<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/archiving/1.2/JATS-archivearticle1.dtd">
<article article-type="brief-report" xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>microPublication Biology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2578-9430</issn>
      <publisher>
        <publisher-name>Caltech Library</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.17912/micropub.biology.002083</article-id>
      <article-id pub-id-type="accession" assigning-authority="wormbase">WBPaper00069536</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>new finding</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>phenotype data</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>c. elegans</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Identification of a potential internalization or endocytic compartment-targeting signal in the C-terminal tail of the tetraspanin protein TSP-12</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Liu</surname>
            <given-names>Zhiyu</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization">Visualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Williams</surname>
            <given-names>Byron</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Liu</surname>
            <given-names>Jun</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition">Funding acquisition</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision">Supervision</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration">Project administration</role>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="corresp" rid="cor1">§</xref>
        </contrib>
        <aff id="aff1">
          <label>1</label>
          Department of Molecular Biology and Genetics, Cornell University
        </aff>
      </contrib-group>
      <contrib-group>
        <contrib contrib-type="reviewer">
          <anonymous/>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor1">
          <label>§</label>
          Correspondence to: Jun Liu (
          <email>kelly.jun.liu@cornell.edu</email>
          )
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there are no conflicts of interest present.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>24</day>
        <month>4</month>
        <year>2026</year>
      </pub-date>
      <pub-date date-type="collection" publication-format="electronic">
        <year>2026</year>
      </pub-date>
      <volume>2026</volume>
      <elocation-id>10.17912/micropub.biology.002083</elocation-id>
      <history>
        <date date-type="received">
          <day>26</day>
          <month>2</month>
          <year>2026</year>
        </date>
        <date date-type="rev-recd">
          <day>23</day>
          <month>4</month>
          <year>2026</year>
        </date>
        <date date-type="accepted">
          <day>23</day>
          <month>4</month>
          <year>2026</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2026 by the authors</copyright-statement>
        <copyright-year>2026</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          Tetraspanins are unique yet highly conserved four-pass transmembrane proteins that play important roles in diverse biological processes. The 
          <italic>
            <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
          </italic>
           tetraspanin protein 
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
           is localized both at the cell surface and in multiple intracellular compartments, including different endosomal vesicles and the Golgi. In this study, we found that mutating key residues in the short C-terminal intracellular domain of 
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
           (ILxxxxxWYY) led to an increase of cell surface localization of 
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
           without affecting its localization in the ER or Golgi. These observations suggest that the ILxxxxxWYY motif in 
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
           represents a potential internalization or endocytic compartment-targeting signal.
        </p>
      </abstract>
      <funding-group>
        <award-group>
          <funding-source>
            <institution-wrap>
              <institution>National Institutes of Health (United States)</institution>
              <institution-id>https://ror.org/01cwqze88</institution-id>
            </institution-wrap>
          </funding-source>
          <award-id>R35 GM130351 </award-id>
          <principal-award-recipient>Jun Liu</principal-award-recipient>
        </award-group>
        <funding-statement>This work was supported by the National Institutes of Health R35 GM130351 grant to J.L.</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <fig position="anchor" id="f1">
      <label>Figure 1. Imaging and western blotting results showing that mutations in the C-terminal tail of TSP-12 lead to increased localization of TSP-12 at or near the cell surface</label>
      <caption>
        <p>
          <bold>A</bold>
          ) Predicted structure of TSP-12 by AlphaFold3. Both the N- (green) and C- (yellow) termini of TSP-12 are localized to the cytoplasmic side. Two extracellular domains, LEL (large extracellular loop) and SEL (small extracellular loop), are shown in orange and dark blue, respectively. Four transmembrane (TM) α-helices are colored in royal blue. The putative sorting signals in the C-terminus are labeled in red (arrows). 
          <bold>B</bold>
          ) The amino acid sequence of TSP-12 with the transmembrane domains shown in royal blue and the 5 amino acids, IL and WYY, shown in red. 
          <bold>C</bold>
          ) The C-terminal tail amino acid sequence of TSP-12 showing mutation of IL and WYY in wild-type (WT) to AA and AAA (red) in TSP-12(5A mut). D) Western blot showing GFP::TSP-12 protein and GFP::TSP-12(5A mut) protein probed with anti-GFP antibodies. CGC1 worms do not express GFP::TSP-12 and are used as a negative control. 40 μg total protein (equivalent to ~200 young adult hermaphrodites) are used in each lane. Samples of each genotype were run in duplicate lanes. * marks non-specific, anti-GFP antibody cross-reacting band. MW, molecular weight ladder. Actin is used as the protein loading control. Compared to WT, the amount of the ~55kDa band is decreased while levels of ~60kDa bands are increased for GFP::TSP-12 in 
          <italic>tsp-12(5A mut)</italic>
           mutant. In addition, the GFP::TSP-12(5A mut) protein migrates slightly faster than the wild-type protein, as compared to the mobility of the non-specific (*) and actin bands. 
          <bold>E-H</bold>
          ) and 
          <bold>M-P</bold>
          ) Airyscan confocal images showing localization of GFP::TSP-12 (E-H), SUP-17::GFP (M-P), with the ER and 
          <italic>cis</italic>
          -Golgi marker mCherry::RER-1 (E'-P') in early embryos (E-F, M-N) and&amp;nbsp; proximal oocytes (G-H, O-P). Scale bar, 10μm. 
          <bold>I-L) and Q-T</bold>
          ) Quantification of normalized cell surface over cytoplasmic localization of TSP-12 (I, K) and SUP-17 (Q, S), with the respective wild-type value set as 1.00, and the colocalization of TSP-12 (J, L) or SUP-17 (R, T) with RER-1. Pearson's coefficients indicate the correlated relationship between GFP::TSP-12 or SUP-17::GFP and mCherry::RER-1. Manders' M1 indicates the fraction of GFP::TSP-12 or SUP-17::GFP that is colocalized with mCherry::RER-1. Manders' M2 indicates the fraction of mCherry::RER-1 that is colocalized with GFP::TSP-12 or SUP-17::GFP. Manders' Colocalization Coefficients (M1 and M2) were determined by specifically quantifying the punctate signal of mCherry::RER-1, which labels the 
          <italic>cis</italic>
          -Golgi. Statistical analysis was conducted using R by comparing 5A mutant embryos/germlines with WT embryos/germlines using ANOVA followed by Tukey HSD. 
          <sup>***</sup>
          <italic>P</italic>
           &lt; 0.001; 
          <sup>* </sup>
          0.01&lt; 
          <italic>P</italic>
           &lt; 0.05; n.s., no significant difference.
        </p>
      </caption>
    </fig>
    <graphic xlink:href="25789430-2026-micropub.biology.002083"/>
    <sec>
      <title>Description</title>
      <p>
        Transmembrane proteins targeted for the secretory pathway, cell surface, or endosomal compartments involve precise sorting mechanisms. Nascent cargo proteins undergo quality control within the endoplasmic reticulum (ER) to ensure correct folding and modification. Following this, export-competent proteins accumulate at ER export sites (ERES) and traverse the ER-Golgi interface via coat protein complex II (COPII)-coated vesicles (Farhan et al., 2025; Watson et al., 2025). The cargo proteins then undergo anterograde transport through the Golgi, being further modified via glycosylation before reaching the 
        <italic>trans</italic>
        -Golgi network (TGN). As the primary sorting hub, the TGN distributes cargo proteins to the plasma membrane, secretory granules, or the endolysosomal system. Meanwhile, retrograde trafficking retrieves escaped ER proteins or recycles Golgi-resident proteins (Dancourt and Barlowe 2010; Downes and Zanetti 2025). A number of targeting signals on cargo proteins have been identified to serve either as export signals, retention or retrieval motifs, or internalization and/or endolysosomal sorting signals (Dell et al., 2019). For example, cytosolic export signals, such as di-acidic [e.g., (D/E)x(D/E), x stands for any amino acid], di-hydrophobic(e.g., LL, IL), or di-aromatic motifs (e.g., FF, YY, LxxLE), are known to recruit the Sec23/Sec24 subunits of the COPII complex at ER export sites for efficient ER exit of cargo proteins (Barlowe 2003; Malhotra 2024). Conversely, cytosolic KKxx motifs (which recruit COPI for ER retrieval), luminal KDEL motifs (which are recognized by the KDEL receptor), and Golgi-retention signals such as the Vps74/GOLPH3-binding motif [(F/L)(L/I/V)xx(R/K)] (Gomez-Navarro and Miller 2016; Tu et al., 2008), serve as retention or retrieval signals for maintaining ER or Golgi localization of cargo proteins (Watson et al., 2025). Additionally, transmembrane proteins can be recycled through a cycle of endocytosis, sorting in early endosomes, and recycling back to the cell surface via either recycling endosomes or the retromer pathways. Motifs such as NPxY, YxxØ (Ø: an amino acid with a bulky hydrophobic side chain), [DE]xxxL[LI], and DxxLL have been found to serve either as internalization or endolysosomal targeting signals (Bonifacino and Traub 2003; Hsu et al., 2012; Kelly and Owen 2011).
      </p>
      <p>
        We have been studying a highly conserved tetraspanin protein 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
         in 
        <italic>
          <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
        </italic>
        (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
         and its paralog 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006640">TSP-14</ext-link>
         function redundantly to regulate both Notch signaling and BMP signaling (Dunn et al., 2010; Liu et al., 2020; Wang et al., 2017). Our previous work has shown that 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
         is localized to multiple cellular compartments, including the cell surface, the Golgi, and early, late and recycling endosomes (Liu et al., 2020; Liu et al., 2026; Wang et al., 2017). When analyzing the protein sequence of 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
        , we found two putative COPII (ER to Golgi) sorting motifs in the C-terminal tail of 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
        , IL and WYY (ILxxxxxWYY, 
        <xref ref-type="fig" rid="f1">Figure 1B</xref>
        ). To test the importance of these motifs for the localization and function of 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
        , we first used CRISPR/Cas9 to change the IL and the WYY residues to alanines in an endogenous GFP::TSP-12 background, generating the "5A mutant" (abbreviated 5A mut; 
        <xref ref-type="fig" rid="f1">Figure 1C</xref>
        ). The “5A mutant” animals do not have any detectable phenotypes. To our surprise, in both early embryos and proximal oocytes, GFP::TSP-12(5A mut) does not appear to accumulate in either the ER or the
        <italic> cis</italic>
        -Golgi compared to wild-type (WT) GFP::TSP-12. Instead, there is increased localization of GFP::TSP-12(5A mut) at or near the cell surface (Figure1E-L). &amp;nbsp;These observations suggest that the ILxxxxxWYY motif is unlikely to be a sorting motif for the ER-to-Golgi trafficking of 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
        .&amp;nbsp;
      </p>
      <p>
        We have previously shown that on western blots, WT GFP::TSP-12 can be detected as two major bands at around 60kDa, representing both glycosylated and un-glycosylated forms of GFP::TSP-12, as well as a band near 55kDa (Liu et al., 2026). As shown in 
        <xref ref-type="fig" rid="f1">Figure 1D,</xref>
         we observed a decrease in the amount of the ~55kDa band and an increase in the amount and a downward mobility shift of the 60kDa bands in the GFP::TSP-12(5A mut) lane compared to the WT GFP::TSP-12 lane. The downward mobility shift may indicate differential glycosylation in the 5A mut, or may be simply due to the amino acid changes altering migration of the mutant protein in the gel. Because the ~55kDa band is absent in 
        <italic>
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00006324">sup-17</ext-link>
          (ts)
        </italic>
         mutants at the restrictive temperature when GFP::TSP-12 protein is accumulated in the ER, we speculated previously that the ~55kDa band may represent a cleaved form of GFP::TSP-12 produced after the protein has trafficked past the Golgi, possibly due to endocytic processing (Liu et al., 2026). The reduced amount of this ~55kDa band, along with increased level and near cell surface localization of GFP::TSP-12(5A mut) is consistent with this hypothesis, suggesting that the increased GFP::TSP-12(5A mut) protein near the cell surface might be a consequence of the GFP::TSP-12(5A mut) mutant protein unable to be internalized or unable to be sorted to various endosomal compartments.&amp;nbsp;
      </p>
      <p>
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
         and 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006324">SUP-17</ext-link>
        /ADAM10 are known to exhibit cell type-specific interdependence in their trafficking through the Golgi (Liu et al., 2026). To determine whether increased localization of 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
        (5A mut) near the cell surface affects 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006324">SUP-17</ext-link>
         localization, we next generated 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
        (5A mut) mutation in the untagged 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
         background and examined SUP-17::GFP localization. As shown in Figure 1(M-T), the 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
        (5A mut) mutation did not significantly alter the cell surface or intracellular localization of SUP-17::GFP in either embryos or proximal oocytes. &amp;nbsp;
      </p>
      <p>
        In summary, we have identified a putative internalization or endocytic compartment-targeting signal in the C-terminal tail of the tetraspanin protein 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
        . The ILxxxxxWYY motif has similarities to, but is not identical to, previously identified internalization or endolysosomal targeting motifs (NPxY, YxxØ, [DE]xxxL[LI], and DxxLL). Future work will be needed to identify the specific coat protein complexes that mediate 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
         internalization or targeting to the endocytic compartment.
      </p>
    </sec>
    <sec>
      <title>Methods</title>
      <p>
        All 
        <italic>
          <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
        </italic>
         strains used in this study were derived from 
        <ext-link ext-link-type="wormbase" xlink:href="WBStrain00054690">CGC1</ext-link>
         (Ichikawa et al., 2025), and were maintained at 20°C (unless otherwise noted
        <italic>
          ). 
          <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
        </italic>
         strains used and generated in this study are summarized under Reagents.
      </p>
      <p>
        <bold>CRISPR/Cas9 experiments</bold>
      </p>
      <p>CRISPR/Cas9 experiments were conducted by following the protocol described in (Liu et al., 2026). The genotypes of the final strains were confirmed through Sanger sequencing. Oligonucleotides used in this study are summarized under Reagents.</p>
      <p>
        <bold>Live imaging and image analysis</bold>
      </p>
      <p>Imaging experiments and subsequent image analysis were conducted by following the protocol described in (Liu et al., 2026).</p>
      <p>
        <bold>Western blot analysis</bold>
      </p>
      <p>Western blot experiments were conducted by following the protocol described in (Liu et al., 2026). Goat anti-GFP (Rockland Immunochemicals, Item No. 600-101-215) (1:3,000), mouse anti-actin IgM (JLA20, Developmental Studies Hybridoma Bank) (1:2,000), HRP-conjugated donkey anti-goat IgG (Jackson Immunoresearch) (1:10,000), and IRdye 800CW-conjugated goat anti-mouse IgM (Licor) (1:10,000) were used.</p>
    </sec>
    <sec>
      <title>Reagents</title>
      <p>
        <bold>Strains used in this study:</bold>
      </p>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>
                  <bold>STRAIN</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>GENOTYPE</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW3705</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006324">sup-17</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147525">jj98</ext-link>
                    [SUP-17::GFP])
                  </italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW4453</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147524">jj181</ext-link>
                    [GFP::3xFLAG::TSP-12])
                  </italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>GK171 (LW7015)</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBTransgene00021508">dkIs91</ext-link>
                    (pie-1p::mCherry::RER-1) 
                  </italic>
                  [Gift from Ken Sato (Sakaguchi et al., 2015)]
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW7039</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006324">sup-17</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147525">jj98</ext-link>
                    [SUP-17::GFP]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBTransgene00021508">dkIs91</ext-link>
                    (pie-1p::mCherry::RER-1) isolate #1
                  </italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW7040</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006324">sup-17</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147525">jj98</ext-link>
                    [SUP-17::GFP]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBTransgene00021508">dkIs91</ext-link>
                    (pie-1p::mCherry::RER-1) isolate #2
                  </italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW7178</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006324">sup-17</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147525">jj98</ext-link>
                    [SUP-17::GFP]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                    (jj551[5A mut]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBTransgene00021508">dkIs91</ext-link>
                    (pie-1p::mCherry::RER-1)
                  </italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW7179</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006324">sup-17</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147525">jj98</ext-link>
                    [SUP-17::GFP]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                    (jj552[5A mut]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBTransgene00021508">dkIs91</ext-link>
                    (pie-1p::mCherry::RER-1)
                  </italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW7037</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147524">jj181</ext-link>
                    [GFP::3xFLAG::TSP-12]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBTransgene00021508">dkIs91</ext-link>
                    (pie-1p::mCherry::RER-1) isolate #1
                  </italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW7038</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147524">jj181</ext-link>
                    [GFP::3xFLAG::TSP-12]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBTransgene00021508">dkIs91</ext-link>
                    (pie-1p::mCherry::RER-1) isolate #2
                  </italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW7180</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147524">jj181</ext-link>
                     jj553[GFP::3xFLAG::TSP-12 (5A mut]]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBTransgene00021508">dkIs91</ext-link>
                    (pie-1p::mCherry::RER-1)
                  </italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>LW7181</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                    (
                    <ext-link ext-link-type="wormbase" xlink:href="WBVar02147524">jj181</ext-link>
                     jj554[GFP::3xFLAG::TSP-12 (5A mut]); 
                    <ext-link ext-link-type="wormbase" xlink:href="WBTransgene00021508">dkIs91</ext-link>
                    (pie-1p::mCherry::RER-1)
                  </italic>
                </p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>
        <bold>&amp;nbsp;</bold>
      </p>
      <p>
        <bold>Oligonucleotides used in this study:</bold>
      </p>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td colspan="3">
                <p>
                  <bold>Oligonucleotides used for genotyping</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>
                  <bold>
                    <italic>
                      <ext-link ext-link-type="wormbase" xlink:href="WBGene00006324">sup-17</ext-link>
                      (
                      <ext-link ext-link-type="wormbase" xlink:href="WBVar02147525">jj98</ext-link>
                      [SUP-17::GFP])
                    </italic>
                  </bold>
                </p>
              </td>
              <td>
                <p>LW27 (ATCCAGGATCAGCAGCTGTA, R)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>
                  <bold>&amp;nbsp;</bold>
                </p>
              </td>
              <td>
                <p>LW30 (AAGTGTTGCGCTGTACACAC, F)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>
                  <bold>&amp;nbsp;</bold>
                </p>
              </td>
              <td>
                <p>JKL-269 (AAGCGTTCAACTAGCAGACC, F)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>
                  <bold>
                    <italic>
                      <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                      (
                      <ext-link ext-link-type="wormbase" xlink:href="WBVar02147524">jj181</ext-link>
                      [GFP::3xFLAG::TSP-12])
                    </italic>
                  </bold>
                </p>
              </td>
              <td>
                <p>ZL431 (GGAGAATCTGTACTTTCAATCCGG, F)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>
                  <bold>&amp;nbsp;</bold>
                </p>
              </td>
              <td>
                <p>ZL374 (CCCTCTGCTGTGCTCTGTGTTGC, R)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>
                  <bold>&amp;nbsp;</bold>
                </p>
              </td>
              <td>
                <p>ZL375 (CTGAAGGGGAACATTTCTTTCCTGG, F)</p>
              </td>
            </tr>
            <tr>
              <td colspan="3">
                <p>
                  <bold>
                    <italic>
                      <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                      (jj551/jj552/jj553/jj554[
                      <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">TSP-12</ext-link>
                      (5A mut)])
                    </italic>
                  </bold>
                </p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>Genotyping</p>
              </td>
              <td>
                <p>ZL1045 (GTGACCGGCATAGGCTGTG, R)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>&amp;nbsp;</p>
              </td>
              <td>
                <p>ZL1046 (GTAGCCGTTTCGATGGTTATTATTGC, F)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>&amp;nbsp;</p>
              </td>
              <td>
                <p>ZL1060 (TCAACGGGCAAAATGGTATTAT, F)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>Sequencing</p>
              </td>
              <td>
                <p>ZL1024 (CAATAGAAGCCAGAGAAGTGGC, F)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>
                  <bold>&amp;nbsp;</bold>
                </p>
              </td>
              <td>
                <p>ZL1045 (GTGACCGGCATAGGCTGTG, R)</p>
              </td>
            </tr>
            <tr>
              <td colspan="2">
                <p>
                  <bold>&amp;nbsp;</bold>
                </p>
              </td>
              <td>
                <p>followed by sequencing using ZL1024</p>
              </td>
            </tr>
            <tr>
              <td colspan="3">
                <p>
                  <bold>
                    Oligonucleotides used for generating 
                    <italic>
                      <ext-link ext-link-type="wormbase" xlink:href="WBGene00006638">tsp-12</ext-link>
                      (5A mut)
                    </italic>
                     using CRISPR-Cas9
                  </bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>sgRNA (ZL1043)</p>
              </td>
              <td colspan="2">
                <p>ATCGGACATACTCGCTCAAC</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>Repair template</p>
                <p>(ZL1042)</p>
              </td>
              <td colspan="2">
                <p>AGGTTCTCGGTATCTGTTTCGCTCAAAATCTCAAATCTGATGCTGCCGCCCAGCGTGCAAAAGCTGCCGCTACCCATTAATCAATCAAATAATCAATTAATCAACG</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <p>We thank Scott Emr, Chris Fromme, and the rest of the Liu lab for discussions, Ken Sato for the mCherry::RER-1 strain, CGC (which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440)) for the CGC1 strain, and WormBase (grant U24HG002223) for providing genetic data and annotation services. The confocal imaging data was acquired through the Cornell University Biotechnology Resource Center, with NYSTEM (CO29155) and NIH (S10OD018516) funding for the shared Zeiss LSM880 confocal/multiphoton microscope.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="R1">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Barlowe</surname>
              <given-names>C</given-names>
            </name>
          </person-group>
          <year>2003</year>
          <month>6</month>
          <day>1</day>
          <article-title>Signals for COPII-dependent export from the ER: what's the ticket out?</article-title>
          <source>Trends in Cell Biology</source>
          <volume>13</volume>
          <issue>6</issue>
          <issn>0962-8924</issn>
          <fpage>295</fpage>
          <lpage>300</lpage>
          <pub-id pub-id-type="doi">10.1016/s0962-8924(03)00082-5</pub-id>
        </element-citation>
      </ref>
      <ref id="R2">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bonifacino</surname>
              <given-names>JS</given-names>
            </name>
            <name>
              <surname>Traub</surname>
              <given-names>LM</given-names>
            </name>
          </person-group>
          <year>2003</year>
          <month>3</month>
          <day>6</day>
          <article-title>Signals for sorting of transmembrane proteins to endosomes and lysosomes.</article-title>
          <source>Annu Rev Biochem</source>
          <volume>72</volume>
          <issn>0066-4154</issn>
          <fpage>395</fpage>
          <lpage>447</lpage>
          <pub-id pub-id-type="doi">10.1146/annurev.biochem.72.121801.161800</pub-id>
          <pub-id pub-id-type="pmid">12651740</pub-id>
        </element-citation>
      </ref>
      <ref id="R3">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dancourt</surname>
              <given-names>Julia</given-names>
            </name>
            <name>
              <surname>Barlowe</surname>
              <given-names>Charles</given-names>
            </name>
          </person-group>
          <year>2010</year>
          <month>6</month>
          <day>7</day>
          <article-title>Protein Sorting Receptors in the Early Secretory Pathway</article-title>
          <source>Annual Review of Biochemistry</source>
          <volume>79</volume>
          <issue>1</issue>
          <issn>0066-4154</issn>
          <fpage>777</fpage>
          <lpage>802</lpage>
          <pub-id pub-id-type="doi">10.1146/annurev-biochem-061608-091319</pub-id>
        </element-citation>
      </ref>
      <ref id="R4">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dell'Angelica</surname>
              <given-names>Esteban C.</given-names>
            </name>
            <name>
              <surname>Bonifacino</surname>
              <given-names>Juan S.</given-names>
            </name>
          </person-group>
          <year>2019</year>
          <month>10</month>
          <day>6</day>
          <article-title>Coatopathies: Genetic Disorders of Protein Coats</article-title>
          <source>Annual Review of Cell and Developmental Biology</source>
          <volume>35</volume>
          <issue>1</issue>
          <issn>1081-0706</issn>
          <fpage>131</fpage>
          <lpage>168</lpage>
          <pub-id pub-id-type="doi">10.1146/annurev-cellbio-100818-125234</pub-id>
        </element-citation>
      </ref>
      <ref id="R5">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Downes</surname>
              <given-names>Katie W.</given-names>
            </name>
            <name>
              <surname>Zanetti</surname>
              <given-names>Giulia</given-names>
            </name>
          </person-group>
          <year>2025</year>
          <month>3</month>
          <day>25</day>
          <article-title>Mechanisms of COPII coat assembly and cargo recognition in the secretory pathway</article-title>
          <source>Nature Reviews Molecular Cell Biology</source>
          <volume>26</volume>
          <issue>12</issue>
          <issn>1471-0072</issn>
          <fpage>910</fpage>
          <lpage>925</lpage>
          <pub-id pub-id-type="doi">10.1038/s41580-025-00839-y</pub-id>
        </element-citation>
      </ref>
      <ref id="R6">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dunn</surname>
              <given-names>Cory D.</given-names>
            </name>
            <name>
              <surname>Sulis</surname>
              <given-names>Maria Luisa</given-names>
            </name>
            <name>
              <surname>Ferrando</surname>
              <given-names>Adolfo A.</given-names>
            </name>
            <name>
              <surname>Greenwald</surname>
              <given-names>Iva</given-names>
            </name>
          </person-group>
          <year>2010</year>
          <month>3</month>
          <day>10</day>
          <article-title>
            A conserved tetraspanin subfamily promotes Notch signaling in
                    
            <italic>Caenorhabditis elegans</italic>
            
                    and in human cells
          </article-title>
          <source>Proceedings of the National Academy of Sciences</source>
          <volume>107</volume>
          <issue>13</issue>
          <issn>0027-8424</issn>
          <fpage>5907</fpage>
          <lpage>5912</lpage>
          <pub-id pub-id-type="doi">10.1073/pnas.1001647107</pub-id>
        </element-citation>
      </ref>
      <ref id="R7">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Farhan</surname>
              <given-names>Hesso</given-names>
            </name>
            <name>
              <surname>Raote</surname>
              <given-names>Ishier</given-names>
            </name>
            <name>
              <surname>Campelo</surname>
              <given-names>Felix</given-names>
            </name>
            <name>
              <surname>Ge</surname>
              <given-names>Liang</given-names>
            </name>
            <name>
              <surname>Hirschberg</surname>
              <given-names>Koret</given-names>
            </name>
            <name>
              <surname>Forrester</surname>
              <given-names>Alison</given-names>
            </name>
            <name>
              <surname>Zanetti</surname>
              <given-names>Giulia</given-names>
            </name>
            <name>
              <surname>Lippincott-Schwartz</surname>
              <given-names>Jennifer</given-names>
            </name>
            <name>
              <surname>Pastor-Pareja</surname>
              <given-names>José Carlos</given-names>
            </name>
            <name>
              <surname>Perez</surname>
              <given-names>Franck</given-names>
            </name>
            <name>
              <surname>Saito</surname>
              <given-names>Kota</given-names>
            </name>
            <name>
              <surname>Malhotra</surname>
              <given-names>Vivek</given-names>
            </name>
          </person-group>
          <year>2025</year>
          <month>9</month>
          <day>29</day>
          <article-title>Towards a unified framework for the function of endoplasmic reticulum exit sites</article-title>
          <source>Nature Reviews Molecular Cell Biology</source>
          <volume>26</volume>
          <issue>12</issue>
          <issn>1471-0072</issn>
          <fpage>957</fpage>
          <lpage>969</lpage>
          <pub-id pub-id-type="doi">10.1038/s41580-025-00899-0</pub-id>
        </element-citation>
      </ref>
      <ref id="R8">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gomez-Navarro</surname>
              <given-names>Natalia</given-names>
            </name>
            <name>
              <surname>Miller</surname>
              <given-names>Elizabeth</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>11</month>
          <day>30</day>
          <article-title>Protein sorting at the ER–Golgi interface</article-title>
          <source>Journal of Cell Biology</source>
          <volume>215</volume>
          <issue>6</issue>
          <issn>0021-9525</issn>
          <fpage>769</fpage>
          <lpage>778</lpage>
          <pub-id pub-id-type="doi">10.1083/jcb.201610031</pub-id>
        </element-citation>
      </ref>
      <ref id="R9">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hsu</surname>
              <given-names>Victor W.</given-names>
            </name>
            <name>
              <surname>Bai</surname>
              <given-names>Ming</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Jian</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>4</month>
          <day>13</day>
          <article-title>Getting active: protein sorting in endocytic recycling</article-title>
          <source>Nature Reviews Molecular Cell Biology</source>
          <volume>13</volume>
          <issue>5</issue>
          <issn>1471-0072</issn>
          <fpage>323</fpage>
          <lpage>328</lpage>
          <pub-id pub-id-type="doi">10.1038/nrm3332</pub-id>
        </element-citation>
      </ref>
      <ref id="R10">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ichikawa</surname>
              <given-names>K</given-names>
            </name>
            <name>
              <surname>Shoura</surname>
              <given-names>MJ</given-names>
            </name>
            <name>
              <surname>Artiles</surname>
              <given-names>KL</given-names>
            </name>
            <name>
              <surname>Jeong</surname>
              <given-names>DE</given-names>
            </name>
            <name>
              <surname>Owa</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>Kobayashi</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Suzuki</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Kanamori</surname>
              <given-names>M</given-names>
            </name>
            <name>
              <surname>Toyoshima</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Iino</surname>
              <given-names>Y</given-names>
            </name>
            <name>
              <surname>Rougvie</surname>
              <given-names>AE</given-names>
            </name>
            <name>
              <surname>Wahba</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Fire</surname>
              <given-names>AZ</given-names>
            </name>
            <name>
              <surname>Schwarz</surname>
              <given-names>EM</given-names>
            </name>
            <name>
              <surname>Morishita</surname>
              <given-names>S</given-names>
            </name>
          </person-group>
          <year>2025</year>
          <month>8</month>
          <day>1</day>
          <article-title>CGC1, a new reference genome for Caenorhabditis elegans.</article-title>
          <source>Genome Res</source>
          <volume>35</volume>
          <issue>8</issue>
          <issn>1088-9051</issn>
          <fpage>1902</fpage>
          <lpage>1918</lpage>
          <pub-id pub-id-type="doi">10.1101/gr.280274.124</pub-id>
          <pub-id pub-id-type="pmid">40664475</pub-id>
        </element-citation>
      </ref>
      <ref id="R11">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kelly</surname>
              <given-names>Bernard T</given-names>
            </name>
            <name>
              <surname>Owen</surname>
              <given-names>David J</given-names>
            </name>
          </person-group>
          <year>2011</year>
          <month>8</month>
          <day>1</day>
          <article-title>Endocytic sorting of transmembrane protein cargo</article-title>
          <source>Current Opinion in Cell Biology</source>
          <volume>23</volume>
          <issue>4</issue>
          <issn>0955-0674</issn>
          <fpage>404</fpage>
          <lpage>412</lpage>
          <pub-id pub-id-type="doi">10.1016/j.ceb.2011.03.004</pub-id>
        </element-citation>
      </ref>
      <ref id="R12">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Liu</surname>
              <given-names>Zhiyu</given-names>
            </name>
            <name>
              <surname>Shi</surname>
              <given-names>Herong</given-names>
            </name>
            <name>
              <surname>Nzessi</surname>
              <given-names>Anthony K.</given-names>
            </name>
            <name>
              <surname>Norris</surname>
              <given-names>Anne</given-names>
            </name>
            <name>
              <surname>Grant</surname>
              <given-names>Barth D.</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>Jun</given-names>
            </name>
          </person-group>
          <year>2020</year>
          <month>1</month>
          <day>27</day>
          <article-title>
            Tetraspanins TSP-12 and TSP-14 function redundantly to regulate the trafficking of the type II BMP receptor in
            
            <italic>Caenorhabditis elegans</italic>
          </article-title>
          <source>Proceedings of the National Academy of Sciences</source>
          <volume>117</volume>
          <issue>6</issue>
          <issn>0027-8424</issn>
          <fpage>2968</fpage>
          <lpage>2977</lpage>
          <pub-id pub-id-type="doi">10.1073/pnas.1918807117</pub-id>
        </element-citation>
      </ref>
      <ref id="R13">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Liu</surname>
              <given-names>Z</given-names>
            </name>
            <name>
              <surname>Williams</surname>
              <given-names>B</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Clark</surname>
              <given-names>FK</given-names>
            </name>
            <name>
              <surname>Vignogna</surname>
              <given-names>RC</given-names>
            </name>
            <name>
              <surname>Fromme</surname>
              <given-names>JC</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <year>2026</year>
          <month>1</month>
          <day>2</day>
          <article-title>Tetraspanin TSP-12 and SUP-17/ADAM10 exhibit cell type-specific codependence for trafficking through the Golgi.</article-title>
          <source>Proc Natl Acad Sci U S A</source>
          <volume>123</volume>
          <issue>1</issue>
          <issn>0027-8424</issn>
          <fpage>e2524916123</fpage>
          <lpage>e2524916123</lpage>
          <pub-id pub-id-type="doi">10.1073/pnas.2524916123</pub-id>
          <pub-id pub-id-type="pmid">41481460</pub-id>
        </element-citation>
      </ref>
      <ref id="R14">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Malhotra</surname>
              <given-names>Vivek</given-names>
            </name>
          </person-group>
          <year>2024</year>
          <month>7</month>
          <day>3</day>
          <article-title>Tailored assemblies of COPII proteins in secretion</article-title>
          <source>Journal of Cell Biology</source>
          <volume>223</volume>
          <issue>8</issue>
          <issn>0021-9525</issn>
          <pub-id pub-id-type="doi">10.1083/jcb.202404013</pub-id>
        </element-citation>
      </ref>
      <ref id="R15">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sakaguchi</surname>
              <given-names>Aisa</given-names>
            </name>
            <name>
              <surname>Sato</surname>
              <given-names>Miyuki</given-names>
            </name>
            <name>
              <surname>Sato</surname>
              <given-names>Katsuya</given-names>
            </name>
            <name>
              <surname>Gengyo-Ando</surname>
              <given-names>Keiko</given-names>
            </name>
            <name>
              <surname>Yorimitsu</surname>
              <given-names>Tomohiro</given-names>
            </name>
            <name>
              <surname>Nakai</surname>
              <given-names>Junichi</given-names>
            </name>
            <name>
              <surname>Hara</surname>
              <given-names>Taichi</given-names>
            </name>
            <name>
              <surname>Sato</surname>
              <given-names>Ken</given-names>
            </name>
            <name>
              <surname>Sato</surname>
              <given-names>Ken</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>10</month>
          <day>1</day>
          <article-title>REI-1 Is a Guanine Nucleotide Exchange Factor Regulating RAB-11 Localization and Function in C.&amp;nbsp;elegans Embryos</article-title>
          <source>Developmental Cell</source>
          <volume>35</volume>
          <issue>2</issue>
          <issn>1534-5807</issn>
          <fpage>211</fpage>
          <lpage>221</lpage>
          <pub-id pub-id-type="doi">10.1016/j.devcel.2015.09.013</pub-id>
        </element-citation>
      </ref>
      <ref id="R16">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tu</surname>
              <given-names>Linna</given-names>
            </name>
            <name>
              <surname>Tai</surname>
              <given-names>William C. S.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Lu</given-names>
            </name>
            <name>
              <surname>Banfield</surname>
              <given-names>David K.</given-names>
            </name>
          </person-group>
          <year>2008</year>
          <month>7</month>
          <day>18</day>
          <article-title>Signal-Mediated Dynamic Retention of Glycosyltransferases in the Golgi</article-title>
          <source>Science</source>
          <volume>321</volume>
          <issue>5887</issue>
          <issn>0036-8075</issn>
          <fpage>404</fpage>
          <lpage>407</lpage>
          <pub-id pub-id-type="doi">10.1126/science.1159411</pub-id>
        </element-citation>
      </ref>
      <ref id="R17">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wang</surname>
              <given-names>L</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>Z</given-names>
            </name>
            <name>
              <surname>Shi</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>J</given-names>
            </name>
          </person-group>
          <year>2017</year>
          <month>1</month>
          <day>9</day>
          <article-title>Two Paralogous Tetraspanins TSP-12 and TSP-14 Function with the ADAM10 Metalloprotease SUP-17 to Promote BMP Signaling in Caenorhabditis elegans.</article-title>
          <source>PLoS Genet</source>
          <volume>13</volume>
          <issue>1</issue>
          <issn>1553-7390</issn>
          <fpage>e1006568</fpage>
          <lpage>e1006568</lpage>
          <pub-id pub-id-type="doi">10.1371/journal.pgen.1006568</pub-id>
          <pub-id pub-id-type="pmid">28068334</pub-id>
        </element-citation>
      </ref>
      <ref id="R18">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Watson</surname>
              <given-names>Emma T.</given-names>
            </name>
            <name>
              <surname>Wegeng</surname>
              <given-names>William R.</given-names>
            </name>
            <name>
              <surname>Aravani</surname>
              <given-names>Stamatina</given-names>
            </name>
            <name>
              <surname>Ernst</surname>
              <given-names>Andreas M.</given-names>
            </name>
            <name>
              <surname>von Blume</surname>
              <given-names>Julia</given-names>
            </name>
          </person-group>
          <year>2025</year>
          <month>11</month>
          <day>10</day>
          <article-title>Mechanistic insights into cargo sorting and export from the Golgi apparatus</article-title>
          <source>Nature Reviews Molecular Cell Biology</source>
          <volume>26</volume>
          <issue>12</issue>
          <issn>1471-0072</issn>
          <fpage>940</fpage>
          <lpage>956</lpage>
          <pub-id pub-id-type="doi">10.1038/s41580-025-00907-3</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>