<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/archiving/1.2/JATS-archivearticle1.dtd">
<article article-type="brief-report" xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>microPublication Biology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2578-9430</issn>
      <publisher>
        <publisher-name>Caltech Library</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.17912/micropub.biology.002252</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>new finding</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>biochemistry</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>s. cerevisiae</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>
          The methyltransferase Rrp8 is a positive regulator of autophagy flux in 
          <italic>Saccharomyces cerevisiae</italic>
        </article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Badenahalli Narasimhaiah</surname>
            <given-names>Swaroopa</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation">Data curation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation">Validation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization">Visualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Delorme-Axford</surname>
            <given-names>Elizabeth</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation">Data curation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition">Funding acquisition</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology">Methodology</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration">Project administration</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources">Resources</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision">Supervision</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation">Validation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization">Visualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="corresp" rid="cor1">§</xref>
        </contrib>
        <aff id="aff1">
          <label>1</label>
          Biological Sciences, Oakland University, Rochester, MI, United States
        </aff>
      </contrib-group>
      <contrib-group>
        <contrib contrib-type="reviewer">
          <name>
            <surname>Segarra</surname>
            <given-names>Veronica</given-names>
          </name>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor1">
          <label>§</label>
          Correspondence to: Elizabeth Delorme-Axford (
          <email>delormeaxford@oakland.edu</email>
          )
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there are no conflicts of interest present.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>3</day>
        <month>8</month>
        <year>2026</year>
      </pub-date>
      <pub-date date-type="collection" publication-format="electronic">
        <year>2026</year>
      </pub-date>
      <volume>2026</volume>
      <elocation-id>10.17912/micropub.biology.002252</elocation-id>
      <history>
        <date date-type="received">
          <day>20</day>
          <month>6</month>
          <year>2026</year>
        </date>
        <date date-type="rev-recd">
          <day>27</day>
          <month>7</month>
          <year>2026</year>
        </date>
        <date date-type="accepted">
          <day>30</day>
          <month>7</month>
          <year>2026</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2026 by the authors</copyright-statement>
        <copyright-year>2026</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. The products of autophagic degradation may be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions. However, the role of nucleolar proteins in autophagy remains largely unexplored. Here we identify Ribosomal RNA processing 8 (Rrp8) as a positive regulator of autophagy flux in the yeast 
          <italic>Saccharomyces cerevisiae.</italic>
           Our work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation.
        </p>
      </abstract>
      <funding-group>
        <funding-statement>This work was supported by grant funding from PCR Biosystems and Oakland University (OU) startup funds (to EDA). SBN was supported by a graduate teaching assistantship obtained through the OU Department of Biological Sciences. EDA is supported by funding from the National Institute of General Medical Sciences R15GM159346.</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <fig position="anchor" id="f1">
      <label>Figure 1. Rrp8 positively regulates autophagy flux</label>
      <caption>
        <p>
          (
          <bold>A</bold>
          ) WT (JMY347), 
          <italic>atg13</italic>
          Δ (EDA328), and 
          <italic>rrp8</italic>
          Δ (SBN08) strains were grown to mid-log phase in YPD (+N), then starved for nitrogen (-N) in SD-N medium for 4 h. Pho8Δ60 activity was measured and normalized to the activity of starved WT cells, which was set at 100%. (
          <bold>B</bold>
          ) WT (EDA291) and 
          <italic>rrp8</italic>
          Δ
          <italic/>
          (SBN03) strains expressing GFP-Atg8 were grown in nutrient-rich media, and then starved for nitrogen as indicated
          <italic>.</italic>
           Protein extracts were analyzed by SDS-PAGE and blotted using an antibody that recognizes GFP. GAPDH is the loading control. A representative blot is shown (n=3). (
          <bold>C</bold>
          ) Densitometry of blots represented in (
          <bold>B</bold>
          ). Processed GFP-Atg8 was calculated by determining the ratio of free GFP:total GFP (sum of free GFP and full-length GFP-Atg8). Results shown are relative to the WT strain during starvation (2 h SD-N), which was set to 1 (n=3). (
          <bold>D</bold>
          ) Loss of 
          <italic>RRP8 </italic>
          decreases cell survival after prolonged nitrogen starvation. WT (BY4742) and 
          <italic>rrp8</italic>
          ∆ cells were grown in nutrient-rich YPD medium (+N) until mid-log phase and then starved for nitrogen for 7 days (–N). Cells were serially diluted and spotted onto YPD plates, incubated for 2 days, and imaged. The image shown is representative of n=4 independent experiments. (
          <bold>E</bold>
          ) 
          <italic>RRP8</italic>
           expression decreases during nitrogen starvation. WT (BY4741) cells were grown to mid-log phase in YPD (+N) and then shifted to nitrogen starved (-N) media for 1 hour. Total RNA was extracted, and RT-qPCR was performed. Results shown are relative to the level of expression in WT cells under rich conditions, which was set to 1 (n=3). (
          <bold>F</bold>
          ) Rrp8-PA fusion protein levels decrease with nitrogen starvation. WT (SBN15) cells endogenously expressing Rrp8-PA fusion protein were grown to mid-log phase in YPD then starved for nitrogen for the time points indicated. Protein extracts were resolved by SDS-PAGE and blotted with anti-PA or anti-GAPDH (loading control) antibodies. A representative blot is shown (n=4). (
          <bold>G</bold>
          ) Densitometry of blots represented in (
          <bold>F</bold>
          ). The percentage of Rrp8-PA:GAPDH was quantified. (
          <bold>H</bold>
          ) Loss of 
          <italic>SFP1</italic>
           decreases Rrp8-PA fusion protein levels. WT (SBN15) and 
          <italic>sfp1</italic>
          Δ (SBN21) endogenously expressing Rrp8-PA were grown to mid-log phase in YPD (+N) starved for nitrogen for 2 h (-N). Protein extracts were analyzed as in (
          <bold>F</bold>
          ). A representative blot is shown (n=3). (
          <bold>I</bold>
          ) Densitometry of blots represented in (
          <bold>H</bold>
          ). The percentage of Rrp8-PA:GAPDH was quantified. For (
          <bold>A</bold>
          ), (
          <bold>C</bold>
          ), (
          <bold>E</bold>
          ), (
          <bold>G</bold>
          ), and (
          <bold>I</bold>
          ), results shown are the mean. Error bars indicate standard deviation.
        </p>
      </caption>
    </fig>
    <graphic xlink:href="25789430-2026-micropub.biology.002252"/>
    <sec>
      <title>Description</title>
      <p>Macroautophagy (hereafter referred to as autophagy) is a dynamic pathway of cellular degradation and recycling that is conserved from yeast to humans. Nonselective autophagy targets bulk cytoplasm; whereas selective forms of autophagy target specific intracellular cargo. Basal autophagy is low, but is markedly upregulated during stressfulconditions such as nutrient deprivation. Canonically, autophagy is a catabolic process, breaking down cytoplasmic cargo within the vacuole (in yeast) to maintain cell survival. The autophagic cargo are degraded, and the resulting biomolecules are transported to the cytosol for reuse. The effluxed bioproducts of autophagic degradation can be used for anabolic reactions during nutrient-limited conditions. Thus, autophagy serves both metabolic and quality control functions.</p>
      <p>
        The goal of this study was to investigate the role of the budding yeast 
        <italic>Saccharomyces cerevisiae</italic>
         ribosomal RNA processing 8 (Rrp8) protein in autophagy. Rrp8 is a S-adenosylmethionine-dependent methyltransferase (Bousquet-Antonelli et al., 2000). Rrp8 methylates m
        <sup>1</sup>
        A645 of 25S rRNA (Peifer et al., 2013). The N
        <sup>1</sup>
        -methyladenosine (m
        <sup>1</sup>
        A) modification is important for regulating gene expression (Li et al., 2022). m
        <sup>1</sup>
        A is a reversible modification in tRNA, mRNA, rRNA and long non-coding RNA (lncRNA) and has impacts on RNA processing, structure, and functions of targets (Li et al., 2022). Nucleomethylin (the mammalian homolog of yeast Rrp8) is associated with metabolic disease, obesity, and nutrient availability signaling (Oie et al., 2014; Sharma et al., 2018). Additionally, there is a gap in our understanding of how autophagy contributes to cellular metabolism, and in return, how metabolism impacts autophagy activity.
      </p>
      <p>
        Given the relationship between nucleomethylin and nutrient availability signaling, we examined whether Rrp8 (the yeast homolog of nucleomethylin) plays a role in autophagy in 
        <italic>Saccharomyces cerevisiae. </italic>
        To the best of our knowledge, whether Rrp8 has any impact on autophagy– in any model system– has never been explored. We first investigated whether autophagy was affected in cells lacking 
        <italic>RRP8</italic>
         by performing the alkaline phosphatase (ALP) or Pho8Δ60 assay (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). The ALP assay is a quantitative enzymatic measurement of autophagy (Noda &amp; Klionsky, 2008), although some minimal degree of basal phosphatase activity is observed in cells under nutrient-rich conditions (Delorme-Axford et al., 2018). As expected, when cells were starved for nitrogen (4 h), robust autophagy activity is observed in the wild-type (WT) strain and little activity in the negative control 
        <italic>atg13</italic>
        ∆ strain (~35%; 
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). Atg13 is essential for autophagy in yeast (Tsukada &amp; Ohsumi, 1993). Pho8Δ60 activity is reduced in the 
        <italic>rrp8</italic>
        ∆ strain compared to WT (~63%; 
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ), supporting that autophagy flux decreases in cells lacking 
        <italic>RRP8</italic>
        .
      </p>
      <p>
        Based on these results, we next examined whether autophagy was impaired in 
        <italic>rrp8</italic>
        Δ cells by performing the GFP-Atg8 processing assay (
        <xref ref-type="fig" rid="f1">Figure 1B,</xref>
         C). The GFP-Atg8 assay is a method to monitor bulk autophagy progression based on the release of free GFP. Following autophagosome-vacuole fusion, Atg8 is rapidly hydrolyzed; the GFP moiety remains relatively stable within the vacuole (Cheong &amp; Klionsky, 2008). The release of free GFP from the GFP-Atg8 fusion protein indicates autophagy flux following autophagosome-vacuole fusion (Delorme-Axford et al., 2015). Consistent with our Pho8Δ60 assay results (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ), we observed a significant decrease of free GFP release in the 
        <italic>rrp8</italic>
        Δ cells compared to the WT at 1 and 2 h of nitrogen starvation (
        <xref ref-type="fig" rid="f1">Figure 1B,</xref>
         C). To determine whether loss of 
        <italic>RRP8 </italic>
        impacts cell survival, we examined WT and 
        <italic>rrp8</italic>
        ∆ cells under nutrient-rich and prolonged nitrogen starvation conditions (
        <xref ref-type="fig" rid="f1">Figure 1D</xref>
        ). Following 7 days of nitrogen starvation, 
        <italic>rrp8</italic>
        Δ cells
        <italic/>
        showed reduced survival compared to WT, suggesting that Rrp8 may play an important role in mediating cell survival under nutrient-stress conditions (
        <xref ref-type="fig" rid="f1">Figure 1D</xref>
        ). This is consistent with previous observations that cells deficient in autophagy display reduced viability under prolonged starvation (Bernard, Jin, González-Rodríguez, et al., 2015; Tsukada &amp; Ohsumi, 1993). Taken together, these data support the idea that Rrp8 is a positive regulator of autophagy flux when cells are starved for nitrogen (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        –D).
      </p>
      <p>
        To determine whether 
        <italic>RRP8 </italic>
        expression changes during autophagy-inducing conditions, we assessed 
        <italic>RRP8 </italic>
        mRNA levels using RT-qPCR (
        <xref ref-type="fig" rid="f1">Figure 1E</xref>
        ). Two pairs of independent primers (
        <italic>1-RRP8 </italic>
        and 
        <italic>2-RRP8</italic>
        ) were used to ensure reliability (
        <xref ref-type="fig" rid="f1">Figure 1E</xref>
        ). Following nitrogen starvation, 
        <italic>RRP8</italic>
         expression markedly declined by 1 hour of starvation (&gt;90%; 
        <xref ref-type="fig" rid="f1">Figure 1E</xref>
        ). As a control, 
        <italic>SLD3 </italic>
        (a gene with no known connection to autophagy) was also analyzed (
        <xref ref-type="fig" rid="f1">Figure 1E</xref>
        ). As expected, 
        <italic>SLD3</italic>
         expression did not significantly change between nutrient-rich and starvation conditions (
        <xref ref-type="fig" rid="f1">Figure 1E</xref>
        ). To monitor Rrp8 protein levels,
        <italic> RRP8</italic>
         was chromosomally tagged at the C-terminus with Protein A (PA), allowing detection of endogenous Rrp8-PA fusion protein during a time course of nitrogen starvation (0, 1, 2, and 3 h; 
        <xref ref-type="fig" rid="f1">Figure 1F,</xref>
         1G). Western blot analysis revealed a noticeable decrease in Rrp8-PA protein levels during nitrogen starvation compared to nutrient-rich conditions, suggesting that Rrp8 is downregulated during nutrient stress (~50% by 3 h; 
        <xref ref-type="fig" rid="f1">Figure 1F,</xref>
         1G).
      </p>
      <p>
        The split-finger protein 1 (Sfp1) is a nutrient and stress sensitive transcription factor (Albert et al., 2019). Sfp1 is an activator of ribosomal protein and ribosome biogenesis gene transcription in yeast (Marion et al., 2004). Sfp1 is phosphorylated by the Target of Rapamycin Complex 1 (TORC1) kinase at multiple sites (Lempiäinen et al., 2009). Tor kinase is a negative regulator of autophagy (Noda &amp; Ohsumi, 1998). Rapamycin treatment strongly inhibits the TORC1-Sfp1 interaction, leading to Sfp1 dephosphorylation (Lempiäinen et al., 2009). Rapamycin inhibits Tor, thereby activating autophagy (reviewed in (Delorme-Axford et al., 2015)). In addition, prior work by others suggests that Sfp1 may be a potential transcriptional activator of 
        <italic>RRP8 </italic>
        (Cipollina et al., 2008). To investigate whether Sfp1 regulates 
        <italic>RRP8</italic>
        , we compared Rrp8-PA fusion protein levels in WT and 
        <italic>sfp1</italic>
        Δ cells by western blot analysis (
        <xref ref-type="fig" rid="f1">Figure 1H,</xref>
         1I). Under nutrient-rich conditions (+N), Rrp8-PA is well expressed in WT cells and decreases when cells are starved for nitrogen (-N; 
        <xref ref-type="fig" rid="f1">Figure 1H,</xref>
         1I). In contrast, Rrp8-PA levels were reduced in 
        <italic>sfp1</italic>
        Δ cells relative to WT under both nutrient-rich and starved conditions (
        <xref ref-type="fig" rid="f1">Figure 1H,</xref>
         1I). Taken together, these data suggest that Sfp1 may function as a positive regulator of Rrp8.
      </p>
      <p>
        Here we characterize the yeast methyltransferase Rrp8 as a positive regulator of autophagy flux. Although we observed that 
        <italic>RRP8</italic>
        /Rrp8 levels decline during nitrogen starvation, we do not currently know the mechanism(s) underlying our observations and/or what role the enzymatic activity of Rrp8 may have in this process. It is interesting to speculate that the observed decrease in 
        <italic>RRP8</italic>
        /Rrp8 levels could serve as a mechanism to limit enzyme activity. We also found that loss of TORC1-regulated transcription factor 
        <italic>SFP1 </italic>
        decreases Rrp8 levels under nutrient-rich and starved conditions, suggesting that Sfp1 may regulate Rrp8 expression. This work provides insight into the role of the conserved nucleolar protein Rrp8 in regulating cellular responses to starvation. Further elucidation of these mechanisms will advance our understanding of the molecular crosstalk between ribosome biogenesis, metabolism, and autophagy.
      </p>
    </sec>
    <sec>
      <title>Methods</title>
      <p>
        <bold>
          <italic>Yeast Strains, Media, and Cell Culture: </italic>
        </bold>
        <italic>Saccharomyces cerevisiae</italic>
        <bold>
          <italic/>
        </bold>
        yeast strains used in this study are listed in the accompanying table. Yeast cells were grown in YPD (1% yeast extract, 2% peptone, and 2% glucose) medium (Gibco, A1374501). To induce autophagy, cells were grown to mid-log phase in YPD, then shifted to
        <bold>
          <italic/>
        </bold>
        nitrogen starvation medium (SD-N; 0.17% yeast nitrogen base without ammonium sulfate or amino acids and 2% glucose) for the indicated time points. Chromosome tagging and gene deletions were performed using established methods (Gueldener et al., 2002; Longtine et al., 1998).
      </p>
      <p>
        <bold>
          <italic>Pho8Δ60 Assay: </italic>
        </bold>
        The Pho8Δ60 assay was performed using the SmartReader 96 microplate absorbance reader (Accuris, MR9600) as previously described (Tasmi et al., 2026). Pho8Δ60 values were normalized to the protein content of each sample determined by the Pierce BCA Protein Assay kit (Thermo Scientific, 23227) as described (Delorme-Axford et al., 2023).
      </p>
      <p>
        <bold>
          <italic>SDS-PAGE and Western Blots:</italic>
        </bold>
        <italic/>
        SDS-PAGE and western blots were performed as previously described (Tasmi et al., 2026).
        <bold/>
        Western blots were visualized using the Azure 600 (Azure Biosystems) or iBright CL1500 (Invitrogen) imaging systems. Densitometry for western blots was performed using ImageJ (
        <ext-link ext-link-type="uri" xlink:href="https://imagej.nih.gov/ij/">https://imagej.nih.gov/ij/</ext-link>
        ). Antibodies used in this study are included in the accompanying table.
      </p>
      <p>
        <bold>
          <italic>Yeast Viability Assay:</italic>
        </bold>
        <italic/>
        Yeast growth assays were performed as previously described (Avogo et al., 2025).
      </p>
      <p>
        <bold>
          <italic>RNA and Real-Time Quantitative PCR (RT-qPCR): </italic>
        </bold>
        RNA extraction and RT-qPCR was performed as previously described (Avogo et al., 2025). Relative gene expression was calculated using the 2
        <sup>−ΔΔCT</sup>
         method (Livak and Schmittgen 2001), normalized to 
        <italic>UBC6</italic>
         levels. RT-qPCR primers used in this study are listed in the accompanying table.
      </p>
      <p>
        <bold>
          <italic>Statistical analysis: </italic>
        </bold>
        The two-tailed unpaired 
        <italic>t</italic>
         test was used to determine statistical significance with GraphPad Prism (GraphPad Software, USA). For 
        <xref ref-type="fig" rid="f1">Figure 1,</xref>
        <italic>p</italic>
         values are as follows: *
        <italic>p</italic>
        &lt;0.05; **
        <italic>p</italic>
        &lt;0.01; ***
        <italic>p</italic>
        &lt;0.001; ****
        <italic>p</italic>
        &lt;0.0001; ns indicates not significant.
        <bold/>
        A 
        <italic>p</italic>
         value &lt; 0.05 was considered significant.
      </p>
    </sec>
    <sec>
      <title>Reagents</title>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td colspan="3">
                <p>
                  <bold>
                    <italic>Saccharomyces cerevisiae </italic>
                    strains used in this study are as follows:
                  </bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <bold>Strains</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Genotype</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Reference</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>BY4741</p>
              </td>
              <td>
                <p>
                  <italic>MATα</italic>
                  <italic>his3</italic>
                  Δ
                  <italic>1</italic>
                  <italic>leu2</italic>
                  Δ
                  <italic>0</italic>
                  <italic>met15</italic>
                  Δ
                  <italic>0</italic>
                  <italic>ura3</italic>
                  Δ
                  <italic>0</italic>
                </p>
              </td>
              <td>
                <p>Horizon Discovery</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>BY4742</p>
              </td>
              <td>
                <p>
                  <italic>MATα</italic>
                  <italic>his3</italic>
                  Δ1 
                  <italic>leu2</italic>
                  Δ0 
                  <italic>lys2</italic>
                  Δ0 
                  <italic>ura3</italic>
                  Δ0
                </p>
              </td>
              <td>
                <p>Horizon Discovery</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  BY4742, 
                  <italic>rrp8</italic>
                  Δ
                  <italic>::KANMX</italic>
                </p>
              </td>
              <td>
                <p>
                  BY4742, 
                  <italic>rrp8</italic>
                  Δ
                  <italic>::KANMX</italic>
                </p>
              </td>
              <td>
                <p>Horizon Discovery</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>EDA291</p>
              </td>
              <td>
                <p>
                  WLY176, 
                  <italic>CUP1p-GFP-ATG8(405)::LEU2</italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>EDA328</p>
              </td>
              <td>
                <p>
                  JMY347, 
                  <italic>atg13</italic>
                  Δ::
                  <italic>HIS5</italic>
                </p>
              </td>
              <td>
                <p>(Tasmi et al., 2026)</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>JMY347</p>
              </td>
              <td>
                <p>
                   SEY6210, 
                  <italic>pho13</italic>
                  Δ
                  <italic> ZEO1p-pho8</italic>
                  Δ
                  <italic>60, CUP1p-GFP-ATG8(405)::LEU2</italic>
                </p>
              </td>
              <td>
                <p>(Wen et al., 2020)</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>SBN03</p>
              </td>
              <td>
                <p>
                  EDA291, 
                  <italic>rrp8</italic>
                  Δ
                  <italic>::URA3</italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>SBN08</p>
              </td>
              <td>
                <p>
                  JMY347, 
                  <italic>rrp8</italic>
                  Δ::
                  <italic>HIS5</italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>SBN15</p>
              </td>
              <td>
                <p>
                  BY4742, 
                  <italic>RRP8-PA::HIS3</italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>SBN21</p>
              </td>
              <td>
                <p>
                  SBN15, 
                  <italic>sfp1</italic>
                  Δ::
                  <italic>URA3</italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>SEY6210</p>
              </td>
              <td>
                <p>
                  MATα 
                  <italic>leu2-3,112 ura3-52 his3-</italic>
                  Δ
                  <italic>200 trp1-</italic>
                  Δ
                  <italic>901 suc2-</italic>
                  Δ
                  <italic>9 lys2-801; GAL</italic>
                </p>
              </td>
              <td>
                <p>(Robinson et al., 1988)</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>WLY176</p>
              </td>
              <td>
                <p>
                  SEY6210,
                  <italic> pho13</italic>
                  ∆
                  <italic> pho8::pho8</italic>
                  ∆
                  <italic>60</italic>
                </p>
              </td>
              <td>
                <p> (Kanki et al., 2009)</p>
              </td>
            </tr>
            <tr>
              <td colspan="3" rowspan="2">
                <p>
                  <bold>RT-qPCR primer sequences used in this study are as follows:</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <bold>Primer</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Sequence (5' to 3')</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Reference</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>1-RRP8-qPCR-F</italic>
                </p>
              </td>
              <td>
                <p>ACGCTTTGAAGCTGATGGGA</p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>1-RRP8-qPCR-R</italic>
                </p>
              </td>
              <td>
                <p>TAATCTCCGCAGGTGGCTTG</p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>2-RRP8-qPCR-F</italic>
                </p>
              </td>
              <td>
                <p>TTTAGCGCCAAGGGGTGAAT</p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>2-RRP8-qPCR-R</italic>
                </p>
              </td>
              <td>
                <p>CCCATCAGCTTCAAAGCGTC</p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>SLD3-qPCR-F</italic>
                </p>
              </td>
              <td>
                <p>CGCAACTTCAAAGCATCATTGAATCGC</p>
              </td>
              <td>
                <p>(Bernard, Jin, Xu, et al., 2015)</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>SLD3-qPCR-R</italic>
                </p>
              </td>
              <td>
                <p>GGGGCTTATTAGTGGGAGTAGAGG</p>
              </td>
              <td>
                <p>(Bernard, Jin, Xu, et al., 2015)</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>UBC6-qPCR-F</italic>
                </p>
              </td>
              <td>
                <p>GATACTTGGAATCCTGGCTGGTCTGTCTC</p>
              </td>
              <td>
                <p>(Teste et al., 2009)</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>UBC6-qPCR-R</italic>
                </p>
              </td>
              <td>
                <p>AAAGGGTCTTCTGTTTCATCACCTGTATTTGC</p>
              </td>
              <td>
                <p>(Teste et al., 2009)</p>
              </td>
            </tr>
            <tr>
              <td colspan="3">
                <p>
                  <bold>Antibodies used in this study are as follows:</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <bold>Name </bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Identifier (Source)</bold>
                  <italic/>
                </p>
              </td>
              <td>
                <p>
                  <bold>Concentration</bold>
                  <italic/>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>mouse monoclonal anti-GAPDH (1E6D9)</p>
              </td>
              <td>
                <p>Cat# 60004-1-Ig (Proteintech)</p>
              </td>
              <td>
                <p> 1:20,000</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>mouse monoclonal anti-GFP (JL-8)</p>
              </td>
              <td>
                <p>Cat# 632381 (Clontech)</p>
              </td>
              <td>
                <p>1:3,000</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>rabbit polyclonal anti-peroxidase (anti-PA) antibody</p>
              </td>
              <td>
                <p>Cat# 323-005-024 (Jackson Immunoresearch)</p>
              </td>
              <td>
                <p>1:30,000</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>mouse monoclonal anti-Pgk1 (22C5D8)</p>
              </td>
              <td>
                <p>Cat# 459250 (Invitrogen)</p>
              </td>
              <td>
                <p> 1:5,000</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
    </sec>
  </body>
  <back>
    <ref-list>
      <ref id="R1">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Albert</surname>
              <given-names>Benjamin</given-names>
            </name>
            <name>
              <surname>Tomassetti</surname>
              <given-names>Susanna</given-names>
            </name>
            <name>
              <surname>Gloor</surname>
              <given-names>Yvonne</given-names>
            </name>
            <name>
              <surname>Dilg</surname>
              <given-names>Daniel</given-names>
            </name>
            <name>
              <surname>Mattarocci</surname>
              <given-names>Stefano</given-names>
            </name>
            <name>
              <surname>Kubik</surname>
              <given-names>Slawomir</given-names>
            </name>
            <name>
              <surname>Hafner</surname>
              <given-names>Lukas</given-names>
            </name>
            <name>
              <surname>Shore</surname>
              <given-names>David</given-names>
            </name>
          </person-group>
          <year>2019</year>
          <month>2</month>
          <day>25</day>
          <article-title>Sfp1 regulates transcriptional networks driving cell growth and division through multiple promoter-binding modes</article-title>
          <source>Genes &amp; Development</source>
          <volume>33</volume>
          <issue>5-6</issue>
          <issn>0890-9369</issn>
          <fpage>288</fpage>
          <lpage>293</lpage>
          <pub-id pub-id-type="doi">10.1101/gad.322040.118</pub-id>
        </element-citation>
      </ref>
      <ref id="R2">
        <mixed-citation>
          Avogo EW, Burlingame NA, Badenahalli Narasimhaiah S, Delorme-Axford E. 2025. Bioinformatics analysis identifies Mot2 protein as a potential regulator of autophagy in 
          <italic>Saccharomyces cerevisiae</italic>
          . MicroPubl Biol.
        </mixed-citation>
      </ref>
      <ref id="R3">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bernard</surname>
              <given-names>Amélie</given-names>
            </name>
            <name>
              <surname>Jin</surname>
              <given-names>Meiyan</given-names>
            </name>
            <name>
              <surname>González-Rodríguez</surname>
              <given-names>Patricia</given-names>
            </name>
            <name>
              <surname>Füllgrabe</surname>
              <given-names>Jens</given-names>
            </name>
            <name>
              <surname>Delorme-Axford</surname>
              <given-names>Elizabeth</given-names>
            </name>
            <name>
              <surname>Backues</surname>
              <given-names>Steven K.</given-names>
            </name>
            <name>
              <surname>Joseph</surname>
              <given-names>Bertrand</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>3</month>
          <day>1</day>
          <article-title>Rph1/KDM4 Mediates Nutrient-Limitation Signaling that Leads to the Transcriptional Induction of Autophagy</article-title>
          <source>Current Biology</source>
          <volume>25</volume>
          <issue>5</issue>
          <issn>0960-9822</issn>
          <fpage>546</fpage>
          <lpage>555</lpage>
          <pub-id pub-id-type="doi">10.1016/j.cub.2014.12.049</pub-id>
        </element-citation>
      </ref>
      <ref id="R4">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bernard</surname>
              <given-names>Amélie</given-names>
            </name>
            <name>
              <surname>Jin</surname>
              <given-names>Meiyan</given-names>
            </name>
            <name>
              <surname>Xu</surname>
              <given-names>Ziheng</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>11</month>
          <day>2</day>
          <article-title>A large-scale analysis of autophagy-related gene expression identifies new regulators of autophagy</article-title>
          <source>Autophagy</source>
          <volume>11</volume>
          <issue>11</issue>
          <issn>1554-8627</issn>
          <fpage>2114</fpage>
          <lpage>2122</lpage>
          <pub-id pub-id-type="doi">10.1080/15548627.2015.1099796</pub-id>
        </element-citation>
      </ref>
      <ref id="R5">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>BOUSQUET-ANTONELLI</surname>
              <given-names>CÉCILE</given-names>
            </name>
            <name>
              <surname>VANROBAYS</surname>
              <given-names>EMMANUEL</given-names>
            </name>
            <name>
              <surname>GÉLUGNE</surname>
              <given-names>JEAN-PAUL</given-names>
            </name>
            <name>
              <surname>CAIZERGUES-FERRER</surname>
              <given-names>MICHÈLE</given-names>
            </name>
            <name>
              <surname>HENRY</surname>
              <given-names>YVES</given-names>
            </name>
          </person-group>
          <year>2000</year>
          <month>6</month>
          <day>1</day>
          <article-title>Rrp8p is a yeast nucleolar protein functionally linked to Gar1p and involved in pre-rRNA cleavage at site A2</article-title>
          <source>RNA</source>
          <volume>6</volume>
          <issue>6</issue>
          <issn>1355-8382</issn>
          <fpage>826</fpage>
          <lpage>843</lpage>
          <pub-id pub-id-type="doi">10.1017/s1355838200992288</pub-id>
        </element-citation>
      </ref>
      <ref id="R6">
        <element-citation publication-type="book-chapter">
          <person-group person-group-type="author">
            <name>
              <surname>Cheong</surname>
              <given-names>Heesun</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
          </person-group>
          <year>2008</year>
          <article-title>Chapter 1 Biochemical Methods to Monitor Autophagy‐Related Processes in Yeast</article-title>
          <source>Methods in Enzymology</source>
          <issn>0076-6879</issn>
          <fpage>1</fpage>
          <lpage>26</lpage>
          <pub-id pub-id-type="doi">10.1016/s0076-6879(08)03201-1</pub-id>
        </element-citation>
      </ref>
      <ref id="R7">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cipollina</surname>
              <given-names>Chiara</given-names>
            </name>
            <name>
              <surname>van den Brink</surname>
              <given-names>Joost</given-names>
            </name>
            <name>
              <surname>Daran-Lapujade</surname>
              <given-names>Pascale</given-names>
            </name>
            <name>
              <surname>Pronk</surname>
              <given-names>Jack T.</given-names>
            </name>
            <name>
              <surname>Porro</surname>
              <given-names>Danilo</given-names>
            </name>
            <name>
              <surname>de Winde</surname>
              <given-names>Johannes H.</given-names>
            </name>
          </person-group>
          <year>2008</year>
          <month>6</month>
          <day>1</day>
          <article-title>Saccharomyces cerevisiae
            SFP1: at the crossroads of central metabolism and ribosome biogenesis</article-title>
          <source>Microbiology</source>
          <volume>154</volume>
          <issue>6</issue>
          <issn>1350-0872</issn>
          <fpage>1686</fpage>
          <lpage>1699</lpage>
          <pub-id pub-id-type="doi">10.1099/mic.0.2008/017392-0</pub-id>
        </element-citation>
      </ref>
      <ref id="R8">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Delorme-Axford</surname>
              <given-names>Elizabeth</given-names>
            </name>
            <name>
              <surname>Abernathy</surname>
              <given-names>Emma</given-names>
            </name>
            <name>
              <surname>Lennemann</surname>
              <given-names>Nicholas J.</given-names>
            </name>
            <name>
              <surname>Bernard</surname>
              <given-names>Amélie</given-names>
            </name>
            <name>
              <surname>Ariosa</surname>
              <given-names>Aileen</given-names>
            </name>
            <name>
              <surname>Coyne</surname>
              <given-names>Carolyn B.</given-names>
            </name>
            <name>
              <surname>Kirkegaard</surname>
              <given-names>Karla</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
          </person-group>
          <year>2018</year>
          <month>3</month>
          <day>21</day>
          <article-title>The exoribonuclease Xrn1 is a post-transcriptional negative regulator of autophagy</article-title>
          <source>Autophagy</source>
          <volume>14</volume>
          <issue>5</issue>
          <issn>1554-8627</issn>
          <fpage>898</fpage>
          <lpage>912</lpage>
          <pub-id pub-id-type="doi">10.1080/15548627.2018.1441648</pub-id>
        </element-citation>
      </ref>
      <ref id="R9">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Delorme-Axford</surname>
              <given-names>Elizabeth</given-names>
            </name>
            <name>
              <surname>Guimaraes</surname>
              <given-names>Rodrigo Soares</given-names>
            </name>
            <name>
              <surname>Reggiori</surname>
              <given-names>Fulvio</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>3</month>
          <day>1</day>
          <article-title>The yeast Saccharomyces cerevisiae: An overview of methods to study autophagy progression</article-title>
          <source>Methods</source>
          <volume>75</volume>
          <issn>1046-2023</issn>
          <fpage>3</fpage>
          <lpage>12</lpage>
          <pub-id pub-id-type="doi">10.1016/j.ymeth.2014.12.008</pub-id>
        </element-citation>
      </ref>
      <ref id="R10">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Delorme-Axford</surname>
              <given-names>Elizabeth</given-names>
            </name>
            <name>
              <surname>Wen</surname>
              <given-names>Xin</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
          </person-group>
          <year>2023</year>
          <month>7</month>
          <day>2</day>
          <article-title>The yeast transcription factor Stb5 acts as a negative regulator of autophagy by modulating cellular metabolism</article-title>
          <source>Autophagy</source>
          <issn>1554-8627</issn>
          <fpage>1</fpage>
          <lpage>14</lpage>
          <pub-id pub-id-type="doi">10.1080/15548627.2023.2228533</pub-id>
        </element-citation>
      </ref>
      <ref id="R11">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gueldener</surname>
              <given-names>U.</given-names>
            </name>
          </person-group>
          <year>2002</year>
          <month>3</month>
          <day>15</day>
          <article-title>A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast</article-title>
          <source>Nucleic Acids Research</source>
          <volume>30</volume>
          <issue>6</issue>
          <issn>1362-4962</issn>
          <fpage>23e</fpage>
          <lpage>23</lpage>
          <pub-id pub-id-type="doi">10.1093/nar/30.6.e23</pub-id>
        </element-citation>
      </ref>
      <ref id="R12">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>He</surname>
              <given-names>Congcong</given-names>
            </name>
            <name>
              <surname>Song</surname>
              <given-names>Hui</given-names>
            </name>
            <name>
              <surname>Yorimitsu</surname>
              <given-names>Tomohiro</given-names>
            </name>
            <name>
              <surname>Monastyrska</surname>
              <given-names>Iryna</given-names>
            </name>
            <name>
              <surname>Yen</surname>
              <given-names>Wei-Lien</given-names>
            </name>
            <name>
              <surname>Legakis</surname>
              <given-names>Julie E.</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
          </person-group>
          <year>2006</year>
          <month>12</month>
          <day>18</day>
          <article-title>Recruitment of Atg9 to the preautophagosomal structure by Atg11 is essential for selective autophagy in budding yeast</article-title>
          <source>The Journal of Cell Biology</source>
          <volume>175</volume>
          <issue>6</issue>
          <issn>1540-8140</issn>
          <fpage>925</fpage>
          <lpage>935</lpage>
          <pub-id pub-id-type="doi">10.1083/jcb.200606084</pub-id>
        </element-citation>
      </ref>
      <ref id="R13">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kanki</surname>
              <given-names>Tomotake</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Ke</given-names>
            </name>
            <name>
              <surname>Baba</surname>
              <given-names>Misuzu</given-names>
            </name>
            <name>
              <surname>Bartholomew</surname>
              <given-names>Clinton R.</given-names>
            </name>
            <name>
              <surname>Lynch-Day</surname>
              <given-names>Melinda A.</given-names>
            </name>
            <name>
              <surname>Du</surname>
              <given-names>Zhou</given-names>
            </name>
            <name>
              <surname>Geng</surname>
              <given-names>Jiefei</given-names>
            </name>
            <name>
              <surname>Mao</surname>
              <given-names>Kai</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>Zhifen</given-names>
            </name>
            <name>
              <surname>Yen</surname>
              <given-names>Wei-Lien</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
          </person-group>
          <year>2009</year>
          <month>11</month>
          <day>15</day>
          <article-title>A Genomic Screen for Yeast Mutants Defective in Selective Mitochondria Autophagy</article-title>
          <source>Molecular Biology of the Cell</source>
          <volume>20</volume>
          <issue>22</issue>
          <issn>1059-1524</issn>
          <fpage>4730</fpage>
          <lpage>4738</lpage>
          <pub-id pub-id-type="doi">10.1091/mbc.e09-03-0225</pub-id>
        </element-citation>
      </ref>
      <ref id="R14">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lempiäinen</surname>
              <given-names>Harri</given-names>
            </name>
            <name>
              <surname>Uotila</surname>
              <given-names>Aino</given-names>
            </name>
            <name>
              <surname>Urban</surname>
              <given-names>Jörg</given-names>
            </name>
            <name>
              <surname>Dohnal</surname>
              <given-names>Ilse</given-names>
            </name>
            <name>
              <surname>Ammerer</surname>
              <given-names>Gustav</given-names>
            </name>
            <name>
              <surname>Loewith</surname>
              <given-names>Robbie</given-names>
            </name>
            <name>
              <surname>Shore</surname>
              <given-names>David</given-names>
            </name>
          </person-group>
          <year>2009</year>
          <month>3</month>
          <day>1</day>
          <article-title>Sfp1 Interaction with TORC1 and Mrs6 Reveals Feedback Regulation on TOR Signaling</article-title>
          <source>Molecular Cell</source>
          <volume>33</volume>
          <issue>6</issue>
          <issn>1097-2765</issn>
          <fpage>704</fpage>
          <lpage>716</lpage>
          <pub-id pub-id-type="doi">10.1016/j.molcel.2009.01.034</pub-id>
        </element-citation>
      </ref>
      <ref id="R15">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Li</surname>
              <given-names>Jiexin</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Haisheng</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Hongsheng</given-names>
            </name>
          </person-group>
          <year>2022</year>
          <month>1</month>
          <day>1</day>
          <article-title>
            N
                    
            <sup>1</sup>
            
                    -methyladenosine modification in cancer biology: Current status and future perspectives
          </article-title>
          <source>Computational and Structural Biotechnology Journal</source>
          <volume>20</volume>
          <issn>2001-0370</issn>
          <fpage>6578</fpage>
          <lpage>6585</lpage>
          <pub-id pub-id-type="doi">10.1016/j.csbj.2022.11.045</pub-id>
        </element-citation>
      </ref>
      <ref id="R16">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Longtine</surname>
              <given-names>Mark S.</given-names>
            </name>
            <name>
              <surname>Mckenzie III</surname>
              <given-names>Amos</given-names>
            </name>
            <name>
              <surname>Demarini</surname>
              <given-names>Douglas J.</given-names>
            </name>
            <name>
              <surname>Shah</surname>
              <given-names>Nirav G.</given-names>
            </name>
            <name>
              <surname>Wach</surname>
              <given-names>Achim</given-names>
            </name>
            <name>
              <surname>Brachat</surname>
              <given-names>Arndt</given-names>
            </name>
            <name>
              <surname>Philippsen</surname>
              <given-names>Peter</given-names>
            </name>
            <name>
              <surname>Pringle</surname>
              <given-names>John R.</given-names>
            </name>
          </person-group>
          <year>1998</year>
          <month>12</month>
          <day>4</day>
          <article-title>Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae</article-title>
          <source>Yeast</source>
          <volume>14</volume>
          <issue>10</issue>
          <issn>0749-503X</issn>
          <fpage>953</fpage>
          <lpage>961</lpage>
          <pub-id pub-id-type="doi">10.1002/(sici)1097-0061(199807)14:10&lt;953::aid-yea293&gt;3.0.co;2-u</pub-id>
        </element-citation>
      </ref>
      <ref id="R17">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Marion</surname>
              <given-names>Rosa M.</given-names>
            </name>
            <name>
              <surname>Regev</surname>
              <given-names>Aviv</given-names>
            </name>
            <name>
              <surname>Segal</surname>
              <given-names>Eran</given-names>
            </name>
            <name>
              <surname>Barash</surname>
              <given-names>Yoseph</given-names>
            </name>
            <name>
              <surname>Koller</surname>
              <given-names>Daphne</given-names>
            </name>
            <name>
              <surname>Friedman</surname>
              <given-names>Nir</given-names>
            </name>
            <name>
              <surname>O'Shea</surname>
              <given-names>Erin K.</given-names>
            </name>
          </person-group>
          <year>2004</year>
          <month>9</month>
          <day>7</day>
          <article-title>Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene expression</article-title>
          <source>Proceedings of the National Academy of Sciences</source>
          <volume>101</volume>
          <issue>40</issue>
          <issn>0027-8424</issn>
          <fpage>14315</fpage>
          <lpage>14322</lpage>
          <pub-id pub-id-type="doi">10.1073/pnas.0405353101</pub-id>
        </element-citation>
      </ref>
      <ref id="R18">
        <element-citation publication-type="book-chapter">
          <person-group person-group-type="author">
            <name>
              <surname>Noda</surname>
              <given-names>Takeshi</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
          </person-group>
          <year>2008</year>
          <article-title>Chapter 3 The Quantitative Pho8Δ60 Assay of Nonspecific Autophagy</article-title>
          <source>Methods in Enzymology</source>
          <issn>0076-6879</issn>
          <fpage>33</fpage>
          <lpage>42</lpage>
          <pub-id pub-id-type="doi">10.1016/s0076-6879(08)03203-5</pub-id>
        </element-citation>
      </ref>
      <ref id="R19">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Noda</surname>
              <given-names>Takeshi</given-names>
            </name>
            <name>
              <surname>Ohsumi</surname>
              <given-names>Yoshinori</given-names>
            </name>
          </person-group>
          <year>1998</year>
          <month>2</month>
          <day>1</day>
          <article-title>Tor, a Phosphatidylinositol Kinase Homologue, Controls Autophagy in Yeast</article-title>
          <source>Journal of Biological Chemistry</source>
          <volume>273</volume>
          <issue>7</issue>
          <issn>0021-9258</issn>
          <fpage>3963</fpage>
          <lpage>3966</lpage>
          <pub-id pub-id-type="doi">10.1074/jbc.273.7.3963</pub-id>
        </element-citation>
      </ref>
      <ref id="R20">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Oie</surname>
              <given-names>Shohei</given-names>
            </name>
            <name>
              <surname>Matsuzaki</surname>
              <given-names>Kazuya</given-names>
            </name>
            <name>
              <surname>Yokoyama</surname>
              <given-names>Wataru</given-names>
            </name>
            <name>
              <surname>Tokunaga</surname>
              <given-names>Shinji</given-names>
            </name>
            <name>
              <surname>Waku</surname>
              <given-names>Tsuyoshi</given-names>
            </name>
            <name>
              <surname>Han</surname>
              <given-names>Song-Iee</given-names>
            </name>
            <name>
              <surname>Iwasaki</surname>
              <given-names>Naoya</given-names>
            </name>
            <name>
              <surname>Mikogai</surname>
              <given-names>Aya</given-names>
            </name>
            <name>
              <surname>Yasuzawa-Tanaka</surname>
              <given-names>Kayoko</given-names>
            </name>
            <name>
              <surname>Kishimoto</surname>
              <given-names>Hiroyuki</given-names>
            </name>
            <name>
              <surname>Hiyoshi</surname>
              <given-names>Hiromi</given-names>
            </name>
            <name>
              <surname>Nakajima</surname>
              <given-names>Yuka</given-names>
            </name>
            <name>
              <surname>Araki</surname>
              <given-names>Toshiyuki</given-names>
            </name>
            <name>
              <surname>Kimura</surname>
              <given-names>Keiji</given-names>
            </name>
            <name>
              <surname>Yanagisawa</surname>
              <given-names>Junn</given-names>
            </name>
            <name>
              <surname>Murayama</surname>
              <given-names>Akiko</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>5</month>
          <day>1</day>
          <article-title>Hepatic rRNA Transcription Regulates High-Fat-Diet-Induced Obesity</article-title>
          <source>Cell Reports</source>
          <volume>7</volume>
          <issue>3</issue>
          <issn>2211-1247</issn>
          <fpage>807</fpage>
          <lpage>820</lpage>
          <pub-id pub-id-type="doi">10.1016/j.celrep.2014.03.038</pub-id>
        </element-citation>
      </ref>
      <ref id="R21">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Peifer</surname>
              <given-names>Christian</given-names>
            </name>
            <name>
              <surname>Sharma</surname>
              <given-names>Sunny</given-names>
            </name>
            <name>
              <surname>Watzinger</surname>
              <given-names>Peter</given-names>
            </name>
            <name>
              <surname>Lamberth</surname>
              <given-names>Stefanie</given-names>
            </name>
            <name>
              <surname>Kötter</surname>
              <given-names>Peter</given-names>
            </name>
            <name>
              <surname>Entian</surname>
              <given-names>Karl-Dieter</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>11</month>
          <day>22</day>
          <article-title>Yeast Rrp8p, a novel methyltransferase responsible for m1A 645 base modification of 25S rRNA</article-title>
          <source>Nucleic Acids Research</source>
          <volume>41</volume>
          <issue>2</issue>
          <issn>1362-4962</issn>
          <fpage>1151</fpage>
          <lpage>1163</lpage>
          <pub-id pub-id-type="doi">10.1093/nar/gks1102</pub-id>
        </element-citation>
      </ref>
      <ref id="R22">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Robinson</surname>
              <given-names>Jane S.</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
            <name>
              <surname>Banta</surname>
              <given-names>Lois M.</given-names>
            </name>
            <name>
              <surname>Emr</surname>
              <given-names>Scott D.</given-names>
            </name>
          </person-group>
          <year>1988</year>
          <month>11</month>
          <day>1</day>
          <article-title>
            Protein Sorting in 
            <italic>Saccharomyces cerevisiae</italic>
            : Isolation of Mutants Defective in the Delivery and Processing of Multiple Vacuolar Hydrolases
          </article-title>
          <source>Molecular and Cellular Biology</source>
          <volume>8</volume>
          <issue>11</issue>
          <issn>1098-5549</issn>
          <fpage>4936</fpage>
          <lpage>4948</lpage>
          <pub-id pub-id-type="doi">10.1128/mcb.8.11.4936-4948.1988</pub-id>
        </element-citation>
      </ref>
      <ref id="R23">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sharma</surname>
              <given-names>Sunny</given-names>
            </name>
            <name>
              <surname>Hartmann</surname>
              <given-names>Johannes David</given-names>
            </name>
            <name>
              <surname>Watzinger</surname>
              <given-names>Peter</given-names>
            </name>
            <name>
              <surname>Klepper</surname>
              <given-names>Arvid</given-names>
            </name>
            <name>
              <surname>Peifer</surname>
              <given-names>Christian</given-names>
            </name>
            <name>
              <surname>Kötter</surname>
              <given-names>Peter</given-names>
            </name>
            <name>
              <surname>Lafontaine</surname>
              <given-names>Denis L. J.</given-names>
            </name>
            <name>
              <surname>Entian</surname>
              <given-names>Karl-Dieter</given-names>
            </name>
          </person-group>
          <year>2018</year>
          <month>8</month>
          <day>9</day>
          <article-title>A single N1-methyladenosine on the large ribosomal subunit rRNA impacts locally its structure and the translation of key metabolic enzymes</article-title>
          <source>Scientific Reports</source>
          <volume>8</volume>
          <issue>1</issue>
          <issn>2045-2322</issn>
          <pub-id pub-id-type="doi">10.1038/s41598-018-30383-z</pub-id>
        </element-citation>
      </ref>
      <ref id="R24">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tasmi</surname>
              <given-names>Tabassum Ahmad</given-names>
            </name>
            <name>
              <surname>Solomon</surname>
              <given-names>Emily</given-names>
            </name>
            <name>
              <surname>Avogo</surname>
              <given-names>Emmanuella Wesome</given-names>
            </name>
            <name>
              <surname>Badenahalli Narasimhaiah</surname>
              <given-names>Swaroopa</given-names>
            </name>
            <name>
              <surname>Delorme-Axford</surname>
              <given-names>Elizabeth</given-names>
            </name>
          </person-group>
          <year>2026</year>
          <month>2</month>
          <day>6</day>
          <article-title>
            The nonsense-mediated mRNA decay factor Upf3 negatively regulates bulk autophagy progression in
                    
            <italic>Saccharomyces cerevisiae</italic>
          </article-title>
          <source>Autophagy Reports</source>
          <volume>5</volume>
          <issue>1</issue>
          <issn>2769-4127</issn>
          <pub-id pub-id-type="doi">10.1080/27694127.2026.2623730</pub-id>
        </element-citation>
      </ref>
      <ref id="R25">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Teste</surname>
              <given-names>Marie-Ange</given-names>
            </name>
            <name>
              <surname>Duquenne</surname>
              <given-names>Manon</given-names>
            </name>
            <name>
              <surname>François</surname>
              <given-names>Jean M</given-names>
            </name>
            <name>
              <surname>Parrou</surname>
              <given-names>Jean-Luc</given-names>
            </name>
          </person-group>
          <year>2009</year>
          <month>10</month>
          <day>30</day>
          <article-title>Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae</article-title>
          <source>BMC Molecular Biology</source>
          <volume>10</volume>
          <issue>1</issue>
          <issn>1471-2199</issn>
          <pub-id pub-id-type="doi">10.1186/1471-2199-10-99</pub-id>
        </element-citation>
      </ref>
      <ref id="R26">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsukada</surname>
              <given-names>Miki</given-names>
            </name>
            <name>
              <surname>Ohsumi</surname>
              <given-names>Yoshinori</given-names>
            </name>
          </person-group>
          <year>1993</year>
          <month>10</month>
          <day>25</day>
          <article-title>
            Isolation and characterization of autophagy‐defective mutants of 
            <italic>Saccharomyces cerevisiae</italic>
          </article-title>
          <source>FEBS Letters</source>
          <volume>333</volume>
          <issue>1-2</issue>
          <issn>0014-5793</issn>
          <fpage>169</fpage>
          <lpage>174</lpage>
          <pub-id pub-id-type="doi">10.1016/0014-5793(93)80398-e</pub-id>
        </element-citation>
      </ref>
      <ref id="R27">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wen</surname>
              <given-names>Xin</given-names>
            </name>
            <name>
              <surname>Gatica</surname>
              <given-names>Damián</given-names>
            </name>
            <name>
              <surname>Yin</surname>
              <given-names>Zhangyuan</given-names>
            </name>
            <name>
              <surname>Hu</surname>
              <given-names>Zehan</given-names>
            </name>
            <name>
              <surname>Dengjel</surname>
              <given-names>Jörn</given-names>
            </name>
            <name>
              <surname>Klionsky</surname>
              <given-names>Daniel J.</given-names>
            </name>
          </person-group>
          <year>2019</year>
          <month>9</month>
          <day>8</day>
          <article-title>
            The transcription factor Spt4-Spt5 complex regulates the expression of
                    
            <italic>ATG8</italic>
            
                    and
                    
            <italic>ATG41</italic>
          </article-title>
          <source>Autophagy</source>
          <volume>16</volume>
          <issue>7</issue>
          <issn>1554-8627</issn>
          <fpage>1172</fpage>
          <lpage>1185</lpage>
          <pub-id pub-id-type="doi">10.1080/15548627.2019.1659573</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>