation and characterization of a strain carrying mutations in all six vitellogenin genes
","laboratory":{"name":"DLS","WBId":""},"methods":"Maintenance and generation of C. elegans strains
Animals were reared at 20°C on agar plates containing Nematode Growth Media (Brenner 1974). Plates were seeded with E. coli OP50 grown overnight in 2xYT at 37°C. The vit-2(ok3211) vit-1(ok2616) double mutant was created by standard genetic crossing. PCR using locus-specific primers and Sanger sequencing were used to ensure that all mutations were homozygous.
CRISPR/Cas9 genome editing
The sextuple mutant vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X was generated using CRISPR/Cas9 genomic editing. First, the T391E/L392F/A393* mutations were simultaneously introduced into the vit-3, vit-4, and vit-5 loci using a single crRNA, with the T391E/L392F mutations creating a novel EcoRI restriction site within each locus. The Cas9::crRNA:tracrRNA complexes, as well as the ssODN repair template, were microinjected into the germline of DLS882 to generate DLS976 as previously described (Ghanta and Mello 2020). The vit-3, vit-4, and vit-5 edits were independently verified by PCR using locus-specific primer pairs (each with distinct annealing temperatures) followed by an EcoRI digestion, which yielded a unique set of DNA fragments for each locus. The PCR amplicons were also subjected to Sanger sequencing. Next, the vit-6 locus was edited in DLS976 using the same CRISPR strategy to generate DLS1004 containing the S320F/W322* mutations, which also produce a novel EcoRI restriction site within the vit-6 locus. Sanger sequencing was performed on all CRISPR mutations to confirm proper editing and to verify homozygosity.
Coomassie blue staining
For each genotype, 25 worms (day 2 adults) were harvested into 26 µL of M9 media by picking, snap frozen in liquid nitrogen, and stored at -80ºC. Then, 10 µL of 4X Laemmli sample buffer (Bio-Rad, 1610747) and 4 µL of 1 M Dithiothreitol (DTT) were added to the samples before incubating them at 100°C for 5 minutes. Protein samples were sonicated for 10 minutes using a Bioruptor Pico instrument (Diagenode), incubated at 100°C for an additional 5 minutes, and briefly centrifuged. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was performed using 4–20% precast gels (Bio-Rad, 4568094) and Tris/Glycine/SDS running buffer (Bio-Rad, 1610732). Gels were stained with 0.5% Coomassie brilliant blue R-250 (in 45% ethanol, 9% glacial acetic acid, 45% water) with gentle shaking, destained in a 50% methanol, 10% glacial acetic acid, 40% water solution, and finally rinsed in deionized water for at least 1 hour. Gels were imaged using the ImageQuant LAS 4000 instrument (GE Healthcare) and protein bands were identified based on previously published analyses (Sornda et al., 2019). The experiment was performed three times with similar results.
Nile Red staining
Nile Red staining was performed on embryos harvested by hypochlorite treatment as previously described (Escorcia et al., 2018). Isopropanol-fixed embryos were stained for 2 hours with a freshly prepared Nile Red/isopropanol solution (60 μL of 0.5 mg/mL Nile Red stock in 940 µL of 40% isopropanol). The embryos were immediately washed, mounted on agar pads, and imaged using a 20X objective on a Nikon Ti2 widefield microscope equipped with a Hamamatsu ORCA-Fusion BT camera. For image quantification, average fluorescence intensities (mean gray values) were measured by manually circling the embryos (n=50 per genotype) using Fiji (version 2.14.0/1.54f). No background subtraction was performed due to a lack of background fluorescence. The data were plotted as the mean ± SD, outlier data were removed using default parameters, and a one-way ANOVA followed by a Bonferroni's multiple comparisons correction was performed using Prism 10. The experiment was independently replicated three times.
Brood size assay
Twelve animals per genotype were singled to individual plates each day for five days and allowed to lay embryos. Two days after each transfer, when progeny had grown to the L4 stage, the plate was scored for hatched animals. Any mothers that died prior to the final transfer were censored. The total number of hatched progeny was calculated, the data were plotted as the mean ± SD, and a one-way ANOVA followed by a Bonferroni's multiple comparisons correction was performed using Prism 10.
Starvation assays
Hypochlorite treatment was used to isolate embryos from gravid adults and L1s were synchronized in M9 media by overnight rotation at 20°C. The L1 animals were maintained in 15 mL conical tubes containing M9 media without cholesterol (~8 worms/µL) with rotation at 20°C until scoring. On days one, three, five, ten, and fifteen, 100 worms per genotype were dropped onto unseeded plates and scored for movement. Animals that displayed no movement after 10 seconds were considered dead. The experiment was performed three independent times. The percentage of animals alive at each time point was plotted as the mean ± SEM using Prism 10. To compare the survival curves between wild-type and each mutant, we simulated the survival of each genotype for 100 arbitrary individual worms based on the average population-level survival percentages measured at each timepoint and performed a Mantel-Cox log-rank test in Prism, as previously described (Lee and Ashrafi 2008; Zhang et al., 2011).
","reagents":"Genotyping: | ||
Alleles | Primer Sequences | Expected Band Sizes (bp) |
For: AGCGTGAGCTCAAGGAGAAG Rev: AGCTTCGTATCCACGACGAC | WT: 3325 MT: 1528 | |
For: ATGGAGCACGCTCTTGCTAT Rev: TGGGATCTTTCCAGAGATGG | WT: 1378 MT: 525 | |
For: TCCGCTTTTTGCAAAGTATC Rev: TGGTTGACGTGGATCTTGGA | - EcoRI: 845 + EcoRI: 386 & 409 | |
For: TACTTTCAGGTCTCTGGACC Rev: TTTGTCTAGATGCTGGGCGG | - EcoRI: 599 + EcoRI: 342 & 257 | |
For: CAGCACACAAGTTTTCAGGT Rev: GATGCTCTTCTTCTCGAAGT | - EcoRI: 361 + EcoRI: 351 & 10 | |
For: CGCACCCTCGAAGGAGAATG Rev: CAAGAGATGGGTAGCGCATG | - EcoRI: 820 + EcoRI: 405 & 415 | |
CRISPR Edits: | ||
Gene | crRNA Sequence | ssODN Repair Sequence |
ACUUGUCAUUGAAACCACAU | GTTCAACTTGTCATTGAAACCGAATTCTAAGTGGCTGGAACCAAGAACACCATTCAACAC | |
UCUACAACCAGGAAUCCGAA | CCGAGCTTGTCTACAACCAGGAATTCGAATAGGCTGAGCAACAATGGGCTCAAACTGGAG | |
Strains: | ||
Strain Name | Genotype | Available From |
Wild-type | CGC | |
CGC | ||
CGC | ||
CGC | ||
Upon request | ||
vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X | Upon request | |
vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-2(ok3211) vit-1(ok2616) X | Upon request |
Vitellogenesis is the process by which nutrients are provisioned to an animal's progeny in the form of yolk, comprised of lipids and vitellogenin lipoproteins (Kimble and Sharrock 1983; Klass et al., 1979; Sharrock 1983; Sharrock et al., 1990). The nematode C. elegans possesses six vitellogenin-encoding (vit) genes, which produce proteins YP170B, encoded by vit-2, YP170A, encoded by vit-3, vit-4, and vit-5, and YP115 and YP88 formed from the cleaved vit-6 gene product (Sharrock 1983; Sharrock et al., 1990). The vit-1 gene is 82% identical to vit-2 (Blumenthal et al., 1984; Perez and Lehner 2019); however, it remains unclear if the mature VIT-1 protein is also 170 kDa. The VIT proteins recruit and transport phospholipids, free fatty acids, and cholesterol in the form of lipoprotein particles from the animal's intestine to the mature oocytes in the gonad (Grant and Hirsh 1999; Hall et al., 1999; Kimble and Sharrock 1983; Perez and Lehner 2019; Sharrock et al., 1990). Lipoproteins are internalized by oocytes via the RME-2 receptor through receptor-mediated endocytosis (Grant and Hirsh 1999). Together, the vitellogenin proteins, which are functional orthologues of the human low-density lipoprotein ApoB (Baker 1988), are required for proper delivery of yolk to the progeny. To date, the vit genes have only been studied individually or tested in tandem using double loss-of-function mutants or RNAi (Ezcurra et al., 2018; Geens et al., 2023; Murphy et al., 2003; Seah et al., 2016; Sornda et al., 2019).
To further understand the physiological consequence of total loss of vitellogenin protein, we generated a novel strain that contains loss-of-function mutations in all six vitellogenin genes (vit-1-6). Taking advantage of the high sequence similarity of the vit-3, vit-4, and vit-5 genes, we simultaneously engineered a premature stop codon into these three vit genes using CRISPR/Cas9 genome editing (Figure 1A). These nonsense mutations were introduced into the vit-2(ok3211) vit-1(ok2616) double mutant, yielding the vit-1-5 mutant. After verifying the quintuple mutant strain by genotyping and Sanger sequencing of each locus, we engineered a premature stop codon mutation into the vit-6 locus via CRISPR/Cas9 (Figure 1A), thereby generating the vit-1-6 mutant.
To validate that our loss-of-function alleles impaired VIT protein production, we stained SDS-PAGE gels containing protein lysates from wild-type animals, the rme-2(b1008) mutant, the vit-2 vit-1 double mutant, and the vit-1-6 sextuple mutant with Coomassie blue to visualize the highly abundant yolk proteins (Figure 1B). Yolk proteins have established molecular weights of 170 kDa (YP170A and YP170B), 115 kDa (YP115), and 88 kDa (YP88) and are easily visualized by Coomassie staining of SDS-PAGE gels (Sharrock 1983). The rme-2(b1008) mutant displayed increased VIT protein levels compared to wild-type, which is expected given that oocytes lacking the RME-2 receptor are unable to clear yolk from the body cavity (Grant and Hirsh 1999). In contrast, the vit-1-6 sextuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B). These results are consistent with previous studies, where animals subjected to vit-5 and/or vit-6 RNAi showed a decrease in the amount of yolk proteins relative to controls when analyzed by Coomassie blue staining (Geens et al., 2023; Sornda et al., 2019). Notably, the vit-2 vit-1 double mutant showed little impairment in yolk protein synthesis, suggesting that vit-3-6 may compensate for their loss. Furthermore, we did not observe any increase in YP115 or YP88 levels in the vit-2 vit-1 double mutant, which has been previously observed in older adult animals subjected to vit-5 RNAi (Sornda et al., 2019). While we are confident that the vit-1-6 mutations severely decrease yolk production, we are unable to eliminate the possibility that some VIT protein is synthesized in these animals due to stop codon readthrough.
Given that yolk is responsible for the deposition of lipids into the mature oocyte, we hypothesized that loss of the vit genes would result in lower amounts of embryonic lipids. Using Nile Red to stain neutral lipids and triglycerides, we found that the vit mutant embryos exhibited lower amounts of Nile Red fluorescence relative to wild-type across three independent experiments, indicating that lipid levels were reduced in vit mutant embryos (Figure 1C). We observed a similar phenotype in the rme-2 mutant. Notably, we only found an average reduction of 32% and 21% in Nile Red staining for the vit-1-6 and the rme-2 mutant, respectively, suggesting that additional mechanisms of lipid deposition or de novo synthesis compensate for loss of vitellogenesis.
Despite its role in intergenerational nutrient allocation, it has been previously reported that reduced vitellogenin gene expression does not dramatically alter progeny production (Dowen 2019; Ezcurra et al., 2018; Van Rompay et al., 2015). However, animals lacking rme-2 have dramatically reduced brood sizes (Dowen 2019; Grant and Hirsh 1999). Therefore, we measured the brood size of the vit-2 vit-1 double mutant and the vit-1-6 sextuple mutant and compared them to the broods produced by wild-type and rme-2 animals (Figure 1D). Intriguingly, the vit mutants produced near wild-type broods while the rme-2 mutant was nearly sterile, suggesting that the brood size defect of rme-2 animals is not solely explained by the lack of yolk protein delivery. These results are consistent with those previously described for other vitellogenesis mutants, such as vrp-1 and ceh-60 (Dowen 2019; Van Rompay et al., 2015). Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009).
Some vitellogenesis mutants have been shown to have deficiencies in maintaining progeny fitness, including a reduced ability to survive starvation at the L1 larval stage (Chotard et al., 2010; Geens et al., 2023; Van Rompay et al., 2015). Consistently, wild-type larvae that receive a lower dose of yolk as embryos have reduced fitness relative to their siblings that receive higher doses (Perez et al., 2017). Thus, we tested whether our vit mutants displayed reduced survival during L1 starvation. Indeed, the vit-1-6 mutant exhibited lower L1 survival (54%) compared to wild-type (91%) at day 10 of starvation, which persisted to day 15 (Figure 1E). The vit-1-6 survival phenotype was more severe than that of the vit-2 vit-1 double mutant; however, no mutant reached the levels of rme-2 mutant, which had a mean survival of 5% by day 10 and no surviving progeny by day 15 (Figure 1E). Together, these data indicate that loss of yolk provisioning, conferred by either mutation of the six vit genes or rme-2, impairs L1 starvation survival.
It is surprising that the vit-1-6 mutant does not closely phenocopy the rme-2 mutant, as both mutations result in failure to provision yolk to the offspring. The dramatic difference in brood size can perhaps be attributed to a defect in the spermatheca valve leading to oocyte damage in the rme-2 mutant (Chi and Reinke 2009); however, an explanation for why the rme-2 mutant displays more severe L1 survival phenotypes compared to the vit-1-6 mutant requires additional studies. One intriguing possibility is that the RME-2 receptor facilitates the uptake of molecules other than yolk. A recent study found that 5-carboxyfluorescein (5-CF), a small membrane-impermeable fluorescent molecule, can be transported from the intestine to the oocyte via RME-2 (Turmel-Couture et al., 2024). While it is possible that 5-CF is transported to the germline within yolk particles, it is also possible that RME-2 mediates the uptake of molecules independent of yolk. Thus, additional research is needed to elucidate the full suite of molecules that can be endocytosed by RME-2 in the oocytes.
The vit-1-6 mutant strain provides a useful avenue to explore the metabolic dysfunction in vitellogenin-depleted animals. Using Nile Red staining, we found that upon loss of the vitellogenin proteins, embryos still have a substantial amount of lipids, suggesting that multiple lipid synthesis pathways contribute to maternal nutrient provisioning. One alternative mechanism for maternal deposition of lipids into the C. elegans germline is through the delivery of malonyl-CoA via gap junctions. Malonyl-CoA is produced in the somatic sheath cells and transported out of the somatic cells by the INX-8/INX-9 hemichannels and into the germline by the INX-14/INX-21 hemichannels (Starich et al., 2020). Malonyl-CoA can then be used in the germline and embryos to fuel fatty acid synthesis via de novo lipogenesis, which is critical for proper embryonic development (Starich et al., 2020). Perhaps this pathway is heavily utilized when yolk protein expression or function is impaired, as in the vit-1-6 or rme-2 mutants.
Here, we used CRISPR-Cas9 genome editing to generate a novel mutant strain containing nonsense mutations in the vit-3, vit-4, vit-5, and vit-6 genes, which were combined with the previously established loss-of-function mutations vit-1(ok2616) and vit-2(ok3211), to yield the sextuple vit-1-6 mutant. Our results indicate that depletion of all six vitellogenin proteins does not confer an abnormal brood size, but rather, the progeny exhibit a reduction in fitness during L1 starvation. While our well-fed conditions support efficient propagation of this strain in the laboratory, it is likely that these animals would be at a severe disadvantage in the wild where maternal provisioning of lipids is likely crucial for progeny survival during adverse or stressful conditions. This strain will be a useful resource to other research labs interested in investigating the metabolic tradeoffs during development, reproduction, and aging.
","references":[{"reference":"Baker ME. 1988. Is vitellogenin an ancestor of apolipoprotein B-100 of human low-density lipoprotein and human lipoprotein lipase? Biochem J 255(3): 1057-60.
","pubmedId":"3145737","doi":""},{"reference":"Blumenthal T, Squire M, Kirtland S, Cane J, Donegan M, Spieth J, Sharrock W. 1984. Cloning of a yolk protein gene family from Caenorhabditis elegans. J Mol Biol 174(1): 1-18.
","pubmedId":"6546952","doi":""},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77(1): 71-94.
","pubmedId":"4366476","doi":""},{"reference":"Chi W, Reinke V. 2009. DPL-1 (DP) acts in the germ line to coordinate ovulation and fertilization in C. elegans. Mech Dev 126(5-6): 406-16.
","pubmedId":"19368797","doi":""},{"reference":"Chotard L, Skorobogata O, Sylvain MA, Shrivastava S, Rocheleau CE. 2010. TBC-2 is required for embryonic yolk protein storage and larval survival during L1 diapause in Caenorhabditis elegans. PLoS One 5(12): e15662.
","pubmedId":"21203392","doi":""},{"reference":"Dowen RH. 2019. CEH-60/PBX and UNC-62/MEIS Coordinate a Metabolic Switch that Supports Reproduction in C. elegans. Dev Cell 49(2): 235-250.e7.
","pubmedId":"30956009","doi":""},{"reference":"Escorcia W, Ruter DL, Nhan J, Curran SP. 2018. Quantification of Lipid Abundance and Evaluation of Lipid Distribution in Caenorhabditis elegans by Nile Red and Oil Red O Staining. J Vis Exp(133): 10.3791/57352.
","pubmedId":"29553519","doi":""},{"reference":"Ezcurra M, Benedetto A, Sornda T, Gilliat AF, Au C, Zhang Q, et al., Gems D. 2018. C. elegans Eats Its Own Intestine to Make Yolk Leading to Multiple Senescent Pathologies. Curr Biol 28(16): 2544-2556.e5.
","pubmedId":"30100339","doi":""},{"reference":"Geens E, Van de Walle P, Caroti F, Jelier R, Steuwe C, Schoofs L, Temmerman L. 2023. Yolk-deprived Caenorhabditis elegans secure brood size at the expense of competitive fitness. Life Sci Alliance 6(6): 10.26508/lsa.202201675.
","pubmedId":"37059473","doi":""},{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics 216(3): 643-650.
","pubmedId":"32963112","doi":""},{"reference":"Grant B, Hirsh D. 1999. Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol Biol Cell 10(12): 4311-26.
","pubmedId":"10588660","doi":""},{"reference":"Hall DH, Winfrey VP, Blaeuer G, Hoffman LH, Furuta T, Rose KL, Hobert O, Greenstein D. 1999. Ultrastructural features of the adult hermaphrodite gonad of Caenorhabditis elegans: relations between the germ line and soma. Dev Biol 212(1): 101-23.
","pubmedId":"10419689","doi":""},{"reference":"Kimble J, Sharrock WJ. 1983. Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans. Dev Biol 96(1): 189-96.
","pubmedId":"6825952","doi":""},{"reference":"Klass MR, Wolf N, Hirsh D. 1979. Further characterization of a temperature-sensitive transformation mutant in Caenorhabditis elegans. Dev Biol 69(1): 329-35.
","pubmedId":"446897","doi":""},{"reference":"Lee BH, Ashrafi K. 2008. A TRPV channel modulates C. elegans neurosecretion, larval starvation survival, and adult lifespan. PLoS Genet 4(10): e1000213.
","pubmedId":"18846209","doi":""},{"reference":"Murphy CT, McCarroll SA, Bargmann CI, Fraser A, Kamath RS, Ahringer J, Li H, Kenyon C. 2003. Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature 424(6946): 277-83.
","pubmedId":"12845331","doi":""},{"reference":"Perez MF, Francesconi M, Hidalgo-Carcedo C, Lehner B. 2017. Maternal age generates phenotypic variation in Caenorhabditis elegans. Nature 552(7683): 106-109.
","pubmedId":"29186117","doi":""},{"reference":"Perez MF, Lehner B. 2019. Vitellogenins - Yolk Gene Function and Regulation in Caenorhabditis elegans. Front Physiol 10: 1067.
","pubmedId":"31551797","doi":""},{"reference":"Seah NE, de Magalhaes Filho CD, Petrashen AP, Henderson HR, Laguer J, Gonzalez J, et al., Lapierre LR. 2016. Autophagy-mediated longevity is modulated by lipoprotein biogenesis. Autophagy 12(2): 261-72.
","pubmedId":"26671266","doi":""},{"reference":"Sharrock WJ. 1983. Yolk proteins of Caenorhabditis elegans. Dev Biol 96(1): 182-8.
","pubmedId":"6337890","doi":""},{"reference":"Sharrock WJ, Sutherlin ME, Leske K, Cheng TK, Kim TY. 1990. Two distinct yolk lipoprotein complexes from Caenorhabditis elegans. J Biol Chem 265(24): 14422-31.
","pubmedId":"2387862","doi":""},{"reference":"Sornda T, Ezcurra M, Kern C, Galimov ER, Au C, de la Guardia Y, Gems D. 2019. Production of YP170 Vitellogenins Promotes Intestinal Senescence in Caenorhabditis elegans. J Gerontol A Biol Sci Med Sci 74(8): 1180-1188.
","pubmedId":"30854561","doi":""},{"reference":"Starich TA, Bai X, Greenstein D. 2020. Gap junctions deliver malonyl-CoA from soma to germline to support embryogenesis in Caenorhabditis elegans. Elife 9: 10.7554/eLife.58619.
","pubmedId":"32735213","doi":""},{"reference":"Turmel-Couture S, Martel PO, Beaulieu L, Lechasseur X, Fotso Dzuna LV, Narbonne P. 2024. Bidirectional transfer of a small membrane-impermeable molecule between the Caenorhabditis elegans intestine and germline. J Biol Chem 300(12): 107963.
","pubmedId":"39510179","doi":""},{"reference":"Van Rompay L, Borghgraef C, Beets I, Caers J, Temmerman L. 2015. New genetic regulators question relevance of abundant yolk protein production in C. elegans. Sci Rep 5: 16381.
","pubmedId":"26553710","doi":""},{"reference":"Zhang X, Zabinsky R, Teng Y, Cui M, Han M. 2011. microRNAs play critical roles in the survival and recovery of Caenorhabditis elegans from starvation-induced L1 diapause. Proc Natl Acad Sci U S A 108(44): 17997-8002.
","pubmedId":"22011579","doi":""}],"suggestedReviewer":{"name":"Liesbet Temmerman, 0000-0002-1249-3995, liesbet.temmerman@kuleuven.be
Barth Grant, grant@dls.rutgers.edu
","WBId":""},"title":"Loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans
","reviews":[]},{"id":"fab69b35-ab53-4d5c-aee7-c246a53cbcf7","decisionLetter":"Dear Authors,
Congratulations on your new publication! We are pleased to let you know that your microPublication is now available online. You can access it here: https://micropublication.org/journals/biology/micropub-biology-001789
Your article will be sent to PubMed Central in 2 weeks. Please make sure there are no typos, errors or omissions in your article, including your title, author names, affiliations, reagents, etc. in addition to your reported results. If you want to make corrections, contact us with the title of your article and your requested edits at editors@micropublication.org.
After two weeks, any correction will require a separate corrigendum article at the editor's discretion.
Thank you for submitting your data to us. We look forward to working with you again.
For your records, this is your article's citation:
\"Macharios MM, Hernandez YD, Breen PC, Dowen RH. 2025. Loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans. microPublication Biology. 10.17912/micropub.biology.001789.\"
Best wishes,
The microPublication Team
","decision":"publish","submitted":true,"abstract":"Organismal homeostasis relies on balancing cellular metabolic decisions with environmental conditions, especially during reproduction. Using Caenorhabditis elegans, we tested whether vitellogenesis, or the deposition of lipid-rich yolk into oocytes, is required for reproductive output and metabolic balance by creating a strain lacking five of the six vitellogenin genes (vit-1/3/4/5/6). This mutant produced embryos with reduced lipid content compared to wild-type, but the total brood size remained unaffected, unlike the rme-2 mutant, which lacks the yolk receptor. However, progeny survival during L1 starvation was impaired in vit-1/3/4/5/6 animals. This strain offers a new model for studying how vitellogenesis impacts reproductive and organismal fitness.
","acknowledgements":"The authors would like to thank the Caenorhabditis Genetics Center (CGC), supported by the NIH Office of Research Infrastructure Programs (P40 OD010440), for providing essential strains for this study. We also extend our sincere thanks to Dr. Gidi Shemer, the Department of Biology, and the Office of Undergraduate Research at UNC Chapel Hill for their continued commitment to and support of undergraduate research.
","authors":[{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing"],"email":"macha@email.unc.edu","firstName":"Monica M. ","lastName":"Macharios","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-5150-7089"},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["investigation"],"email":"yasminee@email.unc.edu","firstName":"Yasmine D. ","lastName":"Hernandez","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["supervision","investigation","writing_reviewEditing"],"email":"petbreen@email.unc.edu","firstName":"Peter C.","lastName":"Breen","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States","University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, United States"],"credit":["conceptualization","writing_reviewEditing","supervision","fundingAcquisition","project","dataCuration"],"email":"dowen@email.unc.edu","firstName":"Robert H.","lastName":"Dowen","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-3421-5192"}],"comments":"We have reviewed the proofs and have fixed a couple of typos. All corrections have been applied.
Please find below our response to the Reviewer's comments:
Only a few minor suggestions:
- Figure 1 caption: please remove line break and spacing between caption title and caption text
To our knowledge, we have no control over this formatting. We have entered the caption title and caption text in the appropriate boxes in the submission portal.
- Figure 1E does not show survival rate, but survival itself. Please adjust in caption text. Also, a more precise/appropriate statistical test such as Cox proportional hazards would be advisable, over the somewhat vaguely formulated one-way ANOVA \"based on the area under the curve\".
The term “survival rate” has been replaced with “survival” in the caption text. Also, we have now applied a logrank (Mantel-Cox) test to our survival data based on previously published studies that have similarly tested L1 survival across multiple independent experiments. All curves are now significantly different from the wild-type control. We have described this analysis approach in detail in the methods section and have cited previous studies that have employed this technique. The caption text has also been modified to reflect this change.
- Please use consistent naming of the double mutant: vit-2 vit-1 is indeed correct, please adjust uses of vit-1 vit-2 to the correct order.
All references to the vit-1 vit-2 double mutant in the manuscript are now referred to as “vit-2 vit-1” in the correct order based on their genomic position on chromosome X.
- Both the (first-paragraph) initial Perez and Lehner citations are somewhat misused in my opinion, because this information was known long before. It would be more correct to give credit to older work, e.g. by Kimble/Sharrock/Grant/Hirsh.
We have added several citations to the first paragraph, which have replaced, or have been added to, the Perez and Lehner citation. This includes early work from Kimble, Sharrock, Grant, and Hirsh.
- \"To date, the vit genes have only been studied individually or tested in tandem using double loss-of-function mutants or RNAi.\" misses citations.
We have added several citations that have used this genetic approach and that are relevant to our study.
- \"After verifying the quintuple mutant strain by genotyping and Sanger sequencing of each locus\": vit 3-5 are highly similar and located closely together on the chromosome. Was the entire region sequenced for verification of the edits as well as their background, in that locus? It would be valuable to describe with a little more detail how well the strain has been characterized (could be added to the methods).
We have provided additional genotyping details for the vit-3, vit-4, and vit-5 loci to the methods section: “The vit-3, vit-4, and vit-5 edits were independently verified by PCR using locus-specific primer pairs (each with distinct annealing temperatures) followed by an EcoRI digestion, which yielded a unique set of DNA fragments for each locus.”
- vit-2 vit-1 would be expected to have increased YP115 and YP88 according to Sornda et al. 2019, or wt levels according to Geens et al. 2023. Here lower levels are reported - how to make sense of that?
As the Reviewer points out, Sornda et al. 2019 showed that knockdown of vit-5 increases YP115 and YP88 levels; however, this phenotype was only observed in older adults (days 4-11 of adulthood but not day 1). We assayed day 2 adults, which were also tested in the Geens et al. 2023 paper, and we found little difference in YP115/YP88 levels between wild-type (lane 1) and vit-2 vit-1 animals (lane 3). This was also true in our replicate experiments. Thus, our observations are in line with the Geens paper, where loss of vit-2 vit-1 does not dramatically impact YP115/YP88 levels early in adulthood. We have revised our text to read:
“In contrast, the vit-1-6 sextuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B). These results are consistent with previous studies, where animals subjected to vit-5 and/or vit-6 RNAi showed a decrease in the amount of yolk proteins relative to controls when analyzed by Coomassie blue staining (Geens et al., 2023; Sornda et al., 2019). Notably, the vit-2 vit-1 double mutant showed little impairment in yolk protein synthesis, suggesting that vit-3-6 may compensate for their loss. Furthermore, we did not observe an increase in YP115 or YP88 levels in the vit-2 vit-1 double mutant, which has been previously observed in older adult animals subjected to vit-5 RNAi (Sornda et al., 2019).”
- Please correctly cite Grant & Hirsh 1999 for the original observation of reduced brood size of rme-2, instead of Dowen 2019.
We have added the Grant & Hirsh 1999 citation to the text describing the reduced brood size of rme-2 mutant animals. We have decided to keep the Dowen 2019 citation as well, since progeny production of the rme-2(b1008) mutant was quantified in the 2019 study and produced similar results as shown in this current study.
- \"Furthermore, our data suggest that RME-2 may serve additional roles in the germline, which could include functioning in spermathecal valve dilation and ovulation (Chi and Reinke 2009).\" Please rephrase; the data presented here do fit with the work of Chi and Reinke, but they do not suffice to suggest additional roles in the germline (which is based on literature, not on the current experimental data).
We agree with the reviewer and have clarified this statement in the text: “Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009).”
- L1 survival: Geens et al. 2023 suggested that vit-6 does not contribute much to this, and it would mainly depend on YP170 proteins. Would you agree?
We appreciate the Reviewer’s comments and agree that role of vit-6 in L1 starvation is poorly defined. However, we are unable to comment on the role of vit-6 in L1 starvation survival since we did not test the vit-6 single mutant or compare the vit-2 vit-1 double mutant to the vit-2 vit-1 vit-6 triple mutant. This comparison was not performed because we generated the vit-6 mutation in our existing vit-1-5 mutant via CRISPR editing. Therefore, we have avoided speculating on the specific function of vit-6 in L1 survival in the revised manuscript.
","dataTable":{"name":null,"url":null},"disclaimer":true,"funding":"Supported by National Institute of General Medical Sciences grant R35GM137985 to Robert H. Dowen.
","image":{"name":"Figure_R1_Corrigendum.png","url":"https://portal.micropublication.org/uploads/814fee781de7972b6d8beaa157a3bc4e.png"},"imageCaption":"(A) A schematic illustrating the nonsense mutations introduced into the vit-3, vit-4, vit-5, and vit-6 genes by CRISPR/Cas9 editing. The edits to vit-3, vit-4, and vit-5 were performed simultaneously using a single crRNA that targeted the same sequence in all three genes. The vit-3-6 mutations were introduced into the vit-1(ok2616) mutant to generate the vit-1/3/4/5/6 quintuple mutant. (B) An SDS-PAGE gel containing protein lysates from wild-type, rme-2(b1008), vit-2(ok2616) vit-1(ok3211), and vit-1/3/4/5/6 animals (25 individuals per lane) stained with Coomassie blue R-250. The arrows indicate bands corresponding to the major yolk proteins (YP170, YP115, and YP88). (C) Quantification of Nile Red fluorescence in embryos from three independent experiments (mean ± SD; n=50/genotype; ns, not significant, *, P<0.05, **, P<0.01, ***, P<0.001, ****, P<0.0001, one-way ANOVA). (D) Brood size measurements for wild-type, rme-2(b1008), vit-2(ok2616) vit-1(ok3211), and vit-1/3/4/5/6 animals. Eleven individual broods were counted for each genotype (mean ± SD; ns, not significant, **, P<0.01, ****, P<0.0001, one-way ANOVA). (E) A time course of survival during L1 starvation (3 independent trials, mean ± SEM reported; P values were calculated using a Mantel-Cox log-rank test).
","imageTitle":"Creation and characterization of a strain carrying mutations in five of the six vitellogenin genes
","laboratory":{"name":"DLS","WBId":""},"methods":"Maintenance and generation of C. elegans strains
Animals were reared at 20°C on agar plates containing Nematode Growth Media (Brenner 1974). Plates were seeded with E. coli OP50 grown overnight in 2xYT at 37°C. The vit-2(ok3211) vit-1(ok2616) double mutant was created by standard genetic crossing. PCR using locus-specific primers and Sanger sequencing were used to ensure that all mutations were homozygous.
CRISPR/Cas9 genome editing
The quintuple mutant vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-1(ok2616) X was generated using CRISPR/Cas9 genomic editing. First, the T391E/L392F/A393* mutations were simultaneously introduced into the vit-3, vit-4, and vit-5 loci using a single crRNA, with the T391E/L392F mutations creating a novel EcoRI restriction site within each locus. The Cas9::crRNA:tracrRNA complexes, as well as the ssODN repair template, were microinjected into the germline of vit-1(ok2616) animals to generate DLS976 as previously described (Ghanta and Mello 2020). The vit-3, vit-4, and vit-5 edits were independently verified by PCR using locus-specific primer pairs (each with distinct annealing temperatures) followed by an EcoRI digestion, which yielded a unique set of DNA fragments for each locus. The PCR amplicons were also subjected to Sanger sequencing. Next, the vit-6 locus was edited in DLS976 using the same CRISPR strategy to generate DLS1004 containing the S320F/W322* mutations, which also produce a novel EcoRI restriction site within the vit-6 locus. Sanger sequencing was performed on all CRISPR mutations to confirm proper editing and to verify homozygosity.
Coomassie blue staining
For each genotype, 25 worms (day 2 adults) were harvested into 26 µL of M9 media by picking, snap frozen in liquid nitrogen, and stored at -80ºC. Then, 10 µL of 4X Laemmli sample buffer (Bio-Rad, 1610747) and 4 µL of 1 M Dithiothreitol (DTT) were added to the samples before incubating them at 100°C for 5 minutes. Protein samples were sonicated for 10 minutes using a Bioruptor Pico instrument (Diagenode), incubated at 100°C for an additional 5 minutes, and briefly centrifuged. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was performed using 4–20% precast gels (Bio-Rad, 4568094) and Tris/Glycine/SDS running buffer (Bio-Rad, 1610732). Gels were stained with 0.5% Coomassie brilliant blue R-250 (in 45% ethanol, 9% glacial acetic acid, 45% water) with gentle shaking, destained in a 50% methanol, 10% glacial acetic acid, 40% water solution, and finally rinsed in deionized water for at least 1 hour. Gels were imaged using the ImageQuant LAS 4000 instrument (GE Healthcare) and protein bands were identified based on previously published analyses (Sornda et al., 2019). The experiment was performed three times with similar results.
Nile Red staining
Nile Red staining was performed on embryos harvested by hypochlorite treatment as previously described (Escorcia et al., 2018). Isopropanol-fixed embryos were stained for 2 hours with a freshly prepared Nile Red/isopropanol solution (60 μL of 0.5 mg/mL Nile Red stock in 940 µL of 40% isopropanol). The embryos were immediately washed, mounted on agar pads, and imaged using a 20X objective on a Nikon Ti2 widefield microscope equipped with a Hamamatsu ORCA-Fusion BT camera. For image quantification, average fluorescence intensities (mean gray values) were measured by manually circling the embryos (n=50 per genotype) using Fiji (version 2.14.0/1.54f). No background subtraction was performed due to a lack of background fluorescence. The data were plotted as the mean ± SD, outlier data were removed using default parameters, and a one-way ANOVA followed by a Bonferroni's multiple comparisons correction was performed using Prism 10. The experiment was independently replicated three times.
Brood size assay
Twelve animals per genotype were singled to individual plates each day for five days and allowed to lay embryos. Two days after each transfer, when progeny had grown to the L4 stage, the plate was scored for hatched animals. Any mothers that died prior to the final transfer were censored. The total number of hatched progeny was calculated, the data were plotted as the mean ± SD, and a one-way ANOVA followed by a Bonferroni's multiple comparisons correction was performed using Prism 10.
Starvation assays
Hypochlorite treatment was used to isolate embryos from gravid adults and L1s were synchronized in M9 media by overnight rotation at 20°C. The L1 animals were maintained in 15 mL conical tubes containing M9 media without cholesterol (~8 worms/µL) with rotation at 20°C until scoring. On days one, three, five, ten, and fifteen, 100 worms per genotype were dropped onto unseeded plates and scored for movement. Animals that displayed no movement after 10 seconds were considered dead. The experiment was performed three independent times. The percentage of animals alive at each time point was plotted as the mean ± SEM using Prism 10. To compare the survival curves between wild-type and each mutant, we simulated the survival of each genotype for 100 arbitrary individual worms based on the average population-level survival percentages measured at each timepoint and performed a Mantel-Cox log-rank test in Prism, as previously described (Lee and Ashrafi 2008; Zhang et al., 2011).
","reagents":"PRIMERS
Gene | Primer Pair | Annealing Temp (ºC) | Expected Band Sizes (bps) |
For: ATCAGTTGTCCGCGGAATTG | 59 | WT: 2399 | |
For: CATCCTCCCAGTCGATACCC Rev: GGGACATTGGCTCAACTGTG | 59 | WT: 1445 | |
For: TCACATGGAAAACGAGGACA | 59 | WT: 1321 | |
For: TCCGCTTTTTGCAAAGTATC | 56 | - EcoRI: 845 | |
For: TACTTTCAGGTCTCTGGACC | 57 | - EcoRI: 599 | |
For: CAGCACACAAGTTTTCAGGT | 56 | - EcoRI: 361 | |
For: CGCACCCTCGAAGGAGAATG | 59 | - EcoRI: 820 |
CRISPR
Gene(s) | crRNA | ssODN |
ACTTGTCATTGAAACCACAT | GTTCAACTTGTCATTGAAACCGAATTCTAA GTGGCTGGAACCAAGAACACCATTCAACAC | |
TCTACAACCAGGAATTCGAA | CCGAGCTTGTCTACAACCAGGAATTCGAAT AGGCTGAGCAACAATGGGCTCAAACTGGAG |
STRAINS
Strain | Genotype | Available From |
Wild-type | CGC | |
CGC | ||
CGC | ||
CGC | ||
Upon request | ||
vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-1(ok2616) X | Upon request | |
vit-6(rhd332[S320F, W322*]) IV; vit-5(rhd322[T391E, L392F, A393*]) vit-4(rhd321[T391E, L392F, A393*]) vit-3(rhd320[T391E, L392F, A393*]) vit-1(ok2616) X | Upon request |
Vitellogenesis is the process by which nutrients are provisioned to an animal's progeny in the form of yolk, comprised of lipids and vitellogenin lipoproteins (Kimble and Sharrock 1983; Klass et al., 1979; Sharrock 1983; Sharrock et al., 1990). The nematode C. elegans possesses six vitellogenin-encoding (vit) genes, which produce proteins YP170B, encoded by vit-2, YP170A, encoded by vit-3, vit-4, and vit-5, and YP115 and YP88 formed from the cleaved vit-6 gene product (Sharrock 1983; Sharrock et al., 1990). The vit-1 gene is 82% identical to vit-2 (Blumenthal et al., 1984; Perez and Lehner 2019); however, it remains unclear if the mature VIT-1 protein is also 170 kDa. The VIT proteins recruit and transport phospholipids, free fatty acids, and cholesterol in the form of lipoprotein particles from the animal's intestine to the mature oocytes in the gonad (Grant and Hirsh 1999; Hall et al., 1999; Kimble and Sharrock 1983; Perez and Lehner 2019; Sharrock et al., 1990). Lipoproteins are internalized by oocytes via the RME-2 receptor through receptor-mediated endocytosis (Grant and Hirsh 1999). Together, the vitellogenin proteins, which are functional orthologues of the human low-density lipoprotein ApoB (Baker 1988), are required for proper delivery of yolk to the progeny. To date, the vit genes have only been studied individually or tested in tandem using double loss-of-function mutants or RNAi (Ezcurra et al., 2018; Geens et al., 2023; Murphy et al., 2003; Seah et al., 2016; Sornda et al., 2019).
To further understand the physiological consequence of partial loss of vitellogenin protein, we generated a novel strain that contains loss-of-function mutations in five of the six vitellogenin genes (vit-1/3/4/5/6). Taking advantage of the high sequence similarity of the vit-3, vit-4, and vit-5 genes, we simultaneously engineered a premature stop codon into these three vit genes using CRISPR/Cas9 genome editing (Figure 1A). These nonsense mutations were introduced into the vit-1(ok2616) mutant, yielding the vit-1/3/4/5 mutant. After verifying the quadruple mutant strain by genotyping and Sanger sequencing of each locus, we engineered a premature stop codon mutation into the vit-6 locus via CRISPR/Cas9 (Figure 1A), thereby generating the vit-1/3/4/5/6 quintuple mutant.
To validate that our loss-of-function alleles reduced VIT protein production, we stained SDS-PAGE gels containing protein lysates from wild-type animals, the rme-2(b1008) mutant, the vit-2 vit-1 double mutant, and the vit-1/3/4/5/6 quintuple mutant with Coomassie blue to visualize the highly abundant yolk proteins (Figure 1B). Yolk proteins have established molecular weights of 170 kDa (YP170A and YP170B), 115 kDa (YP115), and 88 kDa (YP88) and are easily visualized by Coomassie staining of SDS-PAGE gels (Sharrock 1983). The rme-2(b1008) mutant displayed increased VIT protein levels compared to wild-type, which is expected given that oocytes lacking the RME-2 receptor are unable to clear yolk from the body cavity (Grant and Hirsh 1999). In contrast, the vit-1/3/4/5/6 quintuple mutant displayed severe reductions in VIT protein levels compared to wild-type (Figure 1B). These results are consistent with previous studies, where animals subjected to vit-5 and/or vit-6 RNAi showed a decrease in the amount of yolk proteins relative to controls when analyzed by Coomassie blue staining (Geens et al., 2023; Sornda et al., 2019). Notably, the vit-2 vit-1 double mutant showed little impairment in yolk protein synthesis, suggesting that vit-3-6 may compensate for their loss. Furthermore, we did not observe any increase in YP115 or YP88 levels in the vit-2 vit-1 double mutant, which has been previously observed in older adult animals subjected to vit-5 RNAi (Sornda et al., 2019). While we are confident that the vit-1/3/4/5/6 mutations severely decrease yolk production, we predict that synthesis of YP170B, encoded by the vit-2 gene, remains unaffected in this strain. Moreover, we are unable to eliminate the possibility that some VIT-3/4/5/6 protein is synthesized in these animals due to stop codon readthrough.
Given that yolk is responsible for the deposition of lipids into the mature oocyte, we hypothesized that partial loss of the vit genes would result in lower amounts of embryonic lipids. Using Nile Red to stain neutral lipids and triglycerides, we found that the vit mutant embryos exhibited lower amounts of Nile Red fluorescence relative to wild-type across three independent experiments, indicating that lipid levels were reduced in vit mutant embryos (Figure 1C). We observed a similar phenotype in the rme-2 mutant. Notably, we only found an average reduction of 32% and 21% in Nile Red staining for the vit-1/3/4/5/6 and the rme-2 mutant, respectively, suggesting that additional mechanisms of lipid deposition or de novo synthesis compensate for loss of vitellogenesis.
Despite its role in intergenerational nutrient allocation, it has been previously reported that reduced vitellogenin gene expression does not dramatically alter progeny production (Dowen 2019; Ezcurra et al., 2018; Van Rompay et al., 2015). However, animals lacking rme-2 have dramatically reduced brood sizes (Dowen 2019; Grant and Hirsh 1999). Therefore, we measured the brood size of the vit-2 vit-1 double mutant and the vit-1/3/4/5/6 quintuple mutant and compared them to the broods produced by wild-type and rme-2 animals (Figure 1D). Intriguingly, the vit mutants produced near wild-type broods while the rme-2 mutant was nearly sterile, suggesting that the brood size defect of rme-2 animals is not solely explained by the lack of yolk protein delivery. These results are consistent with those previously described for other vitellogenesis mutants, such as vrp-1 and ceh-60 (Dowen 2019; Van Rompay et al., 2015). Finally, our data suggest that RME-2 plays multiple roles in the germline, consistent with previous findings that it also functions in spermathecal valve dilation and ovulation (Chi and Reinke 2009; Grant and Hirsh 1999).
Some vitellogenesis mutants have been shown to have deficiencies in maintaining progeny fitness, including a reduced ability to survive starvation at the L1 larval stage (Chotard et al., 2010; Geens et al., 2023; Van Rompay et al., 2015). Consistently, wild-type larvae that receive a lower dose of yolk as embryos have reduced fitness relative to their siblings that receive higher doses (Perez et al., 2017). Thus, we tested whether our vit mutants displayed reduced survival during L1 starvation. Indeed, the vit-1/3/4/5/6 mutant exhibited lower L1 survival (54%) compared to wild-type (91%) at day 10 of starvation, which persisted to day 15 (Figure 1E). The vit-1/3/4/5/6 survival phenotype was more severe than that of the vit-2 vit-1 double mutant; however, no mutant reached the levels of rme-2 mutant, which had a mean survival of 5% by day 10 and no surviving progeny by day 15 (Figure 1E). Together, these data indicate that reduced yolk provisioning, conferred by either mutation of the vit-1/3/4/5/6 genes or rme-2, impairs L1 starvation survival.
It is surprising that the vit-1/3/4/5/6 mutant does not closely phenocopy the rme-2 mutant, as both mutants display a deficit in yolk provisioning to the offspring. The dramatic difference in brood size can perhaps be accredited to a defect in the spermatheca valve leading to oocyte damage in the rme-2 mutant (Chi and Reinke 2009); however, an explanation for why the rme-2 mutant displays more severe L1 survival phenotypes compared to the vit-1/3/4/5/6 mutant requires additional studies. One intriguing possibility is that the RME-2 receptor facilitates the uptake of molecules other than yolk. A recent study found that 5-carboxyfluorescein (5-CF), a small membrane-impermeable fluorescent molecule, can be transported from the intestine to the oocyte via RME-2 (Turmel-Couture et al., 2024). While it is possible that 5-CF is transported to the germline within yolk particles, it is also possible that RME-2 mediates the uptake of molecules independent of yolk. Thus, additional research is needed to elucidate the full suite of molecules that can be endocytosed by RME-2 in the oocytes.
The vit-1/3/4/5/6 mutant strain provides a useful avenue to explore the metabolic dysfunction in vitellogenin-depleted animals. Using Nile Red staining, we found that upon reduction of vitellogenin protein, embryos still have a substantial amount of lipids, suggesting that multiple lipid synthesis pathways contribute to maternal nutrient provisioning. It is possible that VIT-2 alone is sufficient to deliver lipids to oocytes in the vit-1/3/4/5/6 mutant via the established vitellogenesis pathway. However, an alternative mechanism for maternal deposition of lipids into the C. elegans germline is through the delivery of malonyl-CoA via gap junctions. Malonyl-CoA is produced in the somatic sheath cells and transported out of the somatic cells by the INX-8/INX-9 hemichannels and into the germline by the INX-14/INX-21 hemichannels (Starich et al., 2020). Malonyl-CoA can then be used in the germline and embryos to fuel fatty acid synthesis via de novo lipogenesis, which is critical for proper embryonic development (Starich et al., 2020). Perhaps this pathway is heavily utilized when yolk protein expression is reduced, as in the vit-1/3/4/5/6 or rme-2 mutants.
Here, we used CRISPR-Cas9 genome editing to generate a novel mutant strain containing nonsense mutations in the vit-3, vit-4, vit-5, and vit-6 genes, which were combined with the previously established vit-1(ok2616) loss-of-function mutation, to yield the quintuple vit-1/3/4/5/6 mutant. Our results indicate that depletion of five of the six vitellogenin proteins does not confer an abnormal brood size, but rather, the progeny exhibit a reduction in fitness during L1 starvation. While our well-fed conditions support efficient propagation of this strain in the laboratory, it is likely that these animals would be at a severe disadvantage in the wild where maternal provisioning of lipids is likely crucial for progeny survival during adverse or stressful conditions. This strain will be a useful resource to other research labs interested in investigating the metabolic tradeoffs during development, reproduction, and aging.
","references":[{"reference":"Baker ME. 1988. Is vitellogenin an ancestor of apolipoprotein B-100 of human low-density lipoprotein and human lipoprotein lipase? Biochem J 255(3): 1057-60.
","pubmedId":"3145737","doi":""},{"reference":"Blumenthal T, Squire M, Kirtland S, Cane J, Donegan M, Spieth J, Sharrock W. 1984. Cloning of a yolk protein gene family from Caenorhabditis elegans. J Mol Biol 174(1): 1-18.
","pubmedId":"6546952","doi":""},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77(1): 71-94.
","pubmedId":"4366476","doi":""},{"reference":"Chi W, Reinke V. 2009. DPL-1 (DP) acts in the germ line to coordinate ovulation and fertilization in C. elegans. Mech Dev 126(5-6): 406-16.
","pubmedId":"19368797","doi":""},{"reference":"Chotard L, Skorobogata O, Sylvain MA, Shrivastava S, Rocheleau CE. 2010. TBC-2 is required for embryonic yolk protein storage and larval survival during L1 diapause in Caenorhabditis elegans. PLoS One 5(12): e15662.
","pubmedId":"21203392","doi":""},{"reference":"Dowen RH. 2019. CEH-60/PBX and UNC-62/MEIS Coordinate a Metabolic Switch that Supports Reproduction in C. elegans. Dev Cell 49(2): 235-250.e7.
","pubmedId":"30956009","doi":""},{"reference":"Escorcia W, Ruter DL, Nhan J, Curran SP. 2018. Quantification of Lipid Abundance and Evaluation of Lipid Distribution in Caenorhabditis elegans by Nile Red and Oil Red O Staining. J Vis Exp(133): 10.3791/57352.
","pubmedId":"29553519","doi":""},{"reference":"Ezcurra M, Benedetto A, Sornda T, Gilliat AF, Au C, Zhang Q, et al., Gems D. 2018. C. elegans Eats Its Own Intestine to Make Yolk Leading to Multiple Senescent Pathologies. Curr Biol 28(16): 2544-2556.e5.
","pubmedId":"30100339","doi":""},{"reference":"Geens E, Van de Walle P, Caroti F, Jelier R, Steuwe C, Schoofs L, Temmerman L. 2023. Yolk-deprived Caenorhabditis elegans secure brood size at the expense of competitive fitness. Life Sci Alliance 6(6): 10.26508/lsa.202201675.
","pubmedId":"37059473","doi":""},{"reference":"Ghanta KS, Mello CC. 2020. Melting dsDNA Donor Molecules Greatly Improves Precision Genome Editing in Caenorhabditis elegans. Genetics 216(3): 643-650.
","pubmedId":"32963112","doi":""},{"reference":"Grant B, Hirsh D. 1999. Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol Biol Cell 10(12): 4311-26.
","pubmedId":"10588660","doi":""},{"reference":"Hall DH, Winfrey VP, Blaeuer G, Hoffman LH, Furuta T, Rose KL, Hobert O, Greenstein D. 1999. Ultrastructural features of the adult hermaphrodite gonad of Caenorhabditis elegans: relations between the germ line and soma. Dev Biol 212(1): 101-23.
","pubmedId":"10419689","doi":""},{"reference":"Kimble J, Sharrock WJ. 1983. Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans. Dev Biol 96(1): 189-96.
","pubmedId":"6825952","doi":""},{"reference":"Klass MR, Wolf N, Hirsh D. 1979. Further characterization of a temperature-sensitive transformation mutant in Caenorhabditis elegans. Dev Biol 69(1): 329-35.
","pubmedId":"446897","doi":""},{"reference":"Lee BH, Ashrafi K. 2008. A TRPV channel modulates C. elegans neurosecretion, larval starvation survival, and adult lifespan. PLoS Genet 4(10): e1000213.
","pubmedId":"18846209","doi":""},{"reference":"Murphy CT, McCarroll SA, Bargmann CI, Fraser A, Kamath RS, Ahringer J, Li H, Kenyon C. 2003. Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature 424(6946): 277-83.
","pubmedId":"12845331","doi":""},{"reference":"Perez MF, Francesconi M, Hidalgo-Carcedo C, Lehner B. 2017. Maternal age generates phenotypic variation in Caenorhabditis elegans. Nature 552(7683): 106-109.
","pubmedId":"29186117","doi":""},{"reference":"Perez MF, Lehner B. 2019. Vitellogenins - Yolk Gene Function and Regulation in Caenorhabditis elegans. Front Physiol 10: 1067.
","pubmedId":"31551797","doi":""},{"reference":"Seah NE, de Magalhaes Filho CD, Petrashen AP, Henderson HR, Laguer J, Gonzalez J, et al., Lapierre LR. 2016. Autophagy-mediated longevity is modulated by lipoprotein biogenesis. Autophagy 12(2): 261-72.
","pubmedId":"26671266","doi":""},{"reference":"Sharrock WJ. 1983. Yolk proteins of Caenorhabditis elegans. Dev Biol 96(1): 182-8.
","pubmedId":"6337890","doi":""},{"reference":"Sharrock WJ, Sutherlin ME, Leske K, Cheng TK, Kim TY. 1990. Two distinct yolk lipoprotein complexes from Caenorhabditis elegans. J Biol Chem 265(24): 14422-31.
","pubmedId":"2387862","doi":""},{"reference":"Sornda T, Ezcurra M, Kern C, Galimov ER, Au C, de la Guardia Y, Gems D. 2019. Production of YP170 Vitellogenins Promotes Intestinal Senescence in Caenorhabditis elegans. J Gerontol A Biol Sci Med Sci 74(8): 1180-1188.
","pubmedId":"30854561","doi":""},{"reference":"Starich TA, Bai X, Greenstein D. 2020. Gap junctions deliver malonyl-CoA from soma to germline to support embryogenesis in Caenorhabditis elegans. Elife 9: 10.7554/eLife.58619.
","pubmedId":"32735213","doi":""},{"reference":"Turmel-Couture S, Martel PO, Beaulieu L, Lechasseur X, Fotso Dzuna LV, Narbonne P. 2024. Bidirectional transfer of a small membrane-impermeable molecule between the Caenorhabditis elegans intestine and germline. J Biol Chem 300(12): 107963.
","pubmedId":"39510179","doi":""},{"reference":"Van Rompay L, Borghgraef C, Beets I, Caers J, Temmerman L. 2015. New genetic regulators question relevance of abundant yolk protein production in C. elegans. Sci Rep 5: 16381.
","pubmedId":"26553710","doi":""},{"reference":"Zhang X, Zabinsky R, Teng Y, Cui M, Han M. 2011. microRNAs play critical roles in the survival and recovery of Caenorhabditis elegans from starvation-induced L1 diapause. Proc Natl Acad Sci U S A 108(44): 17997-8002.
","pubmedId":"22011579","doi":""}],"suggestedReviewer":{"name":"Liesbet Temmerman, 0000-0002-1249-3995, liesbet.temmerman@kuleuven.be
Barth Grant, grant@dls.rutgers.edu
","WBId":""},"title":"Partial loss of the vitellogenins confers a fitness disadvantage but does not impact brood size in C. elegans
","reviews":[]}]}}},"pageContext":{"id":"39c2df92-2dab-4653-9e3c-6bde52280dfc","correctionId":"micropub-biology-002461"}}, "staticQueryHashes": ["2114697108"]}